CN1263863C - Method for improving plant nutrition quality utilizing gene engineering technology - Google Patents

Abstract

The present invention provides a fusion gene (hLF: SEKDEL) comprising the full-length cDNA coding sequence of human lactoferrin (hLF) and the sequence of a plant endoplasmic reticulum retention signal peptide (SEKDEL), which relates to a plant high-efficient expression carrier constructed by the fusion gene and started and expressed by an albumen specific expression promoter or a fruit specific expression promoter or a constructive expression promoter. The present invention also relates to plant cells converted by the expression carrier, transgenic plants produced by the converted cells and expressing the hLF and descendants thereof, wherein the transgenic plants comprise vegetable seeds and plant tissue. The present invention also provides a method for detecting an hLF nucleotide sequence and a polypeptide in a sample.

Description

A kind of method of utilizing genetic engineering technique improvement plant nutrition quality

Technical field

The present invention relates to genetically engineered and transgenic plant field.Particularly, the present invention relates to the carrier that a kind of foreign gene (as human lactoferrin gene) efficiently expresses in plant seed, fruit or other tissue, and in plant seed, fruit or other tissue the method for efficiently expressing exogenous gene.

Background technology

Has stronger albumen complex functionality in fruit or the seed, if can utilize transgenic technology with foreign gene particularly have the gene of important medical value such as human erythropoietin gene, human growth hormone gene changes in the plant, just might produce a large amount of pharmaceutical proteins.The intravital many proteic physiologically actives of people are relevant with the modification after the translation, and the albumen by prokaryotic expression is the biologically active not because lacking posttranslational modification usually.Express these albumen not only cost height but also conditional request height with yeast or animal cell culture, express these albumen with transgenic plant, its product near naturally promptly have higher biological activity, expression amount height, cost is low and simple.

Utilize the agrobacterium-mediated transformation technical transform to advance the intravital gene of plant, it is at random in intravital genomic integration of plant and expression, if foreign gene has stronger activity, if express at random or ectopic expression might cause injury to transgenic plant, in addition dead.

Therefore this area presses for the carrier and the technology of special and efficiently expressing exogenous gene in seed (as rice paddy seed), fruit (as tamato fruit) and other edible tissues (as blade) plant.

Lactoferrin is an iron-binding protein main in the milk, mainly is distributed in the secretory product such as mammiferous milk, blood, tear, bile, seminal fluid, amniotic fluid and intestinal fluid, and is the highest with content among the human milk in Mammals.Human lactoferrin (Human lactoferrin, hLF) because of trypsinase and similar proteolytic enzyme are had anti-degradation capability, particularly strengthen in conjunction with anti-degradation capability behind the iron ion, therefore, in enteron aisle, can be absorbed with the form of complete molecule, helping baby's absorption to iron in growth, is one of important member in the human body non-specific immunity system, and human lactoferrin has very strong restraining effect (Harmsen etc. 1995) to some human pathogen with virus; In addition, lactoferrin also has the various biological function.At present, clone bovine lactoferrin gene and the cDNA sequence of multiple animal, and in systems such as mammary gland, insect, aspergillus, expressed the lactoferrin of reorganization.It is the human lactoferrin gene of promotor that Holland Php has expressed with ox α s1-casein gene 5 ' regulating and controlling sequence the nineties in 20th century in bovine mammary gland, by price at that time, annual value of production can reach 5,000,000,000 dollars, this shows that the production of human lactoferrin has huge economic benefit.

Summary of the invention

First purpose of the present invention just provides a kind of fusion gene and carrier that is adapted at efficiently expressing in plant seed, fruit or other tissue human lactoferrin.

Second purpose of the present invention provides a kind of method of utilizing seed, fruit or other the organizationally efficient expressing human lactoferrin of transgenic plant, thereby efficiently expresses human lactoferrin in plant seed, fruit or other tissue.

The 3rd purpose of the present invention provides a kind of method of utilizing gene recombination technology to produce above-mentioned new human lactoferrin.

The present invention also provides this new human lactoferrin and the application of encoding sequence in the plant nutrition quality-improving thereof.

A first aspect of the present invention, the carrier that efficiently expresses fusion gene hLF:SEKDEL in fruit, seed or other tissue is provided, and this carrier from 5 ' to 3 ' comprises following element successively: endosperm specific expression promoter or fruit special expression promoter or composition type expression promoter, human lactoferrin total length coded cDNA sequence (hLF), plant ER retention signal peptide (SEKDEL) sequence, terminator sequence.Preferably, in promotor and human lactoferrin total length coded cDNA sequence one joint sequence is arranged, the latter end of the encoding sequence of plant ER retention signal peptide also has a joint sequence.

In one embodiment of the invention, there is a joint sequence to have a BamHI site in promotor and human lactoferrin total length coded cDNA sequence; The latter end of the encoding sequence of plant ER retention signal peptide also has a joint sequence to have a SacI site.

More preferably, human lactoferrin fusion gene hLF:SEKDEL has the nucleotide sequence shown in the SEQ ID NO.3; And by the aminoacid sequence shown in the SEQ ID NO.4; The encoding sequence of plant ER retention signal peptide has the nucleotide sequence shown in the SEQ ID NO.5, and the nucleotide sequence of other respective coding (seeing Table 1).

Lactoferrin is a kind of multi-functional glycoprotein, has effects such as antibiotic and antiviral, is a kind of pharmaceutical protein with important value.In one embodiment of the invention, select the foreign gene of people's lactoferrin for use as research.

The present invention at first provides a kind of carrier of regulating and control foreign gene specific high-efficiency expression in plant seed, fruit and other tissue, for foreign gene (human lactoferrin) is efficiently expressed in plant seed, fruit and other tissue, the present invention has utilized plant seed or fruit specific expression controlling element, or plant constitutive expression controlling element has made up the carrier that efficiently expresses in fruit, seed or other tissue such as the blade.

In one embodiment of the invention, constructed carrier comprises following sequential element endosperm specific expression promoter or fruit special expression promoter or plant composition type expression promoter, terminator sequence.

In one embodiment of the invention, in the particular organization of plant, accumulate, behind the complete encoding sequence of human lactoferrin, added the encoding sequence of plant ER retention signal peptide, thereby made up fusion gene hLF:SEKDEL in order to make human lactoferrin.

Thereby the invention allows for by in plant, expressing the method that described fusion gene realizes improving the plant nutrition quality.Its step is as follows:

Said plant is a higher plant in the aforesaid method, uses tomato, paddy rice in the embodiment of back.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only are used to illustrate the present invention, rather than be used to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following specific embodiment, common condition according to routine, people such as Sambrook for example, molecular cloning: laboratory manual (New York:Cold SpringHarbor Laboratory Press, 1989) condition described in, the perhaps condition of advising according to manufacturer.

Embodiment 1 efficiently expresses the structure of the carrier of fusion gene hLF:SEKDEL in plant seed or fruit or other tissue

The vector construction process of this embodiment is as follows, and this gene constructs is the carrier of the fusion gene (hLF:SEKDEL) of expressing in fruit or endosperm or other tissue such as blade.The 35S promoter CaMV35S that wherein regulating and controlling sequence of specifically expressing derives from tamato fruit specific expression promoter PG in fruit, the regulating and controlling sequence of specifically expressing derives from zein promotor 19Z in endosperm, the promotor that efficiently expresses in other tissue of plant derives from Caulimovirus, encoding sequence derives from human lactoferrin eDNA gene order.

The building process that contains the carrier of fusion rotein hLF:SEKDEL:

1) sequence of fusion gene hLF:SEKDEL

Encoding sequence according to hLF designs and synthesizes following primer:

hLFFP： CGGATCCATGAAACTTGTCTTCCTCG(SEQ ID NO.1)

hLFRP： TTTGAGCTC GGACTTCCTGAGGAATTCACAG(SEQ ID NO.2)

Wherein the hLFFP primer sequence has BamHI restriction enzyme site (following picture horizontal line), hLFRP that the complementary sequence (adding the frame sequence) of SacI restriction enzyme site (following picture horizontal line) and SEKDEL encoding sequence is arranged.

With the total RNA of human blood cell is template, adopt aforesaid primer to obtain hLF:SEKDEL fusion gene full length sequence (SEQ ID NO.3) by RT-PCR, this fusion gene total length length is 2189bp, 717 amino-acid residues of encoding, molecular weight is 79,073 dalton, iso-electric point (pI) is 8.43.

2) enzyme is cut

The plasmid vector that will contain the sequence that clones downcuts fusion gene hLF:SEKDEL with BamHI and SacI double digestion.

3) connect

With the gene that downcuts be connected into BamHI and SaeI enzyme cut through in the big fragment of transforming of gene plasmid pCAMBIA2300 plant expression vector that contains fruit, seed-specific expression promoter, detect the intestinal bacteria positive colony of conversion with blue hickie screening.

Embodiment 2 obtains to contain the Agrobacterium of fusion gene hLF:SEKDEL and the acquisition of transgenic paddy rice and tomato plant

The conversion process of this embodiment is as described below, and the result of this step is transgenic paddy rice and the tomato plant that obtains to have goal gene.

1. contain the acquisition of the agrobacterium strains of goal gene (fusion gene hLF:SEKDEL) expression vector

On the basis that has successfully made up the plant expression vector p2300-hLF-SEKDEL that contains the hLF:SEKDEL fusion gene, by freeze-thaw method p2300-hLF-SEKDEL is imported in the Agrobacterium (as EHA105 or LBA4404), utilize agrobacterium-mediated transformation technical transform model plant paddy rice or tomato.

2. the acquisition of transgenic rice plant

1) inducing and subculture of callus: in sterile vessel, paddy rice (as kind 1826) the seed maturity embryo or the rataria that shell are passed through following washing: 75% alcohol soaked 1-2 minute, after using aseptic washing 2 times again, 25% clorox soak 30 minutes (during to shake several times, or be placed on the shaking table shake), with aseptic washing 4-5 time, seed is moved on on the aseptic filter paper, suck dry moisture is received MS ₂(MS ₀+ 2,4-D 2ppm) on, 25 in every ware is then 25 ℃ of dark cultivations.3-4 is after week, and the yellow callus that paddy rice is grown forwards fresh MS to ₂Last continuation is cultivated, and later per 2 all subcultures once.Behind 2-4 subculture, can select light yellow, granular embryo callus subculture to prepare to cultivate altogether with bacterium.

2) activation of bacterium: take glycerine and be stored in Agrobacterium 50-100 μ l (yeast powder 5g in the LB of 2ml liquid nutrient medium of-20 ℃; Peptone 10g; NaCl 10g; PH 7.0; 1 liter of cumulative volume.Need autoclaving), and add corresponding microbiotic [as Rifampin 20-50ppm; Streptomycin sulphate 50-100ppm; Kantlex 50ppm; Spectinomycin 50-100ppm; Paraxin 20-50ppm], on the shaking table with 250rpm about, 25 ℃ shake bacterium 24-36 hour to OD ₆₀₀=1.0.Get and newly shake bacterium 100-200 μ l in the LB of 30ml liquid nutrient medium, and add corresponding microbiotic (concentration, condition the same), through about 12 hours, bacterium liquid reaches OD ₆₀₀During=0.8-1.0, promptly can be used to transform.

3) cultivate altogether: bacterium liquid is centrifugal with 5000rpm * 5min in the centrifuge tube of aseptic 50ml, removes supernatant, uses the MS of 30ml again _o(MS ₂+ Syringylethanone AS 100 μ mol/l) liquid nutrient medium is resuspended.The callus of choosing in advance was immersed in the bacterium liquid after 15-30 minute, inhales with aseptic filter paper or thieving paper again and remove unnecessary bacterium liquid (need not further blot), place MS _CoOn the solid medium (can cover one deck aseptic filter paper), 25 ℃ of dark cultivations 2-3 days.

4) wash bacterium and screening: the callus of cultivating is used aseptic water washing 3 times earlier altogether, is dipped in the MS that contains cephamycin (250mg/1) again _CoIn the liquid nutrient medium 20-30 minute, after callus blotted with aseptic filter paper or thieving paper, inoculation was selected substratum S ₁(MS ₂+ kantlex 50ppm+Cef (cephamycin) 250ppm) goes up screening 2-3 week.Select the callus that newly grows then and be inoculated in fresh selection substratum S ₁Last screening 2-3 week.

5) plant regeneration with take root: will be inoculated into dark the cultivation about 10 days on the pre-differentiation substratum through the kanamycin-resistant callus tissue of selecting to obtain for 2 times, and forward to again and carry out illumination cultivation on the division culture medium.About 1-2 month, forward seedling high about 2cm to root media (1/2M _S0+ kantlex 50ppm+NAA 0.2ppm+ plant gel phytagel 2.5g/l+ sucrose 15g/l) takes root on.After seedling grows to 10cm height and well developed root system, plant is taken out, clean the solid medium that adheres to sterilized water, move in the soil, just begun to treat to take off lens again behind the robust plant with lens cover several days, cultivate in the greenhouse.

3. utilize leaf dish method to transform tomato:

1) is sowed on the 1/2MS substratum after the tomato seeds sterilization, grew cotyledon in about about 10 days;

2) take glycerine and be stored in Agrobacterium 50-100 μ l (yeast powder 5g in the LB of 2ml liquid nutrient medium of-20 ℃; Peptone 10g; NaCl 10g; PH 7.0; 1 liter of cumulative volume.Need autoclaving), and add corresponding microbiotic [as Rifampin 20-50ppm; Streptomycin sulphate 50-100ppm; Kantlex 50ppm; Spectinomycin 50-100ppm; Paraxin 20-50ppm], on the shaking table with 250rpm about, 25 ℃ shake bacterium 24-36 hour to OD ₆₀₀=1.0.Get and newly shake bacterium 100-200 μ l in the LB of 30ml liquid nutrient medium, and add corresponding microbiotic (concentration, condition the same), through about 12 hours, bacterium liquid reaches OD ₆₀₀During=0.8-1.0, promptly can be used to transform.

3) the centrifugal 10min of 4000g under the room temperature;

4) abandon supernatant, thalline suspends with the 1/2MS liquid nutrient medium, adds cotyledon and soaks 10 minutes;

5) on aseptic filter paper, blot bacterium liquid; Cotyledon is placed on the MS substratum, cultivated altogether two days;

6) blade is forwarded on the callus and division culture medium (MS+ZT 1.0mg/L+IAA 1.0mg/L+Kan50mg/L+cb 250mg/L) that contains Kan, the formation of 7-15 days visible resistant callis and plant regeneration are cultivated in 25-28 ℃ of illumination down;

7) treat bud grow up about 1-2 centimetre of back the time young shoot be implanted in carry out root culture in the root media on (1/2MS), take root about 2-7 days;

8) behind the well developed root system, plant is taken out, clean the solid medium that adheres to sterilized water, in one week of domestication in perlite, the MS pouring with 1% moves in the soil.

Embodiment 3 detections of fusion gene hLF:SEKDEL in transgenic paddy rice and tomato

This experiment is used for detecting the fusion gene of transfer-gen plant.

1. sample preparation

Not genetically modified paddy rice and tomato, and genetically modified paddy rice and tomato, blade is got in operation routinely, and-20 ℃ of preservations are standby.

2. detection method

1) the quick extracting of genomic dna: the blade of preserving is carried out the extracting of total DNA according to improved method of CTAB;

2) enzyme is cut and electrophoresis: get about 10 micrograms of genome DNA and adopt restriction enzyme BamHI and SacI to carry out enzyme to cut, enzyme is cut product at 1% sepharose, 1-2V/cm, and electrophoresis is more than 12 hours;

3) sex change and neutralization: add sex change liquid (1.5M NaCl, 0.5M NaOH) and make glue sex change 45 minutes (jog), add in neutralizer (1.5M NaCl, 0.5M Tris-HCl (the pH8.0)) jog and 45 minutes.

4) change film: nylon membrane evenly is layered on the glue, and shop 3MM Waterman thieving paper is three above, repaves paper tower (5-10 centimetre) and presses weight 18 hours; To remove the gel pieces on striping surface, at room temperature airing is fixed 2 hours for 80 ℃ with 5 * SSC flushing membrane.

5) probe preparation: with BamHI and SacI digested plasmid, reclaim the fragment that contains fusion gene hLF:SEDKEL, adopt random primer labelling test kit label probe.

6) prehybridization and hybridization: carrier film prehybridization solution (5 * SSPE, 5 * Denhardt ' s Solution, 0.1%SDS, 100ug/ml nonhomol ogus Salman Sperm blocking DNA, 50%Formamide) in 42 ℃ of prehybridizations 4 hours.Probe was joined in the prehybridization solution in 42 ℃ hybridization 16 hours.

7) washing the mould sheet develops a film: adopt Washing Solution (1 * SSC, 0.1%SDS) 65 ℃ of washings are 1 hour, repeat this step after, the Hybond membrane after the washing is fixed with preservative film, put into the X-ray sheet in the darkroom, preserved two days for-70 ℃.Take out the X-ray sheet in the darkroom, developed 5 minutes, result displayed on the mating plate is checked in photographic fixing 15 minutes.

The detection of expression of embodiment 4 fusion gene hLF:SEKDEL in transgenic paddy rice and tomato plant

This experiment is used for the detection of expression of the human lactoferrin of transfer-gen plant.

1. proteic extraction:

Get 50mg transgenic paddy rice shell seed or tomato mature fruit, add 100ul PBS (KH ₂PO ₄0.2g/l, Na ₂HPO ₄1.15g/l, KCl 0.2g/l, NaCl 8g/l) and damping fluid, grind in the 1.5ml centrifuge tube; 13000,4 ℃ centrifugal 10 minutes; Get supernatant, standby.

2. proteinic quantitative:

With reference to Bradford method (Bradford, 1976).Get the 2ul protein example, add 1ml Bradford reagent, behind the mixing, spectrophotometric instrumentation OD ₅₉₅Value.

3.SDS-PAGE isolated protein:

The preparation of SDS-PAGE is with reference to " molecular cloning " (Sambrook etc., 1989)

1) before the application of sample, sample (the vegetable-protein sample (30ug/ sample) and the commercially available human lactoferrin 50ng that comprise extraction) is placed the sample loading buffer (2 * sample loading buffer: glycerine 2.4g, 1M Tris-HCl pH6.81ml that contains 50mmol/L DTT; Bromjophenol blue 0.01%, H ₂O is settled to 20ml), boiled 10 minutes;

2) room temperature, electrophoresis under the 100V voltage reaches the gel bottom up to indicator (bromjophenol blue) forward position.

4. protein shifts on nitrocellulose membrane:

1) before the transfer, uses transfering buffering liquid (39mmol glycine, 48mmol Tris Base, 0.037%SDS, 20% methyl alcohol) balanced gel and nitrocellulose membrane 30 minutes;

2) shifted 1 hour with the half dry type electroporation under the room temperature, 3 layers of Whatman filter paper are respectively filled up in the gel both sides;

5. proteinic detection on the nitrocellulose membrane:

1) nitrocellulose membrane is immersed in the confining liquid, 37 ℃ are slowly shaken, seal 60 minutes (confining liquid: get the 5g skim-milk and be dissolved in 100ml 1 * PBS (containing the 0.5g sodium azide));

2) filter membrane is immersed in the lavation buffer solution 37 ℃ of washed twice, each 15 minutes;

3) add first antibody (antibody of anti-human lactoferrin), 37 ℃ of incubations 30 minutes; Same step b) is washed three times;

4) add second antibody (avidin-alkaline phosphatase enzyme complex), 37 ℃ of incubations 30 minutes;

5) with step 2), washed twice;

6) add the albumen specific band that human lactoferrin is observed in the substrate colour developing;

7) pass through to compare the power of the specific band of the human lactoferrin in the plant sample, calculate the expression amount of human lactoferrin in transgenic paddy rice seed and tamato fruit with the specific band of commercially available human lactoferrin.In this research, we have obtained 0.5% transgenic paddy rice and tomato that in transgenic paddy rice seed and tamato fruit human lactoferrin expression amount accounts for total soluble protein.The food that the transgenic paddy rice of the expressing human lactoferrin that these are cultivated and tomato can be used as tool special nutrition value is used.

The present invention mentioned to all documents all quote in this application as a reference, just quoted as a reference separately as each piece document.Should be understood that in addition after having read the above-mentioned content of lecturing, those skilled in the art can make various changes or modifications the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence that the present invention relates to and mark apportion are as follows:

1.SEQ the information of ID NO.1

(1) sequence signature:

(A) length: 26bp

(B) type: oligonucleotide

(C) chain: strand

(D) topological framework: linearity

(2) molecule type: oligonucleotide

(3) sequence description: SEQ ID NO.1

CGGATCCATGAAACTTGTCTTCCTCG

2.SEQ the information of ID NO.2

(1) sequence signature:

(A) length: 49bp

(B) type: oligonucleotide

(C) chain: strand

(D) topological framework: linearity

(2) molecule type: oligonucleotide

(3) sequence description: SEQ ID NO.2

TTTGAGCTCTTATAGCTCGTCTTTCTCGGACTTCCTGAGGAATTCACAG

3.SEQ the information of ID NO.3

(1) sequence signature:

(A) length: 2189bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(2) molecule type: Nucleotide

(3) sequence description: SEQ ID NO.3

1 tcct gctgttcctc ggggccctcg gactgtgtct

61 ggctggccgt aggagaagga gtgttcagtg gtgcgccgta tcccaacccg aggccacaaa

121 atgcttccaa tggcaaagga atatgagaaa agtgcgtggc cctcctgtca gctgcataaa

181 gagagactcc cccatccagt gtatccaggc cattgcggaa aacagggccg atgctgtgac

241 ccttgatggt ggtttcatat acgaggcagg cctggccccc tacaaactgc gacctgtagc

301 ggcggaagtc tacgggaccg aaagacagcc acgaactcac tattatgccg tggctgtggt

361 gaagaagggc ggcagctttc agctgaacga actgcaaggt ctgaagtcct gccacacagg

421 ccttcgcagg accgctggat ggaatgtccc tacagggaca cttcgtccat tcttgaattg

481 gacgggtcca cctgagccca ttgaggcagc tgtggccagg ttcttctcag ccagctgtgt

541 tcccggtgca gataaaggac agttccccaa cctgtgtcgc ctgtgtgcgg ggacagggga

601 aaacaaatgt gccttctcct cccaggaacc gtacttcagc tactctggtg ccttcaagtg

661 tctgagagac ggggctggag acgtggcttt tatcagagag agcacagtgt ttgaggacct

721 gtcagacgag gctgaaaggg acgagtatga gttactctgc ccagacaaca ctcggaagcc

781 agtggacaag ttcaaagact gccatctggc ccgggtccct tctcatgccg ttgtggcacg

841 aagtgtgaat ggcaaggagg atgccatctg gaatcttctc cgccaggcac aggaaaagtt

901 tggaaaggac aagtcaccga aattccagct ctttggctcc cctagtgggc agaaagatct

961 gctgttcaag gactctgcca ttgggttttc gagggtgccc ccgaggatag attctgggct

1021 gtaccttggc tccggctact tcactgccat ccagaacttg aggaaaagtg aggaggaagt

1081 ggctgcccgg cgtgcgcggg tcgtgtggtg tgcggtgggc gagcaggagc tgcgcaagtg

1141 taaccagtgg agtggcttga gcgaaggcag cgtgacctgc tcctcggcct ccaccacaga

1201 ggactgcatc gccctggtgc tgaaaggaga agctgatgcc atgagtttgg atggaggata

1261 tgtgtacact gcatgcaaat gtggtttggt gcctgtcctg gcagagaact acaaatccca

1321 acaaagcagt gaccctgatc ctaactgtgt ggatagacct gtggaaggat atcttgctgt

1381 ggcggtggtt aggagatcag acactagcct tacctggaac tctgtgaaag gcaagaagtc

1441 ctgccacacc gccgtggaca ggactgcagg ctggaatatc cccatgggcc tgctcttcaa

1501 ccagacgggc tcctgcaaat ttgatgaata tttcagtcaa agctgtgccc ctgggtctga

1561 cccgagatct aatctctgtg ctctgtgtat tggcgacgag cagggtgaga ataagtgcgt

1621 gcccaacagc aacgagagat actacggcta cactggggct ttccggtgcc tggctgagaa

1681 tgctggagac gttgcatttg tgaaagatgt cactgtcttg cagaacactg atggaaataa

1741 caatgaggca tgggctaagg atttgaagct ggcagacttt gcgctgctgt gcctcgatgg

1801 caaacggaag cctgtgactg aggctagaag ctgccatctt gccatggccc cgaatcatgc

1861 cgtggtgtct cggatggata aggtggaacg cctgaaacag gtgctgctcc accaacaggc

1921 taaatttggg agaaatggat ctgactgccc ggacaagttt tgcttattcc agtctgaaac

1981 caaaaacctt ctgttcaatg acaacactga gtgtctggcc agactccatg gcaaaacaac

2041 atatgaaaaa tatttgggac cacagtatgt cgcaggcatt actaatctga aaaagtgctc

2101 aacctccccc ctcctggaag c

2161

Annotate: the sequence in the frame is primer sequence or its complementary sequence of design

4.SEQ the information of ID NO.4

(1) sequence signature:

(A) length: 717 amino acid

(B) type: amino acid

(C) chain: strand

(D) topological framework: linearity

(2) molecule type: polypeptide

(3) sequence description: SEQ ID NO.4

MKLVFLVLLF LGALGLCLAG RRRRSVQWCA VSQPEATKCF QWQRNMRKVR

GPPVSCIKRD SPIQCIQAIA ENRADAVTLD GGFIYEAGLA PYKLRPVAAE

VYGTERQPRT HYYAVAVVKK GGSFQLNELQ GLKSCHTGLR RTAGWNVPTG

TLRPFLNWTG PPEPIEAAVA RFFSASCVPG ADKGQFPNLC RLCAGTGENK

CAFSSQEPYF SYSGAFKCLR DGAGDVAFIR ESTVFEDLSD EAERDEYELL

CPDNTRKPVD KFKDCHLARV PSHAVVARSV NGKEDAIWNL LRQAQEKFGK

DKSPKFQLFG SPSGQKDLLF KDSAIGFSRV PPRIDSGLYL GSGYFTAIQN

LRKSEEEVAA RRARVVWCAV GEQELRKCNQ WSGLSEGSVT CSSASTTEDC

IALVLKGEAD AMSLDGGYVY TACKCGLVPV LAENYKSQQS SDPDPNCVDR

PVEGYLAVAV VRRSDTSLTW NSVKGKKSCH TAVDRTAGWN IPMGLLFNQT

GSCKFDEYFS QSCAPGSDPR SNLCALCIGD EQGENKCVPN SNERYYGYTG

AFRCLAENAG DVAFVKDVTV LQNTDGNNNE AWAKDLKLAD FALLCLDGKR

KPVTEARSCH LAMAPNHAVV SRMDKVERLK QVLLHQQAKF GRNGSDCPDK

FCLFQSETKN LLFNDNTECL ARLHGKTTYE KYLGPQYVAG ITNLKKCSTS

PLLEACEFLR KSEKDEL

5.SEQ the information of ID NO.5

(1) sequence signature:

(A) length: 18bp

(B) type: oligonucleotide

(C) chain: strand

(D) topological framework: linearity

(2) molecule type: oligonucleotide

(3) sequence description: SEQ ID NO.5

TCCGAGAAAGACGAGCTA

(4) pairing encoding sequence of sequence SEKDEL and the sequence (table 1) formed thereof

S	E	K	D	E	L
						TCT	GAA	AAA	GAT	GAA	CTT
TCC	CTC
		TCA	CTA
TCG	CTG
		GAG	AAG	GAC	GAG	TTA
	AGT						TTG
AGC						ATT
	ATC

Claims (7)

1. carrier of expressing fusion gene in plant seed, fruit is characterized in that this carrier comprises following element successively with 5 ' to 3 ': endosperm specific expression promoter or fruit special expression promoter or be used for fusion gene hLF:SEKDEL, the terminator sequence that composition type expression promoter, human lactoferrin total length coded cDNA sequence and the plant ER retention signal peptide sequence of higher plant are formed.

2. carrier according to claim 1 is characterized in that between promotor flanking sequence and human lactoferrin total length coded cDNA sequence a joint sequence being arranged; Also has a joint sequence between the encoding sequence of plant ER retention signal peptide and the terminator sequence.

3. a fusion gene as claimed in claim 1 is characterized in that fusion gene hLF:SEKDEL, and its nucleotide sequence is shown in SEQ ID NO.3, and its aminoacid sequence is shown in SEQ ID NO.4.

4. fusion gene according to claim 3 is characterized in that wherein plant ER retention signal peptide-coding sequence is shown in SEQ ID NO.5.

5. fusion gene according to claim 3 is characterized in that making up the primer that encoding sequence adopted of this fusion gene, is respectively the nucleotide sequence shown in nucleotide sequence shown in the SEQ ID NO.1 and the SEQ ID NO.2.

6. thereby one kind is passed through to express the method that the described fusion gene of claim 1 realizes improving the higher plant nutritional quality in higher plant, it is characterized in that it comprises step:

(1) the described carrier that contains fusion gene hLF:SEKDEL is utilized agrobacterium-mediated transformation transform higher plant, obtain to be integrated with in the genome callus of fusion gene hLF:SEKDEL;

(2) callus that is obtained in the step (1) is carried out differentiation culture, filter out the transfer-gen plant and the offspring thereof that express this fusion gene, comprise plant seed, fruit and leaf;

(3) transgenic plant that obtained have additional nutritive value because of the human lactoferrin that contains expression in its seed, fruit and the leaf, can directly eat or be processed into other nutritive food or use as the interpolation raw material of other food.

7. method according to claim 6 is characterized in that described higher plant is tomato and paddy rice.