JPH0568581A - Production of physiologically active peptide - Google Patents

Abstract

PURPOSE:To obtain a new recombinant plasmid, useful for producing physiologically active peptides such as hBNP having no Asp-Pro sequence. CONSTITUTION:A recombinant plasmid having a DNA sequence integrated therein, e.g. pKKmIhB. The above-mentioned plasmid is obtained by binding a DNA sequence capable of coding a physiologically active peptide to a DNA sequence capable of coding Asp-Pro sequence, binding a DNA sequence capable of coding a protected peptide to a DNA sequence capable of coding the Asp-Pro- physiologically active peptide and further integrating the resultant recombinant DNA into a vector having a promoter, a transcription origin, a terminator, etc.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION The present invention relates to human brain natriuretic peptide (human Brain Nature).
tic Peptide, hereinafter abbreviated as hBNP), relates to a method for efficiently producing a physiologically active peptide using recombinant DNA technology.

[0002]

2. Description of the Related Art Conventionally, many physiologically active peptides have been found in microorganisms, plants, animals and the like, and have been applied to medicines and the like. Generally, as a method for producing these useful bioactive peptides, a method for separating and purifying from the found animal organs, a method for chemically synthesizing and a method for producing in a transformant using recombinant DNA technology Is being carried out. Among them, the method using the recombinant DNA technology is an excellent method from the viewpoint of reducing the production cost, and the technology has been further advanced in recent years.

However, when a peptide having a small molecular weight is to be produced by the recombinant DNA method, it is generally difficult to obtain a translation product. Therefore, after the peptide is produced as a fusion protein with another protein that is easily expressed. A method is used in which the desired peptide is cleaved from the fusion protein by chemical or enzymatic treatment and then purified. As a method for producing such a fusion protein and cleaving the desired peptide from the fusion protein, (1) when the desired peptide does not contain a methionine residue, the desired peptide is produced as a fusion protein via a methionine residue. And then cleaving the methionine residue by cyanogen bromide treatment to cut out the desired peptide [Science, 198 , 1059].
(1977), Proc. Natl. Acid. Sc
i. USA, 76 , 106 (1978)], and (2) when the peptide of interest does not contain arginine or lysine residues, it is produced as a fusion protein via arginine or lysine residues, and then arginine is produced. Method of cleaving the target peptide by trypsin treatment that specifically cleaves the C-terminal of lysine or lysine residue [Nature, 285 , 456]
(1980)] and the like are used. (3) When the target peptide does not contain a lysine residue, it is produced as a fusion protein via a lysine residue, and then the C of the lysine residue is produced.
The enzyme Achromobacter (Ach) that specifically cleaves the ends
A method of cleaving the target peptide by treating with (robacter) protease-1 (Japanese Patent Publication No. 54-135789)
No.) etc. are used. However, when the target peptide contains methionine, lysine, and arginine, these methods cannot be used.

By the way, hBNP is a physiologically active peptide having a natriuretic action, a hypotensive action, and a smooth muscle relaxing action, and its DNA sequence is Sudo, Maekawa, Matsuo [Bio.
chem. Biophys. Res. Commun. ，
159 , 1427-1434 (1989)], and further, Minamino, Matsuo [Biochem. Bio
phys. Res. Commun. , 167 , 693 ~
700 (1990)], it was clarified that the amino acid sequence was actually extracted and produced from human atrium, and its amino acid sequence is as shown in SEQ ID NO: 1. In addition, many studies have been actively conducted on the biochemical and pharmacological properties of this peptide, and Nakao et al. Have revealed that it is very promising as a diagnostic and therapeutic drug for patients with heart disease [ Lanc
et., 335 , 801 (1990), New. Eng
l. J. Med. , 323 , 757-758 (199
0)]. Under such circumstances, there is a strong demand for establishment of a more convenient and large-scale production method for hBNP.

[0005]

However, this h
BNP has a low molecular weight and contains methionine, arginine, and lysine residues, as is clear from the structure shown in SEQ ID NO: 1 (two cysteines are bonded in SEQ ID NO: 1), and the conventional technique is used. Was difficult to manufacture. Therefore, an object of the present invention is to provide a method for producing a fusion protein by recombinant DNA technology and efficiently cleaving the target peptide from the obtained fusion protein to efficiently produce a physiologically active peptide.

[0006]

In such a situation, the present inventors have found that the physiologically active peptide (eg, hBNP) having no aspartic acid-proline (Asp-Pro) sequence in its amino acid sequence has an Asp-Pro sequence. A recombinant DNA designed to produce a fusion protein to which another peptide is bound through is constructed, the expression vector containing the recombinant DNA is used to produce the fusion protein, and the fusion protein is treated with an acid. For example, the inventors have found that the bond between Asp-Pro is specifically cleaved and the target physiologically active peptide can be efficiently obtained, and completed the present invention.

[0007] That is, the present invention is
A method for producing a physiologically active peptide having no sp-Pro sequence, which comprises using an expression vector containing a gene encoding a fusion protein in which a protective peptide is bound via an aspartic acid-proline sequence and the physiologically active peptide. A method for producing a physiologically active peptide, comprising culturing transformed cells, collecting a fusion protein from the resulting culture, and cleaving the aspartic acid-proline bond of the fusion protein with an acid. ..

It is necessary that the physiologically active peptide produced by the method of the present invention has no Asp-Pro sequence. This is because when the present invention treats the fusion protein with an acid, the Asp-Pro bond is selectively hydrolyzed,
This is because it utilizes the fact that the target physiologically active peptide is easily obtained. Such a physiologically active peptide is not particularly limited as long as it does not have an Asp-Pro sequence, but a peptide having a relatively small molecular weight is preferable. For example, hBNP is particularly preferable because it has a small molecular weight and does not have an Asp-Pro sequence as shown in SEQ ID NO: 1.

The protected peptide used in the present invention is not particularly limited as long as it has been confirmed that it can be produced by a gene recombination technique, but those having neither Asp-Pro sequence nor cysteine residue are preferable. hBNP
As the protected peptide for production, for example, a polypeptide consisting of amino acids of 50 to 160, including a polypeptide fragment derived from mouse interleukin-1 (mIL-1) or rat interleukin-1 (rIL-1), is used. preferable.

To carry out the production method of the present invention, (A) construction of an expression vector, (B) transformation of a host, (C) production of a fusion protein, and then (D) excision of a desired peptide from the fusion protein and It is carried out in the order of purification. Each of these steps will be described below.

(A) Construction of Expression Vector To construct an expression vector, first, a DNA sequence encoding a physiologically active peptide is ligated with a DNA sequence encoding an Asp-Pro sequence. As a method for binding such a DNA sequence, a conventional method for binding a DNA molecule, for example, T4D
A method of ligating a target fragment with NA ligase can be used. If there is a Pro-encoding DNA sequence near the 5'end of the DNA sequence encoding the target physiologically active peptide, the upstream DNA sequence is Asp.
By mutating the DNA sequence encoding
A DNA sequence encoding the p-Pro sequence may be made. Such a gene mutation may be, for example, commercially available in vitro.
It can be performed using a ro mutagenesis kit or the like. Then, the DN encoding the protected peptide
A vector (preferably a plasmid vector) having a base sequence necessary for expression of a protein such as a promoter, a transcription initiation point, and a terminator, which is formed by ligating the A sequence with the DNA sequence encoding the Asp-Pro-bioactive peptide. Built in.

The expression vector encoding the fusion protein of hBNP and mIL-1 or rIL-1 is constructed, for example, as follows. First, D that codes hBNP
To introduce a DNA sequence encoding the Asp-Pro sequence into the NA sequence (SEQ ID NO: 1), the codon AGC corresponding to Ser at the 5'end of this sequence is converted to the codon GAC corresponding to Asp. This allows Asp at the 5'end.
-The DNA sequence corresponding to Pro has been introduced. In the case of hBNP, if a fusion protein is produced using the DNA thus mutated and cleaved with an acid,
BNP (SEQ ID NO: 2 [in the SEQ ID NO: 2 in which two cysteines are linked]) having a chain length shorter than that of one naturally present is obtained, and this BNP has a physiological activity equivalent to that of natural hBNP. Have. The obtained DNA sequence encoding the mutant hBNP and the DNA sequence encoding mIL-1 or rIL-1 were bound by exonuclease III (Exonuclease II) only at the 3'end of the latter DNA.
I) and Mung-bean nuclease
n nuclease) to appropriately blunt end the DNA, and ligate the DNA encoding the mutant hBNP downstream thereof. The recombinant plasmid thus obtained includes hBNP shown in FIG. 3 or 4 downstream of a promoter such as trc promoter.
Those in which a gene encoding a fusion protein of a protected peptide and a protected peptide is incorporated are preferred.

Specific examples of such expression plasmids include 5.1 Kbp pKKmIhB (FIG. 1), 5.1 Kbp pKKrIhB (FIG. 2) and 3.8 Kbp pUCmIhB (FIG. 3). Be done.

(B) Transformation of host To transform cells using the expression vector obtained above, a conventional method, for example, calcium chloride / rubidium chloride method [Molecular Cloning, 250-2
53, Cold spring harborlabo
ratory (1982)] and the like. The host cells include microorganisms such as Escherichia coli and yeast,
Escherichia coli is particularly preferable.

(C) Production of Fusion Protein The transformant can be cultured and the fusion protein can be collected from the cultured cells. The culture method varies depending on the type of transformant,
In the case of host E. coli, liquid culture is preferred. In the case of E. coli, the fusion protein may be extracted from the supernatant of the disrupted cell suspension or may be extracted from the insoluble fraction, but mIL-1-hBNP (or r-IL-1- hB
Since the NP) fusion protein exists in the insoluble fraction, a high-concentration urea solution, a high-concentration guanidine hydrochloride solution, or SDS
It can be extracted with a solution. As a method for purifying the fusion protein from the insoluble fraction extracted by these methods, an ion exchange column or a gel filtration column can be considered, but for crude purification, degreasing using an organic solvent is followed by dialysis to remove the precipitated precipitate. The collection method is simple. Because it is a small molecule (molecular weight 50
The peptide up to position 00) is often soluble in an aqueous solution, and since the low molecular weight peptide is scarcely contained in the precipitate, hBNP (2
-32) (Molecular weight 3376.8) and other target peptides, so soluble contaminating peptides are scarcely produced, so that the target peptides can be easily purified.

(D) Cleavage and Purification of Physiologically Active Peptide from Fusion Protein To excise the desired bioactive peptide from the obtained fusion protein, the fusion protein may be treated with an acid. The acid treatment of the fusion protein is performed, for example, by dissolving the crudely purified product of the fusion protein in an aqueous solution of an organic acid or an inorganic acid. Considering that the fusion protein is insoluble, it is preferable to use 70% formic acid or 10% acetic acid containing 6M guanidine hydrochloride. Purification of physiologically active peptides such as hBNP from the reaction solution can be carried out by a conventional method using gel filtration, an ion exchange column or a reverse phase column, but considering that the reaction solution contains a large amount of acid and high molecular weight protein. Before the complete purification, desalting and removal of high molecular weight proteins are performed at the same time by a reverse-phase ODS column for rough purification, and then final purification by preparative separation by high performance liquid chromatography (HPLC). Good.

[0017]

EXAMPLES Hereinafter, the production method of the present invention will be described by way of examples, taking the production method of hBNP as an example. Example 1. Substitution of DNA for amino acid modification S 32nd from the C terminus of a polypeptide containing hBNP
hBN of the plasmid pUC119-hBNP containing the hBNP gene for the purpose of converting er to Asp
In the P gene, in vitro mutagenes
The base was replaced by is (Kit Mutan-K manufactured by TAKARA) to introduce a mutation. E. coli M used here
V1184 strain, BW313 strain, BMH71-18mut
The S strain and the helper phage M13KO7 strain used were those attached to the kit. The mutator used was an oligomer (formula 1) consisting of 27 bases, and was used as a DNA synthesizer model 380A (Applied Bio).
systems).

[0018]

[Chemical 1]

In order to convert Ser into Asp, the codon AGC of Ser may be converted into the codon GAC of Asp.
A base substitution reaction of pUC119-hBNP was carried out by a conventional method, and Escherichia coli BMH71-18 strain was transformed with the reaction product. From a large number of colonies formed on ampicillin medium, clones that are thought to have a base-substituted plasmid are selected using the colony hybridization method, and the base sequences of the plasmids extracted from these clones are determined. Thus, the expected mutant plasmid was selected.

Example 2. Preparation of pKKmIhB The expression plasmid pKKmIhB was prepared according to the procedure shown in FIG. That is, the plasmid p containing the hBNP gene
UC119-hBNP was completely digested with EcoRI and HaeII, and this was digested with Klenow fragment (Klenow fragment).
gment), and the restriction enzyme cleavage end was made a blunt end. Then, perform electrophoresis on an agarose gel to obtain 0.7K.
A bp hBNP DNA fragment was recovered. Further, the mIL-1 gene cloned by the polymerase chain reaction (PCR) method was used to express the expression vector pKK233.
2 (made by Pharmacia), pKK233.2-
mIL-1 was constructed. This pKK233 ・ 2-mIL
-1 was completely decomposed with HindIII and treated with Klenow fragment to smooth the HindIII cut surface. This was recovered as a 5.1 Kbp fragment by separation agarose electrophoresis, and then dephosphorylated by treatment with alkaline phosphatase. Next, in order to ligate hBNP to the 3'-terminal side of mIL-1, 0.7 Kbp hBN recovered previously was linked.
P gene fragment and HindIII digested pK recovered thereafter
The K233.2-mIL-1 gene fragment was ligated, and the reaction product was used to transform Escherichia coli (MC1061 strain).
Was transformed. Using the plasmid recovered from this transformant, a treatment as shown in FIG. 4 was carried out to produce pKKmIhB, and two types of DNA fragments were recovered. First of all, this plasmid was digested with AflII and
After blunting with bean nuclease, Pvu
Completely decomposed with I. This was subjected to separation agarose gel electrophoresis to recover a 1 Kbp DNA fragment. Secondly, this plasmid was completely digested with EcoRV and PstI, digested appropriately with exonuclease III, the resulting single-stranded portion was blunt-ended with mang-bean nuclease, and then digested with PvuI. Completely disassembled. This was electrophoresed on an agarose gel and recovered as a 4 Kbp DNA fragment. The 1 Kbp DNA fragment recovered earlier,
After ligation with a 4 Kbp DNA fragment recovered later, this reaction product was used to transform Escherichia coli (MC1061 strain).
Was transformed to obtain an ampicillin-resistant clone. Plasmids were recovered from the resulting transformed cells, the DNA base sequence was determined, and a clone having the desired correct reading frame was selected. In addition, the total proteins of these E. coli were examined by polyacrylamide gel electrophoresis, and a clone producing a new protein [MC1061 / pKKmIhB (Microtechnology Research Institute No. 12424)] was selected.

Example 3. Preparation of pKKrIhB The expression plasmid pKKrIhB was prepared according to the procedure shown in FIG. That is, pKKrIhB was prepared by pKKmI
The procedure was similar to that of hB. First, pKKmIhB
Was completely digested with NcoI and PvuI and subjected to agarose gel electrophoresis to recover a 1.8 Kbp DNA fragment. In addition, the rat interleukin-1 (rIL-1) gene cloned by the PCR method was used as an expression vector pKK2.
Expression plasmid pKK233.2 incorporated into 33.2
-RIL-1 was constructed. This was completely digested with NcoI and PvuI to recover a DNA fragment near 4 Kbp. 5.9 generated by ligation of these two DNA fragments
The Kbp plasmid was recovered. This plasmid was digested with XmaI and blunted with Klenow fragment before Eco
Completely decomposed by RV. After that, agarose gel electrophoresis was performed to collect a 5.1 Kbp DNA fragment, and self-ligation was performed to construct a plasmid for producing a fusion protein of rIL-1 and hBNP. In addition, it was confirmed that this plasmid also had the correct reading frame of interest, and that a new protein was produced in transformed E. coli [MC1061 / pKKrIhB (Microtechnology Research Institute No. 12423)]. Confirmed (FIG. 6).

Example 4. Preparation of pUCmIhB A high expression plasmid pUCmIhB was prepared according to the procedure shown in FIG. That is, in order to efficiently express a protein in a system using Escherichia coli, (1) enhancement of promoter ability, (2) increase of plasmid copy number, etc. are considered.
Regarding the former, the trc promoter used here is a strong promoter and can also induce transcriptional ability with IPTG. Regarding the latter, the pUC series is already commercially available as a plasmid with a high copy number, and the rop protein gene that controls the copy number has been removed. The idea to improve this into a high-expression vector is Miki (Protein engineering).
1 1987) et al. However, their method is that several in vitro mutagensi
Since it is a complex one including s, we independently developed it. FIG. 7 shows a method for constructing a plasmid. PUC19 was completely digested with PstI and HindIII, reacted with exonuclease III and mang-bean nuclease, and then self-ligated, and the reaction product was used to transform E. coli (MC1061 strain). ) Was transformed. Plasmids were taken from the emerged colonies (the origin of replication was not deleted), and those from which the lac promoter had been removed were selected by determining the nucleotide sequence. After completely digesting this plasmid with PvuI and BamHI, a 1.4 Kbp DNA fragment was recovered by agarose gel electrophoresis. In addition, the expression plasmid pKKmIhB was added to Pvu
It was completely digested with I and BamHI, and a 1.4 Kbp DNA fragment was recovered by agarose gel electrophoresis. These two DNA fragments were ligated and E. coli (JM109 strain) was transformed with this reaction product. This transformant [JM109 / pUCm] was transformed into M9 medium containing IPTG.
As a result of culturing IhB (Microtechnology Research Institute No. 12425), high expression of the fusion protein was observed (FIG. 8).

Example 5. HBNP with formic acid (2-3
2) Excision and Purification E. coli MC1061 (MC1061 / pKKrI) transformed with pKKrIhB prepared in Example 2
hB) was cultured in an L medium containing ampicillin (1% bactotryptone, 0.5% bacto yeast extract, 1% sodium chloride, pH 7.4) at 37 ° C. for 16 hours in a 20 l volume jar fermenter. Next, 1 liter of cells collected by centrifugation
A portion (4.4 g) was suspended in 20 ml of a phosphate buffer solution, disrupted using a homogenizer (Physcotron), and then sonicated (Sonicator; Heat system).
ms-Ultrasonic, Inc. ) And centrifugation to obtain a precipitate fraction. This operation was performed twice. Then, 20 ml of 6M guadinine hydrochloride (pH 8.0) was added to the precipitated fraction.
Was added, and the mixture was crushed with a homogenizer and sonicated to dissolve. Water-saturated ether was added to this solution, and the mixture was sonicated and centrifuged, and the guanidine hydrochloride dissolved phase was recovered. Next 20
ml chloroform was added, ultrasonication was performed, and the mixture was centrifuged and the guanidine hydrochloride phase was recovered again. Degreasing was performed by this operation. This was dialyzed against 20 mM Tris buffer (pH 8.0), and the deposited precipitate was collected by centrifugation. Take one fifth of this precipitate and dissolve it in 4 ml of 50% formic acid.
It was left at 24 ° C. for 24 hours. This solution was diluted 100 times with water and diluted with 10 ml of ODS resin (LC-SORB SPW-C-
ODS, manufactured by Chemco) and washed well with 0.1% trifluoroacetic acid to contain 0.1% trifluoroacetic acid.
Eluted with 0% acetonitrile. This was concentrated under reduced pressure, and the deposited precipitate was removed by centrifugation and then applied to a reverse phase column. Conditions (column: nucleosil 120
3C18 φ4.6 × 75 mm, flow rate: 1 ml / min, solvent system: (A) water: acetonitrile: 10% trifluoroacetic acid = 90: 10: 1, (B) water: acetonitrile: 1
0% trifluoroacetic acid = 40: 60: 1, (A):
(B) = After flowing 100: 0 for 2 minutes (A): (B) =
An 80 minute linear gradient from 95: 5 to (A) :( B) = 0: 100 was applied). The peak eluted at 28 minutes was collected and concentrated under reduced pressure to obtain 27 μg of hBNP (2-3
2) was obtained. The HPLC chart is shown in FIG. 9. The retention time on HPLC of the obtained hBNP (2-32) coincided with that of hBNP (2-32) synthesized separately. In addition, when the amino acid composition of hBNP (2-32) obtained in this Example was analyzed using a picotag-amino acid analyzer (Waters), it was in agreement with the value predicted from the amino acid sequence of hBNP (2-32). did. The analytical values are shown in Table 1.

[0024]

[Table 1]

Further, protein sequencer model 47
The amino acid sequence of hBNP (2-32) obtained in this example analyzed by OA (Applied Biosystem) was identical to that of hBNP (2-32) synthesized separately. The analysis result is shown in FIG.

Example 6. Measurement of smooth muscle relaxation activity by chick small intestine hBNP obtained by separately synthesizing hBNP (2-32)
(2-32) and hBNP (1-32) were confirmed to have a smooth muscle relaxing action equivalent to that described below. The rectum of a chick (4-7 days old) was excised and immersed in Kregs-Hensleit nutrient solution using a 3 ml organ bath. The nutrient solution in the organ bath was kept at 32 ° C. by passing 95% O ₂ -5% CO ₂ gas. A static pressure of 0.5 g was applied to the muscle sample, and the muscle sample was left standing for about 30 minutes. When the automatic movement of the muscle was stabilized, the peptide was administered, and the relaxation of the muscle was measured for 8 to 10 minutes. The results are shown in Fig. 11. In FIG. 11, A to C are the chick rectal specimens, hBNP (2-32) produced in this Example, hBNP (2-32) and hBNP (1-32) synthesized separately.
The time-dependent change of the relaxation length when 150-200 ng is administered is shown.

Example 7 hBNP (2
-32) Excision and purification As in Example 3, Escherichia coli taken out from 1 l of the culture solution was crushed to extract the crude fusion protein, defatted, dialyzed, and subjected to precipitation 1
1/0 was dissolved in 4 ml of 10% acetic acid containing 6M guanidine hydrochloride (pH adjusted to 2.5 with pyridine) and left at 40 ° C for 3 days. One half of the reaction solution was desalted and deproteinized in the same manner as in Example 3 and applied to a reverse phase column. Conditions (column: nucleosil 120 3C18φ)
4.6 × 75 mm, flow rate 1 ml / min: solvent system: (A) water:
Acetonitrile: 10% trifluoroacetic acid = 90: 1
0: 1, (B) water: acetonitrile: 10% trifluoroacetic acid = 40: 60: 1, (A) :( B) = 100: 0
After flowing for 4 minutes, (A) :( B) = 0: 100 to 40
Multiplied by the linear gradient end of the minute). The peak eluted at about 22 minutes was collected and concentrated under reduced pressure to obtain 4 μg of hBNP (2-
32) was obtained. The HPLC chart is shown in FIG. The retention time on HPLC of the obtained hBNP (2-32) coincided with that of hBNP (2-32) synthesized separately.

[0028]

Industrial Applicability According to the method of the present invention, a low molecular weight physiologically active peptide represented by hBNP can be produced easily and efficiently using recombinant DNA technology.

[0029]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 32 Sequence type: Amino acid Sequence type: Peptide sequence Ser Pro Lys Met Val Gln Gly Ser Gly Cys Phe Gly Arg Lys Met Asp 5 10 15 Arg Ile Ser Ser Ser Ser Gly Leu Gly Cys Lys Val Leu Arg Arg His 20 25 30

SEQ ID NO: 2 Sequence length: 31 Sequence type: Amino acid Sequence type: Peptide sequence Pro Lys Met Val Gln Gly Ser Gly Cys Phe Gly Arg Lys Met Asp Arg 5 10 15 Ile Ser Ser Ser Ser Gly Leu Gly Cys Lys Val Leu Arg Arg His 20 25 30

SEQ ID NO: 3 Sequence length: 888 Sequence type: Nucleic acid Number of strands: Double-stranded topology: Unknown sequence TCAGCACCTT ACACCTACCA GAGTGATTTG AGATACAAAC TGATGAAGCT CGTCAGGCAG 60 AAGTTTGTCAG TGAATGATTCT CCACACTACTACTATATC AGACTATAGTCACAACTACTATATATCAGGGAGTGGA CTCAAACTAA TCGTCGGGAG GAGACGACTC TAAATATCCT GTTACTCTAA AAATCTCAGA TTCACAACTG 240 TTCGTGAGCG CTCAAGGAGA AGACCAGCCC GTGTTGCTGA AGGAGTTGCC AGAAACACCA 300 AAACTCATCA CAGGTAGTGA GACCGACCTC ATTTTCTTCT GGAAAAGTAT CAACTCTAAG 360 AACTACTTCA CATCAGCTGC TTATCCAGAG CTGTTTATTG CCACCAAAGA ACAAAGTCGG 420 GTGCACCTGG CACGGGGACT GCCCTCTATG ACAGACTTCC AGATGCACCC GCTGGGCAGC 480 CCCGGTTCAG CCTCGGACTT GGAAACGTCC GGGTTACAGG AGCAGCGCAA CCATTTGCAG 540 GGCAAACTGT CGGAGCTGCA GGTGGAGCAG ACATCCCTGG AGCCCCTCCA GGAGAGCCCC 600 CGTCCCACAG GTGTCTGGAA GTCCCGGGAG GTAGCCACCG AGGGCATCCG TGGGCACCGC 660 AAAATGGTCC TCTACACCCT GCGGGCACCA CGAGACCCCA AGATGGTGCA AGGGTCTGGC 720 TGCTTTGGGA GGAAGATGG A CCGGATCAGC TCCTCCAGTG GCCTGGGCTG CAAAGTGCTG 780 AGGCGGCATT AAGAGGAAGT CCTGGCTGCA GACACCTGCT TCTGATTCCA CAAGGGGCTT 840 TTTCCTCAAC CCTGTGGCCG CCTTTGAAGT GACTCATTTT TTTAATGT 888

SEQ ID NO: 4 Sequence length: 732 Sequence type: Nucleic acid Number of strands: Double-stranded topology: Unknown sequence ATGTCAGCAC CTCACAGCTT CCAGAATAAT TTGAGATACA AATTGATAAG GATCGTCAAG 60 CAGGAGTTCA TCATGAATGA TTCCCTCAAC CAAAATATAT ATGTGGATATTCTCTTAAGATCCATCAATT TACTCATCGG GAGGAGACGA CTCTAAATAT CCTGTGACTC TCAAAGTCTC AAATACTCAG 240 CTCTTTGTGA GTGCTCAGGG AGAAGACAAG CCTGTGTTGC TGAAGGAGAT TCCGGAAACA 300 CCAAAACTCA TCACAGGTAG TGAGACCGAC CTCATTTTCT TCTGGGAAAA AATCAACTCT 360 AAGAACTACT TCACATCCGC AGCTTTCCCA GAGCTGTTAA TTGCCACAAA AGAACAAAGT 420 CAGGTGCACC TGGCACGGGG ACTGCCCTCC ATGATAGATT TCCAGATCCG GGAGGTAGCC 480 ACCGAGGGCA TCCGTGGGCA CCGCAAAATG GTCCTCTACA CCCTGCGGGC ACCACGAGAC 540 CCCAAGATGG TGCAAGGGTC TGGCTGCTTT GGGAGGAAGA TGGACCGGAT CAGCTCCTCC 600 AGTGGCCTGG GCTGCAAAGT GCTGAGGCGG CATTAAGAGG AAGTCCTGGC TGCAGACACC 660 TGCTTCTGAT TCCACAAGGG GCTTTTTCCT CAACCCTGTG GCCGCCTTTG AAGTGACTCA 720 TTTTTTTAAT GT 732

[Brief description of drawings]

FIG. 1 is an explanatory diagram of an expression plasmid pKKmIhB.

FIG. 2 is an explanatory diagram of the expression plasmid pKKrIhB.

FIG. 3 is an explanatory diagram of the expression plasmid pUCmIhB.

FIG. 4 is a diagram showing a procedure for constructing an expression plasmid pKKmIhB.

FIG. 5 is a diagram showing a procedure for constructing an expression plasmid pKKrIhB.

FIG. 6 SDS-PA of Escherichia coli crushed product in Example 3
It is a photograph which shows the result of GE. Lane 1 in (A)
Is a protein marker, lane 2 is the total protein of MC1061 and lane 3 is MC1061 expressing mIL-1.
Lane 4 shows the total protein of MC1061 expressing the mIL-1 · hBNP fusion protein. In (B), lane 1 is a protein marker, lane 2 is the total protein of MC1061 expressing the fusion protein, lane 3 is the supernatant obtained by washing the protein of lane 2 with a phosphate buffer, and lane 4 is the lane. 2 shows the precipitate of protein 2 washed with phosphate buffer.

FIG. 7 is a diagram showing a procedure for constructing an expression plasmid pUCmIhB.

FIG. 8: SDS-PA of Escherichia coli crushed product in Example 4
It is a photograph which shows the result of GE. Lane 1 shows the protein marker, lanes 2 to 7 show the total protein of MC1061 which highly expresses the fusion protein, and lane 8 shows the whole protein of non-expressing MC1061.

FIG. 9 is a view showing an HPLC pattern of hBNP cut out by treating the fusion protein with formic acid in Example 5.

FIG. 10 shows the results of amino acid sequence of hBNP obtained in Example 5.

FIG. 11 shows the results of measuring the smooth muscle relaxing activity of hBNP obtained in Example 5.

FIG. 12 is a diagram showing an HPLC pattern of hBNP cut out by treating the fusion protein with acetic acid in Example 6.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification code Internal reference number FI Technical display area A61K 37/02 ACX 8314-4C C07K 7/10 ZNA 8318-4H (C12P 21/02 C12R 1:19 ) C07K 99:00 (72) Inventor Atsushi Izumi 3-3-1, Koyodai, Ryugasaki-shi, Ibaraki Daiichi Pure Chemicals Co., Ltd. Tsukuba factory search synthesis group (72) Inventor Tetsuji Sudo 3-chome, Koyodai, Ryugasaki, Ibaraki No. 3 No. 1 Daiichi Pure Chemicals Co., Ltd. Tsukuba factory search synthesis group

Claims (6)

[Claims] 1. Aspartic acid-by genetic recombination
A method for producing a physiologically active peptide having no proline sequence, which comprises transforming an expression vector containing a gene encoding a fusion protein in which a protective peptide is bound via the aspartic acid-proline sequence and the physiologically active peptide. The fusion protein is collected from the resulting culture, and the aspartic acid-proline bond of the fusion protein is specifically cleaved with an acid. A method of producing a bioactive peptide. 2. The method according to claim 1, wherein the physiologically active peptide is human brain natriuretic peptide. 3. The method according to claim 1, wherein the physiologically active peptide has an amino acid sequence represented by SEQ ID NO: 2. 4. The method according to claim 1, wherein the protected peptide is a polypeptide containing mouse interleukin-1 or rat interleukin-1. 5. A DNA represented by SEQ ID NO: 3 or 4.
A recombinant plasmid that incorporates a sequence. 6. pKKmI having the structure shown in FIG.
The recombinant plasmid according to claim 5, which is selected from hB, pKKrIhB having the structure shown in FIG. 2, and pUCmIhB having the structure shown in FIG.