CN1408872A - Plasmid carrier of recombination human horny cell growth factor, its host and method for preparing recombination human horny cell growth factor - Google Patents

Abstract

The present invention relates to a kind of recombinant plasmid carrier of human horny cell growth factor or its allelic variantion body, its colibacillus host and the preparation process of recombinant human horny cell growth factor. The recombinant plasmid carrier consista recombinant human KGF or KGF derivative sequence, one cistron connected to KGF encoding gene and encoding 17 amino acids in the N end of lacZ encoding enzyme, and phage PL promoter. The plasmid of the present invention can express human KGF in colibacillus.

Description

A kind of plasmid vector of recombinant human horny cell growth factor-2, its host and prepare the method for recombinant human horny cell growth factor-2

Technical field

The present invention relates to the plasmid vector of a kind of recombinant human horny cell growth factor-2 or its allelic variant, relate in particular to the double-cistron expressing plasmid of a kind of recombinant human horny cell growth factor-2 and varient thereof.

The invention still further relates to by plasmid transformed host cells of the present invention.

The invention still further relates to the method for preparing recombinant human horny cell growth factor-2 and varient thereof.

Background technology

Keratinocyte growth factor (KGF) is the effector that the strongest known impelling at present comes from non-one-tenth fiber epithelial cell (particularly keratinocyte) propagation of mescenchymal tissue.The histology of KGFmRNA is distributed with its singularity: the expression of KGFmRNA is arranged in several matrix fibroblasts of organizing from embryo, newborn infant with on becoming fell, expression is also arranged in people's kidney, gi tract, and spongiocyte, lung, brain and various epithelial cell (bronchial epithelial cell that comprises squamous cell carcinoma, immortality, the keratinocyte of immortality and former generation the keratinocyte culture) in do not detect KGFmRNA.This histology of KGFmRNA distributes that prompting KGF produces and not subcutaneous in corium.KGF has the mitogenesis effect to successive mouse cell lines BALB/MK cell, Keratin sulfate and filagrim expression of gene confirm that also KGF influences the differentiation and the maturation of keratinocyte, these evidence proofs KGF acts on keratinocyte, influence differentiation and maturation (Rubin etal.Proc.Natl.Acad.Sci.USA, the 86:802-806 (1989) of keratinocyte; Finch etal., science, 245:752-755 (1989); Marchese etal., J.Cell.Phys.144:326-332 (1990)).KGF is except that the keratinocyte spinosity is swashed the effect, the nonkeratinocyte epithelial cell also there is hormesis: in vivo, KGF induces normal skin accessory structure (as cortex cell and hair follicle cell), the hyperplasia and the differentiation of liver cell (as liver cell) and respiratory film epithelial cell (as II type pneumonocyte), stimulate the hyperplasia and the growth (disclosed PCT patent application WO94/23032) of intestinal mucosa cell (producing mucoprotein goblet cell as the gastric gland intestinal glands, other epithelial cell in the pit cell of colon and the enteron aisle).

Play an important role in the process of tissue reparation of KGF after skin injury.When wound healing, KGFmRNA induces 160 times in the substrate keratinocyte, and aFGF, bFGF and FGF-5 only induce 2 to 10 times, and FGF-3, FGF-4, FGF-6 are not expressing normally or in the skin of damage.On the skin injury model of a pig, KGF can significantly promote skin regeneration.

The varient of KGF, these varients such as 23 amino acid whose KGF of N end disappearance have the biologic activity of natural KGF, and its biologic activity even also higher than natural KGF has been done detailed description in patent US patent5843883.

Based on the biological action of KGF, KGF is expected to be applied to treat or prevent the digestive tube damage that chemicotherapy causes, and other forms of digestive tube mucous membrane disease undermines other diseases.

The method for preparing at present KGF is to adopt gene engineering method.Disclosed PCT patent application WO90/108771 has described purifying KGF from the cell conditioned medium of people's embryo fibroblast, the partial amino-acid order-checking of isolated polypeptide, the clone of this gene reaches the KGF that expresses with the tool biologic activity that obtains recombinating in bacterial cell.Disclosed PCT patent application WO96/11951 has described the proteic novel analogs of KGF, and the clone of these novel analogs genes and the expression in intestinal bacteria (E.coli).

At expression in escherichia coli people KGF and varient thereof, because of expression product to toxic (the Ron et al of intestinal bacteria, J.Biol.Chem.268 (4): 2984-2988), KGF that gives expression to and varient thereof are accumulated in thalline seldom, thereby and must control the generation acquisition expression that assorted bacterium is controlled in basal expression by strictness.Ron etc. are with T7 promoter expression KGF and varient thereof, with BL21 (DE3) pLysE bacterial strain as the host bacterium to reduce basal expression.Relative other promotor, it is the strongest that the T7 promotor starts the ability of transcribing, and BL21 (DE3) host bacterium is also relatively good to the tolerance of toxic protein, BL21 (DE3) is a kind of protease-deficient bacterial strain still, but the expression amount of KGF that is obtained or KGF varient also only accounts for below 2% of total protein (Ron et al, J.Biol.Chem.268 (4): 2984-2988).That the expression method of describing among the US patent9513075 is used is the P of low basal expression _LCopy number was very low when promotor, used expression plasmid were cultivated at low temperature (30 ℃), thereby had further reduced basal expression.US patent5707805 has described with trk promoter expression KGF, and the basal expression of this promotor is higher relatively, thereby but used expression plasmid pKK233-2 is a kind of plasmid of low copy number has reduced basal expression to a certain extent.

Summary of the invention

The invention provides a kind of plasmid vector that contains recombinant human horny cell growth factor-2 gene or its allelic variant, this recombinant plasmid vector contains: the people KGF of reorganization or KGF derived sequence, 17 the amino acid whose cistrons of coding lacZ enzyme N end that are connected with the gene of encoded K GF, phage P _LPromotor.In a preferable embodiment of the present invention, this recombinant plasmid contains the KGF cDNA that useful PCR method obtains from Chinese's prepuce tissues.

Another object of the present invention has provided the recombinant plasmid institute transformed into escherichia coli host cell by above-mentioned express recombinant people KGF or its varient.

A further object of the present invention provides a kind of method of utilizing cupric ion at expression in escherichia coli recombinant human KGF or its varient, this method comprises: cultivating in containing the substratum of 1-10mM can expressing human KGF or the coli strain of its varient, the KGF that gives expression to or its varient exist with soluble form, the separation and purification expression product, KGF or its varient albumen obtain recombinating.In a preferred example, this coli strain is GI724/pLacKGF.

According to an aspect of the present invention, expression plasmid provided by the invention is to make up on the basis of the pTrxFus of invitrogen company expression system, the pTrxFus expression system of invitrogen company has the characteristic of low basal expression, and this specific character is determined by two aspects: that this expression system uses on the one hand is the P of low basal expression _LPromotor, thalline is cultivated at low temperature (30 ℃) when abduction delivering not on the other hand, and the copy number of expression plasmid is lower, has reduced basal expression.We have done improvement on this basis, introduce the bicistronic mRNA expression method.The bicistronic mRNA expression method is exactly to introduce another coding that is easy to express (generally in 20 amino acid) section of DNA sequence than short amino acid sequence before the gene of coding target protein, disadvantageous secondary structure obtains the effective expression of goal gene to the influence of translation initiation in the goal gene thereby overcome.There is several different methods to overcome of the influence of the unfavorable secondary structure in translation initiation district to translation, such as by the sequence in the translation initiation district is transformed, but this transformation depends on not too accurate computer mRNA secondary structure prediction, therefore transforming the result is difficult to expect, and the bicistronic mRNA expression method is a kind of relatively effective means, and its principle is that effective translation of leading cistron can open follow-up intracistronic unfavorable secondary structure.So expression plasmid pLacKGF provided by the invention not only can be used for expressing K GF and varient thereof, in expression plasmid, import other gene and also can be used for expressing other albumen.

According to a further aspect in the invention, be applicable to that host cell of the present invention is intestinal bacteria, be preferably intestinal bacteria GI724 and GI698 bacterial strain.The conversion of expression plasmid can be adopted conventional method, transforms GI724 with pLacKGF, through repeated screening, obtains the stable bacterial strain of high expression level.

According to another aspect of the invention, preparing by expression vector in the method for recombinant human horny cell growth factor-2, because of KGF or its varient of expressing is poisonous to intestinal bacteria, as overcoming this toxicity, will be more favourable to expressing.The cupric ion that adds proper concn in substratum helps some Recombinant Protein Expression, in US patent 5523215, this has been done detailed description, but recombinant protein all exists with the inclusion body form in this patent, recombinant protein will have more than one halfcystine at least, and substratum must highly be ventilated and oxygen enrichmentization.Cupric ion is the oxygenant of doing commonly used in the renaturation of reorganization metaprotein, therefore in substratum, add the oxidation capacity that cupric ion has improved substratum in this piece patent, improve intracellular oxidisability indirectly, form inclusion body thereby help forming between the expressed proteins intermolecular disulfide bond.The present invention adds the expression that cupric ion helps KGF and varient thereof in substratum, but the KGF and the varient thereof of expressing are to exist with soluble form, rather than exist with insoluble inclusion body form, different with the description among the USpatent 5523215, mechanism among mechanism that cupric ion works and the US patent 5523215 is also inequality, may with the activity of its enhancing cytopigment enzyme, it is relevant to improve the cellular metabolism ability.After adding cupric ion, the growth velocity of bacterium improves, and induces this section timed interval prolongation when bacterial growth is stagnated, and final expression amount and bacterium yield are all than the height that does not add cupric ion.In embodiment four, compared and in substratum, added cupric ion and do not add the result that cupric ion obtains.This effect of cupric ion may also help expression in escherichia coli other to the virose foreign protein of intestinal bacteria.

Available several different methods makes bacterial strain GI724/pLacKGF or the GI698/pLacKGF expressing K GF that transforms expression vector, and substratum in a preferred version of the present invention (substratum before particularly inducing) is made carbon source with glycerine.Suggestion is made carbon source with glucose in the specification sheets of invitrogen company, the similar expression system of the usefulness of describing among the US patent5760189 prepares in the method for the IL-11 that recombinates also makes carbon source with glucose, finds to be unfavorable for expressing K GF and varient thereof with this cover expression system in our experiment.In embodiment four, specific descriptions have been made.

Expressing K GF and varient thereof exist with soluble form, purifying process design has subsequently made full use of the characteristic of KGF: KGF energy heparin-binding, and be a utmost point basic protein, provided a kind of method in a preferred embodiment of the invention with heparin affinity chromatography post and SP column purification KGF, purification process two provides the method for a kind of two step of usefulness cation seperation column purifying KGF among the embodiment five, and the KGF purity that methods such as attached gel filtration chromatography finally obtain is greater than 95%.

Brief description of drawings

Fig. 1 illustrates the collection of illustrative plates of the recombinant plasmid pLacKGF of expressing K GF in one embodiment of the present of invention.Indicated the encoding sequence of ripe KGF, replicon ColE1, amicillin resistance (Amp ^R) the bla gene, P _LPromotor, term transcription terminator, the element of leading cistron Lac: ATG=ATG initiator codon, RBS=ribosome bind site, the sequence (SEQ ID NO.2) of Leader=coding MTMITNSSSVPGDPLEI, TAA=TAA translation stop codon.

Fig. 2 illustrates segmental nucleotide sequence of bicistronic mRNA and the amino acid sequence corresponding among the recombinant plasmid pLacKGF that makes up in one embodiment of the present of invention.

Fig. 3 illustrates the collection of illustrative plates of the recombinant plasmid pLac Δ N23KGF that expresses Δ N23 KGF in the another embodiment of the present invention.The explanation of all elements is except that using Δ N23 KGF (SEQ ID No.3) to replace the KGF in the collection of illustrative plates, and it is identical that other is all described in Fig. 1.The detailed description of invention

Come further to set forth the present invention by the following examples, the experimental technique of unreceipted actual conditions among the embodiment, basically " molecular cloning: laboratory manual " all write (New York:Cold Spring Harbor Laboratory Press according to people such as Sambrook, 1989) condition described in, or the condition of advising according to manufacturer.The clone of structure 1 Chinese's keratinocyte growth factor cDNA of the recombinant plasmid pLacKGF of embodiment one expressing human KGF

Get the postoperative prepuce tissues of capable foreskin cutting patient, press total RNA that invitrogen company zooblast total RNA extraction reagent box operation instructions is extracted prepuce tissues, with KGFP1 (5 ' TAAGAAGGAGATATACATATGTGCAAT GACATGACTCCAGAGCA) and KGFP2 (5 ' GAGTCGACTTAAGTTATTGCCATAGGAAGA AA) is primer, press the operation instructions of the RT-PCR test kit of Pharmacia company, carry out the RT-PCR amplification.T cloning vector pMD18-T with the precious biotech firm in Dalian is connected with amplified production (about 500bp), and with Calcium Chloride Method transformed into escherichia coli DH5 α, the picking white colony is identified.

The picking white colony, with RV-M (5 ' AGCGGATAACAATTTCACACAGG) and KGFP2 is that primer carries out the PCR evaluation, picking can amplify the segmental bacterium colony in the 500bp left and right sides, after the incubated overnight, extract plasmid with conventional rapid plasmid extraction method, identify with NdeI and SalI double digestion, picking can cut out the segmental plasmid of 500bp by enzyme, called after pMD18KGF, with M13-47 (5 ' CGCCAGGGTTTTCCCAGTCACGAC) is that primer carries out full-automatic sequencing, and sequencing result shows that the KGF cDNA sequence of being cloned into is correct.The structure of the recombinant plasmid pLacKGF of 2 expressing human KGF

With pMD18KGF is template, is that primer carries out pcr amplification with RV-M and KGFP2, cuts the 500bp left and right sides product that amplification obtains back standby with Sal I enzyme.The plasmid pTrxFus that Invitrogen company sells, after Nde I enzyme is cut, mend flat with the Klenow enzyme, cut with Sal I enzyme at last, enzyme is cut product and is run agarose gel electrophoresis, electrophoretic separation goes out 360bp left and right sides fragment and 3.4kbp left and right sides fragment, gel with invitrogen company reclaims test kit recovery 3.4kbp left and right sides fragment, it is connected with the above-mentioned PCR product of cutting through Sal I enzyme, transformed into escherichia coli GI724 (available from Invitrogen company), with KGFP1 and KGFP2 is that primer screens bacterium colony with the PCR method, positive bacterium colony is cultivated the back and is extracted plasmid, identify with Nde I and Sal I double digestion again, identify that correct plasmid is that primer carries out complete sequence determination with TrxR (5 ' TGTAAAACGACGGCCAGTGC), sequencing result confirms that recombinant plasmid pLacKGF has following feature: the sequence of having inserted the SEQ ID NO.4 of SEQ ID NO.2 and SEQ ID NO.1 composition between the Nde of former pTrxFus plasmid I site and Sal I site.

In SEQ ID NO.4 sequence, former Nde I site CATATG sports CATATA (1-6nt), the 37th base to the 87 bases are sequence (17 amino acid of encoding: MTMITNSSSVPGDPLEI) of coding first cistron, one ribosome bind site AGGA (26nt-29nt) was arranged before this cistron, after this cistron terminator codon TAA, be another ribosome bind site GAAGGAGA (91nt-98nt) subsequently, then 106nt to the 600nt encoded K GF albumen is Sal I restriction enzyme site behind terminator codon TAA.

The structure of the recombinant plasmid pLac Δ N23 KGF of embodiment two expressing human KGF varient Δ N23 KGF

With KGFP3 (5 ' GCACATATGAGTTATGATTACATG) and KGFP2 is primer, and plasmid pMD18KGF is that template is carried out pcr amplification, standby behind amplified production usefulness Nde I and the Sal I double digestion.With pLacKGF Nde I and Sal I double digestion, reclaim enzyme and cut the 3.4kbp left and right sides fragment that obtains, be connected with the above-mentioned pcr amplification product of cutting through enzyme, be transformed into GI724, with KGFP3 and KGFP2 is that primer screens bacterium colony with the PCR method, and positive bacterium colony is cultivated the back and extracted plasmid, again with Nde I and the evaluation of Sal I double digestion, identify that correct plasmid is that primer carries out complete sequence determination with TrxR (5 ' TGTAAAACGACGGCCAGTGC), sequencing result correct (SEQ ID NO.3).

The foundation of embodiment three engineering bacterias

Select for use intestinal bacteria GI724 to be the host bacterium, be equipped with competent cell with Lime Chloride, pLacKGF is transformed into competent cell, be coated in the M9CA (1 * M9 that contains the 100ug/ml penbritin, 2%Caseinhydrolysate, 1%glyceroin, 1.5%agrose) on the flat board, the reorganization bacterium colony is with containing the M9CA substratum of 100ug/ml penbritin 30 ℃ of cultivations, after screening, set up the engineering bacteria GI724/pLacKGF of expressing human KGF, original strain is stored in-70 ℃ with the M9CA substratum that contains 15% glycerine, engineering bacteria is typical intestinal bacteria colony characteristics containing on the M9CA flat board of penbritin growth, atlas analysis of the every biography of this engineering bacteria 20 generations work, the result is consistent with original strain.Embodiment four ferment-seeded bacterium are cultivated:

The GI724/pLacKGF inoculation of preserving is gone into the M9CA substratum that 250ml contains the 100ug/ml penbritin, shakes in the bottle in 30 ℃ at 1 liter and cultivates about 15 hours, and inoculation is gone in 3 liters of fermention mediums.7 liters of fermentor cultivation:

Fermention medium (3 liters):

Na2HPO4·7H2O????????????????????18g

KH2PO4???????????????????????????9g

Na2SO4???????????????????????????2g

KCl??????????????????????????????1.5g

Acid hydrolysis casein food grade 30g

Glycerine 15ml

MgSO4????????????????????????????1.8g

CaCl2????????????????????????????0.054g

ZnCl2????????????????????????????0.02g

Trace?metal??????????????????????5ml

Vitamin complex liquid 2 ml

Penbritin 3g

Trace?metal(1?liter)：

Citric?acid??????????????????????5g

CoCl2·6H2O??????????????????????2g

MnCl2·4H2O??????????????????????12g

CuSO4·5H2O??????????????????????1.85g

H3BO3?????????????????????????????????2.5g

(NH4)6Mo7O24·4H2O????????????????????1.32g

FeCl3·6H2O???????????????????????????3.4g

Vitamin complex liquid (1 liter):

VITMAIN B1 20g

Vitamin B12 200mg

Vitamin B6 2.5g

Wei ShengsuB2 1.0g

Vitamin H 12.5mg

Fermentation parameter: 30 ℃ of culture temperature, pH is controlled at 6.8-7.2, irritates to press to be normal pressure, air flow 2vvm, dissolved oxygen is controlled at more than 10% by control stir speed (S.S.) or logical pure oxygen.

When being cultured to the nectar degree and being the OD660=4 left and right sides (greatly about back 4.5 hours of inoculation), add inductor (1 gram tryptophane) and 30 milliliters of 100mM CuCl2, give birth to temperature to 36 ℃, continue to cultivate,, stagnate until thalli growth according to nutrient consumption situation supplemental acid hydrolysis casein food grade, glycerine and yeast extract, greatly about inducing back 5 hours, whole zymophyte density about OD660=20, centrifugal collection thalline, frozen standby in-70 ℃ of preservations.

In another experiment, when inducing, do not add cupric ion, the fermentation result compares as table 1 with the experiment that adds cupric ion:

Table 1 cupric ion is to the influence of fermentation

	Add Cu++ when inducing	Do not add Cu++ when inducing
			Nectar degree OD660 when inducing	????3.5	????4.0
Induce back the highest growth rate μ	????0.5	????0.4
			Induce the time (h) when cessation of growth cessation	????5	????3
Whole zymophyte density OD660	????22	????12
			Expression amount	????2-3％	????＜1.5％

As seen from the above table, add cupric ion simultaneously, improved growth velocity, prolonged the time that cessation of growth cessation occurs, improved whole zymophyte density, improved expression amount, thereby improved expression output at inductive.For avoiding higher density when fermentation parameter wayward, we are intended to these two experiments low nectar degree and induce so that the result compares easily.Induction time is postponed, and is about 6 to induce at the nectar degree, and whole zymophyte density is 40, and expression amount is at 2-3%.

In another experiment, we replace glycerine as carbon source with glucose, contain 0.2% glucose in the initial substratum, 0.2% acid hydrolysis casein food grade, 0.2% yeast extract, (also not inducing) thalli growth is stagnated when being cultured to the nectar degree and being the OD660=5 left and right sides, illustrates that making carbon source with glucose is disadvantageous for this expression system, may improve the amount of basal expression, thereby cause thalline death.Therefore prepare KGF and varient thereof with this expression method, the most handy glycerine is as the carbon source in the substratum.The preparation of embodiment quintet KGF

Purification scheme one

Thalline by 10% amount be suspended in lysis buffer (10mM Tris-HCl, 2mM EDTA, 200mMNaCl, pH7.5), ultrasonication under the ice bath, broken liquid was removed cell residue in centrifugal 30 minutes with 9000g centrifugal force, took out supernatant and made following purifying as study.

Heparin affinity chromatography post buffer A 1 (10mM Tris-HCl, 200mM NaCl, pH7.5) pre-balance is good, above-mentioned study is crossed this post, then with buffer A 1 flushing baseline before detecting the approaching last sample of baseline, carry out gradient elution with buffer A 1 for the addition 0-1N NaCl gradient that flows then, the fraction collection elutriant, confirm to contain each fraction collection sample (these samples concentrate on 0.5N NaCl elution peak place) of target protein with 12%SDS-PAGE, merge these and collect sample, with diluent (50mMphosphate, pH6.8) being diluted to electricity leads and is about 0.2, cross the SP post, the SP post is used buffer A 2 (50mMNaPO4 in advance, 200mM NaCl, pH6.8) balance is good, carry out gradient elution with buffer A 2 for the addition 0-0.5NNaCl gradient that flows then, fraction collection, confirm to contain each fraction collection sample (these fraction collection samples probably concentrate on 0.45N NaCl elution peak place) of target protein with 12%SDS-PAGE, merging these collects samples and is that 10,000 diaphragm carries out ultrafiltration and concentration with molecular weight cut-off.

Sample is to Sephacryl S-200 post on the above-mentioned concentrated solution, and pillar is used balance liquid (20mM NaPO4,150mM NaCl in advance, Ph7.2) balance is good, after treating that sample enters in the glue fully, with balance liquid from then in the gel filter medium wash-out go out protein, reclaim the collection liquid that those contain target protein.

Purification scheme two

Thalline by 10% amount be suspended in lysis buffer (10mM Tris-HCl, 2mM EDTA, 200mMNaCl, pH7.5), ultrasonication under the ice bath, broken liquid was removed cell residue in centrifugal 30 minutes with 9000g centrifugal force, took out supernatant and made following purifying as study.

Sample is to the SP post on the study, the SP post is used buffer A 3 in advance, and (pH7.5) balance is good for 20mM Tris-HCl, 200mM NaCl, then with buffer A 3 flushings baseline before detecting the approaching last sample of baseline, make the stage gradient wash-out then, earlier with buffer A 4 (20mM Tris-HCl, 400mM NaCl, pH7.5) wash-out, back buffer A 5 (20mM Tris-HCl, 500mM NaCl, pH7.5) wash-out (SDS-PAGE confirms that target protein is come out by wash-out in this gradient).The fraction collection elutriant, confirm to contain each fraction collection sample of target protein with 12%SDS-PAGE, merge these and collect sample, add isopyknic deionized water, go up sample then to another SP post, inferior post is used buffer A 6 (50mM NaPO4 in advance, 350mMNaCl, pH6.8) balance is good, carry out gradient elution with buffer A 6 for the addition 0-0.3N NaCl gradient that flows then, fraction collection confirms to contain each fraction collection sample of target protein with 12%SDS-PAGE, merging these collects samples and is that 10,000 diaphragm carries out ultrafiltration and concentration with molecular weight cut-off.

Sample is to Sephacryl S-200 post on the above-mentioned concentrated solution, and pillar is used balance liquid (20mM NaPO4,150mM NaCl in advance, Ph7.2) balance is good, after treating that sample enters in the glue fully, with balance liquid from then in the gel filter medium wash-out go out protein, reclaim the collection liquid that those contain target protein.

The reorganization KGF albumen that purifying obtains, purity is all greater than 95%, adopt the strain of BALB/MK keratinocyte to carry out the extracorporeal biology determination of activity, the proteic activity of the KGF of two kinds of purification process gained does not have significant difference, ED50 is about 3ng/ml, similar (Ron et al, J.Biol.Chem.268 (4): 2984-2988) to report such as Ron.The fragment (with the antibody of anti-complete KGF) that has an immunoblotting (Westernblotting) to be positive in the purified product that Ron etc. obtain, the SDS-PAGE molecular weight is 16-17KD (and the SDS-PAGE molecular weight of another immunoblotting positive fragment is 21KD), the same biologic activity of tool.This fragment is done immunoblotting with anti-KGF33-44 antibody amino and is negative, and points out the degraded product of this fragment for reorganization KGF.But this phenomenon does not exist in our experiment, use the immunoblotting of being done available from the anti-whole person KGF antibody of SantCruze company to show: no matter to be the middle sample of expressing in total thalline, the purge process, or whole purified product, western blotting method only detects a band, the molecular weight of this band is 21KD in the SDS-PAGE of routine gel electrophoresis, rather than theoretic 18KD, this phenomenon is consistent with the report of Ron etc.The proteic extracorporeal biology determination of activity of embodiment sixfold group KGF

The BALB/MK keratinocyte substratum (50%Eagle ' s low-Ca2+MEM, 50%Ham ' sF-12 medium, 5ug/ml Transferrins,iron complexes, 5ng/ml Sodium Selenite, 0.0005%HAS, 0.005% polysorbas20) in 37 ℃ of cultivations, keep that CO2 is 10% in the incubator, humidity is 99%.Inoculate with on pretreated 12 well culture plates of 1ug/cm2 fibronectin with 5 * 103 every holes of cell, add the 1ml substratum and cultivate, changed substratum every 2 days.After eight days, KGF protein sample (with containing the PBS solution dilution of 2% collagen) adds in the substratum, continues to cultivate 17 hours, changes substratum, and washing once adds 1ml then and contains 25 μ Ci[3H] substratum of thymidine, continue to cultivate 6 hours.Place to go substratum then, washing, with 1ml 0.1%SDS 37 ℃ of dissolvings one hour, 4 ℃ with 12000rpm centrifugal 10 minutes, get supernatant, the 200mg/ml trichoroacetic acid(TCA) that adds the 1ml precooling, mixing, ice bath 30 minutes, 4 ℃ with 12000rpm centrifugal 10 minutes, remove supernatant, precipitation is measured intensity of radioactivity with liquid scintillation instrument then with 1ml 1N NaOH dissolving.Measure the KGF albumen that we are purified to present method, ED50 is about 3ng/ml, to similar (Ron et al, the J.Biol.Chem.268 (4): 2984-2988) of report such as Ron.Determination of activity the results are shown in Table 2.

Table 2 reorganization KGF albumen is to the mitogen activity of BALB/MK keratinocyte

Handle [ ³H]-thymus pyrimidine incorporation cpm

Contrast 216 ± 60

rKGF(1ng/ml)???????????????????????5817±1153

rKGF(5ng/ml)???????????????????????13659±2036

rKGF(10ng/ml)??????????????????????24873±3984

rKGF(50ng/ml)??????????????????????21000±4025

More than the description of preferred embodiment of the present invention is not limited the present invention, those skilled in the art can make various changes and distortion according to the present invention, only otherwise break away from spirit of the present invention, all should belong to scope of the present invention.

SEQUENCE LISTING＜110〉Huanyin Pharmaceutical Co., Ltd., Shanghai

＜120〉、＜130〉PI011118＜160〉6＜170〉PatentIn version 3.1＜210〉1＜211〉489＜212〉DNA＜213〉Homo sapiens＜220〉＜221〉misc_feature＜223〉＜400〉1tgcaatgaca tgactccaga gcaaatggct acaaatgtga actgttccag ccctgagcga 60cacacaagaa gttatgatta catggaagga ggggatataa gagtgagaag actcttctgt 120cgaacacagt ggtacctgag gatcgataaa agaggcaaag taaaagggac ccaagagatg 180aagaataatt acaatatcat ggaaatcagg acagtggcag ttggaattgt ggcaatcaaa 240ggggtggaaa gtgaattcta tcttgcaatg aacaaggaag gaaaactcta tgcaaagaaa 300gaatgcaatg aagattgtaa cttcaaagaa ctaattctgg aaaaccatta caacacatat 360gcatcagcta aatggacaca caacggaggg gaaatgtttg ttgccttaaa tcaaaagggg 420attcctgtaa gaggaaaaaa aacgaagaaa gaacaaaaaa cagcccactt tcttcctatg 480gcaataact 489＜210〉2＜211〉104＜212〉DNA＜213〉＜220〉＜221〉misc_feature＜223〉＜400〉2tagcggataa caatttcaca caggaaacag ctatgaccat gattacgaat tcgagctcgg 60tacccgggga tcctctagag atttaagaag gagatataca tatg 104＜210〉3＜211〉420＜212〉DNA＜213〉Homo sapiens＜220〉＜221〉misc_feature＜223〉23ΔN23 KGF＜400〉3agttatgatt acatggaagg aggggatata agagtgagaa gactcttctg tcgaacacag 60tggtacctga ggatcgataa aagaggcaaa gtaaaaggga cccaagagat gaagaataat 120tacaatatca tggaaatcag gacagtggca gttggaattg tggcaatcaa aggggtggaa 180agtgaattct atcttgcaat gaacaaggaa ggaaaactct atgcaaagaa agaatgcaat 240gaagattgta acttcaaaga actaattctg gaaaaccatt acaacacata tgcatcagct 300aaatggacac acaacggagg ggaaatgttt gttgccttaa atcaaaaggg gattcctgta 360agaggaaaaa aaacgaagaa agaacaaaaa acagcccact ttcttcctat ggcaataact 420＜210〉4＜211〉606＜212〉DNA＜213〉＜220〉＜221〉mutation＜222〉 ( 6 ) .. ( 6 )＜223〉G to A＜220〉＜221〉RBS＜222〉 ( 26 ) .. ( 29 )＜223〉＜220〉＜221〉RBS＜222〉 ( 91 ) .. ( 98 )＜223〉＜220〉＜221〉CDS＜222〉 ( 37 ) .. ( 87 )＜223〉＜220〉＜221〉CDS＜222〉 ( 106 ) .. ( 600 )＜223〉＜400〉4catatagcgg ataacaattt cacacaggaa acagct atg acc atg att acg aat 54

Met?Thr?Met?Ile?Thr?Asn

1????????????????5tcg?agc?tcg?gta?ccc?ggg?gat?cct?cta?gag?att?taagaaggag?atatacat????105Ser?Ser?Ser?Val?Pro?Gly?Asp?Pro?Leu?Glu?Ile

10???????????????????15atg?tgc?aat?gac?atg?act?cca?gag?caa?atg?gct?aca?aat?gtg?aac?tgt????153Met?Cys?Asn?Asp?Met?Thr?Pro?Glu?Gln?Met?Ala?Thr?Asn?Val?Asn?Cys

20??????????????????25??????????????????30tcc?agc?cct?gag?cga?cac?aca?aga?agt?tat?gat?tac?atg?gaa?gga?ggg????201Ser?Ser?Pro?Glu?Arg?His?Thr?Arg?Ser?Tyr?Asp?Tyr?Met?Glu?Gly?Gly

35???????????????????40?????????????????45gat?ata?aga?gtg?aga?aga?ctc?ttc?tgt?cga?aca?cag?tgg?tac?ctg?agg????249Asp?Ile?Arg?Val?Arg?Arg?Leu?Phe?Cys?Arg?Thr?Gln?Trp?Tyr?Leu?Arg50???????????????55?????????????????????60??????????????????65atc?gat?aaa?aga?ggc?aaa?gta?aaa?ggg?acc?caa?gag?atg?aag?aat?aat????297Ile?Asp?Lys?Arg?Gly?Lys?Val?Lys?Gly?Thr?Gln?Glu?Met?Lys?Asn?Asn

70??????????????????75??????????????????80tac?aat?atc?atg?gaa?atc?agg?aca?gtg?gca?gtt?gga?att?gtg?gca?atc????345Tyr?Asn?Ile?Met?Glu?Ile?Arg?Thr?Val?Ala?Val?Gly?Ile?Val?Ala?Ile

85???????????????????90??????????????????95aaa?ggg?gtg?gaa?agt?gaa?ttc?tat?ctt?gca?atg?aac?aag?gaa?gga?aaa????393Lys?Gly?Val?Glu?Ser?Glu?Phe?Tyr?Leu?Ala?Met?Asn?Lys?Glu?Gly?Lys

100??????????????????105??????????????????110ctc?tat?gca?aag?aaa?gaa?tgc?aat?gaa?gat?tgt?aac?ttc?aaa?gaa?cta????441Leu?Tyr?Ala?Lys?Lys?Glu?Cys?Asn?Glu?Asp?Cys?Asn?Phe?Lys?Glu?Leu

115?????????????????120?????????????????125att?ctg?gaa?aac?cat?tac?aac?aca?tat?gca?tca?gct?aaa?tgg?aca?cac????489Ile?Leu?Glu?Asn?His?Tyr?Asn?Thr?Tyr?Ala?Ser?Ala?Lys?Trp?Thr?His130?????????????????135?????????????????140??????????????????145aac?gga?ggg?gaa?atg?ttt?gtt?gcc?tta?aat?caa?aag?ggg?att?cct??gta????537Asn?Gly?Gly?Glu?Met?Phe?Val?Ala?Leu?Asn?Gln?Lys?Gly?Ile?Pro?Val

150?????????????????155?????????????????160aga?gga?aaa?aaa?acg?aag?aaa?gaa?caa?aaa?aca?gcc?cac?ttt?ctt?cct?????585Arg?Gly?Lys?Lys?Thr?Lys?Lys?Glu?Gln?Lys?Thr?Ala?His?Phe?Leu?Pro

165?????????????????170?????????????????175atg?gca?ata?act??taa?gtcgac?????????????????????????????????????????606Met?Ala??Ile?Thr

180＜210〉5＜211〉17＜212〉PRT＜213〉artificial sequence＜400〉5Met Thr Met Ile Thr Asn Ser Ser Ser Val Pro Gly Asp Pro Leu Glu1,5 10 15Ile＜210〉6＜211〉164＜212〉PRT＜213〉artificial sequence＜400〉6Met Cys Asn Asp Met Thr Pro Glu Gln Met Ala Thr Asn Val Asn Cys1,5 10 15Ser Ser Pro Glu Arg His Thr Arg Ser Tyr Asp Tyr Met Glu Gly Gly

20??????????????????25??????????????????30Asp?Ile?Arg?Val?Arg?Arg?Leu?Phe?Cys?Arg?Thr?Gln?Trp?Tyr?Leu?Arg

35??????????????????40??????????????????45Ile?Asp?Lys?Arg?Gly?Lys?Val?Lys?Gly?Thr?Gln?Glu?Met?Lys?Asn?Asn

50??????????????????55??????????????????60Tyr?Asn?Ile?Met?Glu?Ile?Arg?Thr?Val?Ala?Val?Gly?Ile?Val?Ala?Ile65??????????????????70??????????????????75??????????????????80Lys?Gly?Val?Glu?Ser?Glu?Phe?Tyr?Leu?Ala?Met?Asn?Lys?Glu?Gly?Lys

85??????????????????90??????????????????95Leu?Tyr?Ala?Lys?Lys?Glu?Cys?Asn?Glu?Asp?Cys?Asn?Phe?Lys?Glu?Leu

100?????????????????105?????????????????110Ile?Leu?Glu?Asn?His?Tyr?Asn?Thr?Tyr?Ala?Ser?Ala?Lys?Trp?Thr?His

115?????????????????120?????????????????125Asn?Gly?Gly?Glu?Met?Phe?Val?Ala?Leu?Asn?Gln?Lys?Gly?Ile?Pro?Val

130?????????????????135?????????????????140Arg?Gly?Lys?Lys?Thr?Lys?Lys?Glu?Gln?Lys?Thr?Ala?His?Phe?Leu?Pro145?????????????????150?????????????????155?????????????????160Met?Ala?Ile?Thr

Claims (16)

1. the plasmid vector of a recombinant human horny cell growth factor-2 or its varient is characterized in that it comprises:

The gene order of one expressing human keratinocyte growth factor or its allelic variant;

One cistron sequence is connected with gene order or its allelic variant of described expressing human keratinocyte growth factor;

One promotor is connected with described cistron sequence.

2. plasmid vector according to claim 1, the gene order that it is characterized in that described expressing human keratinocyte growth factor are DNA shown in the SEQ ID NO.1.

3. plasmid vector according to claim 1, the gene order that it is characterized in that described expressing human keratinocyte growth factor are the DNA shown in the SEQ ID NO.3.

4. plasmid vector according to claim 1 is characterized in that described cistron sequence is the sequence shown in the SEQ IDNO.2.

5. plasmid vector according to claim 1 is characterized in that described promotor is phage P _LPromotor.

6. plasmid vector according to claim 2 is characterized in that the DNA of described SEQ ID NO.1 derives from Chinese's skin histology.

7. plasmid vector according to claim 1 is characterized in that further comprising in the described plasmid vector transduction terminator.

8. one kind by the described plasmid vector transformed host cells of claim 1.

9. host cell according to claim 7 is characterized in that described host cell is intestinal bacteria.

10. host cell according to claim 8 is characterized in that described intestinal bacteria are E.coliGI724/pLacKGF.

11. host cell according to claim 8 is characterized in that described intestinal bacteria are E.coliGI698/pLacKGF.

12. one kind prepares the method for recombinant human horny cell growth factor-2 or its varient by the described escherichia coli host of claim 9, may further comprise the steps: 1) cultivate in the substratum that includes effective cupric ion dosage and contain recombinant human horny cell growth factor-2

The intestinal bacteria of gene or its allelic variant, the recombinant human horny cell growth factor-2 that gives expression to or

Its varient exists with soluble form;

2) with the intestinal bacteria after the appropriate means cracking cultivation, separating and cracking liquid is used from soluble components

Appropriate means is purified into recombinant human horny cell growth factor-2 or its varient.

13. method according to claim 12, wherein said cupric ion dosage is 1～10mM.

14. method according to claim 12, in the wherein said substratum with glycerine as carbon source.

15. method according to claim 12, wherein said escherichia coli host are E.ColiGI724/pLacKGF.

16. method according to claim 12, wherein said escherichia coli host are E.ColiGI698/DLacKGF.