CN1405304A - Heat-resisting, antiproteinase acidic-neutral xylanase and its gene - Google Patents

Abstract

The invention provides a cylan enzyme and its coding gene. It has fine characters of good heat stability, high activity under acidic and neutral pH and anti-pepsin &parenzyme degradation. It is a new-type feed additive and can be widely used in animal feed.

Description

A kind of acidity-neutral xylanase and gene thereof of heat-resisting, protease inhibitor

Technical field

The present invention relates to a kind of zytase and gene thereof, the invention still further relates to a kind of animal-feed.

Technical background

Xylan (xylan) is a kind of heterozygosis poly five-carbon sugar, and main chain is linked to each other by the wood sugar glycosidic bond by a plurality of xylopyranosyl.The substituting group of the weak point of the multiple different sizes of ining succession on the side chain.Other several structural polysaccharides (as xylogen, Mierocrystalline cellulose, pectin, dextran etc.) are connected with key covalently or non-covalently in these side chains and the vegetable cell, form the important structure-cell walls of vegetable cell.Xylan mainly is present in the secondary wall of vegetable cell, is between xylogen and other saccharan, plays ligation.Xylan is the important component of plant hemicellulose, and it accounts for 1/3rd of plant carbohydrates total amount, is the fertile absorber resource that content second enriches after Mierocrystalline cellulose at occurring in nature.How many also difference to some extent of the contained xylan of different plants, contained xylan can account for 15%～30% of dry weight than many in the softwood in the hard material in the general hard material, generally accounts for 7%～10% of dry weight in the softwood.And in some yearly plants such as wheat, sugarcane, cotton seed hull, xylan content is very high, generally can both reach more than 30%.(Gregory?A?C?E?et?al.Biotech.and?GenticEngi.Rev.，15：439～455，1998)

The animal and fowl fodder main raw material of China derives from plant, as corn, wheat, barley etc., they all contain the xylan of some amount, account for 66% of its non-starch polysaccharide (NSPs) total amount as araboxylan in the wheat kind skin, araboxylan and beta-glucan account for 65% and 31% of its NSPs total amount respectively in the aleurone layer, 88% NSPs is an araboxylan in the albuminous cell, and wherein 1/3 is soluble.And these NSPs are the important antinutritional factor in the feed.Can hinder digesting and assimilating of livestock and poultry, reduce efficiency of feed utilization, bring difficulty for simultaneously the control of health and disease.

Generally believe that now xylan may influence the nutritive value of feed and the animal digestibility and utilization to feed in several ways.Wherein reason is that soluble xylan can be in conjunction with a large amount of water the most intuitively, volume increase, the viscosity of chyme in the animal digestive tract of searching for food are raise, influence the mixing efficiency of gastrointestinal movement to chyme, thereby influence digestion enzyme-to-substrate contact and digestion product have further influenced digestion and the nutrition absorption of animal to feed to the infiltration of small intestine epithelium fine hair.Xylan also may combine with essential other composition (as bile acide or mineral ion etc.) of digestive ferment or digestive enzyme activity and influence the activity of digestive ferment.In addition because xylan is the main component of cell walls, can not be by the digestive ferment hydrolysis, the macromole digestive ferment can not enter in the cell by cell walls, thereby the pair cell content formed a kind of bag by structure, and this bag of xylan is applied also can disturb digesting and assimilating of other nutrient in some cereal cell.In addition, xylan makes the animal that searches for food reduce nutrition absorption, and in the increase of accumulating of enteron aisle, this breeding for enteric microorganism provides good environment, and a large amount of harmful microbe propagation can produce many acidic substance, change enteron aisle pH environment, thereby influence digestive ferment performance optimum effect, microorganism can consume a large number of nutrients competitively simultaneously, reduces the utilization ratio of material.

Because xylan has above-mentioned anti-nutritional activity, in actual production, xylan can not effectively be degraded in the diet, can significantly reduce the digestibility of nutritive substance, reduces food consumption, influences the production performance of livestock and poultry.The drainage of viscosity fecal, control brings difficulty to health, and the livestock and poultry sickness rate increases; Simultaneously, can also influence the deposition of birds, beasts and eggs pigment, make poultry trunk chromaticness white partially, reduce carcass grade.(Morgan?A?J?et?al.Proc?Aust?Poult?Sym，，7：109～115，1995)

Zytase be can degradation of xylan a class lytic enzyme.Result of study shows, if add zytase in the feed, just can significantly reduce or eliminate the anti-oxidant action of xylan.Its concrete effect and mechanism comprise:

(1) behind interpolation zytase and the beta-glucanase, macromolecular saccharan is degraded into the less polysaccharide fragment of molecular weight, thereby reduces the toughness of chyme.Canada Sasktoon university studies confirm that, has a kind of linear relationship between the logarithm of the weightening finish of chick live body and material anharmonic ratio and anterior intestine chyme viscosity; The evidence of american commerce association is added zymin and is made fryer intestinal contents viscosity drop to 6.4CPS by 37.0CPS in the barley diet; Badford and Classen (1991) confirm that the chick weight gains of 70%-80% and the raising of feed conversion rate are caused by the chyme viscosity degradation.The reduction of intestinal contents viscosity helps the thorough mixing of digestive ferment and nutritive substance, reduces the thickness of motionless water layer, reduces the discharge of bile acide, is beneficial to digesting and assimilating of enteron aisle, thereby improves the digestibility of nutritive substance;

(2) improve the endogenous digestive enzyme activity, promote nutritive substance especially fat and proteinic digestion and absorption.Wang Zhen comes (1997) test on piglet to confirm, adds the external source zytase and has improved total protein lytic enzyme, amylase and the lipase activity in the intestinal contents.But it is not clear how it improves endogenous enzyme mechanism alive;

(3) behind interpolation zytase and the beta-glucanase, can reduce nutritive substance the accumulating that causes because of viscosity is too high at enteron aisle, thereby reduce intestinal bacteria group, this variation can make the attenuation of intestines wall, improve dietetic alimentation, the minimizing of Salmonella in the enteron aisle simultaneously can reduce the deconjugation of biliary salts, helps the digestion of fat.The weakening of bacterial flora can reduce the diarrhea rate of animal, helps the healthy growth of livestock and poultry;

(4) xylan is one of composition of plant cell wall, livestock and poultry endogenous digestive ferment can not decompose xylan, nutritive substance in the cell walls is difficult to discharge, zytase can decompose xylan and destroy cell wall structure, digestive ferment can fully be contacted, on the other hand with nutritive substance, the degraded of xylan, can make protein, starch and the fat tied mutually with it dissociate out, help the digestion of nutrition, improve animal feed intake, weightening finish and feed conversion rate.

In No. 105 bulletin of China Ministry of Agriculture, on " the allowing the feed and the fodder additives kind catalogue of use " of formulating, list zytase in the feed grade zymin.Produce zytase at the more existing feed factories of China at present, but only limit to use by oneself, because it yields poorly, the cost height does not form industrialization.At present, more to glycanases such as zytases as the research of the effect of fodder additives, but also relatively weaker to its physico-chemical property, the mechanism of action, determination of activity, suitable addition scheduling theory research aspect, remain to be furtherd investigate.The application surface of zytase in feedstuff industry face yield poorly, problem such as a little less than the proteolytic enzyme ability in cost height, poor heat resistance and the anti-animal gastrointestinal tract; demand screening the good zytase of character that is suitable for using in the feed urgently, and use genetically engineered and protein engineering means to come the cheap production of mass-producing.

Research to zytase just began as far back as the sixties, main research concentrates on the zytase of aspects such as being suitable for foodstuffs industry, pulp and paper industry, energy industry, has been separated to the zytase of a large amount of dissimilar difference in functionalitys from the microorganism in difference source.Study comparatively clearly have Trichoderma reesei (Trichodermareesei), Aspergillus niger (aspergillus niger), Streptomyces lividans (shallow Streptomyces glaucoviolaceus), Cellulomonas fimi (muck bacillus), Clostridium thermocellum (thermal fiber clostridium), Penicillium simplicissimum (simple mould) etc. to be produced zytase.The nearest more than ten years, along with the continuous development and progress, particularly genetic engineering technique of biotechnology and the widespread use of protein engineering, people are more deep to the understanding of zytase, isolated multiple xylanase gene, and the multiple zytase product of suitability for industrialized production.Table one has been enumerated the xylanase gene that part has been cloned into.

Table one: the part xylanase gene bacterium source gene title list of references Thermotoga neapolitana xynA Zverlov et al.1996Clostridium thermocellum xynA that clones in recent years; B Hayashi; et al.1999Trichoderma longibrachiatum xyn Bedford et al.1997Thermomyces lanuginosus xyn Hansen et al.1998Fibrobacter succinogens xynC Paradis et al.1993Cellulomonas fimi xynC Clarke et al.1996Rhodothermus marinus xyn1 Nordberg et al.1997Caldicellulosiruptor Rt69B xynA； B; C; D Morris et al.1999Cellulomonas sp. xcs16 Chaudhary et al.1997Streptomyces halstedii xysl Ruiz-arribas et al.1997Dictyoglomus thermophilum xynB Morris et al.1998Bacillus strain N137 xyaA Tabernero et al.1995Thermotoga maritime. xynA Winterhalter et al.1995Thermotoga neapolitana xynA Zverlov et al.1996Neocallimastix patriciarum xynB Black et al.1994Bacillus stearothermophilus xynA Gat et al.1994Bacillus sp. xynB Blanco et al.1996Thermoanaerobacterium. xynA Lee et al.1993saccharolyticumCaldocellum saccharolyticum xynA Lüthi et al.1990Raminococcus flavefaciens xynD Flint et al.1993Cochliobolus carbonum xyll Patricia et al.1993Butyrivibrio fibrisolvens xynB Lin et al.1993Streptomyces lividans xyhA； B; C Moreau et al.1994Penicillium sp.40 xynA Kimura et al.2000Bacillus sp.BT-7 bx1; 2,3 Tong et al.1999

Aspect the expression of xylanase gene, many good tries have been had in recent years.Usefulness intestinal bacteria (Escherichia coli) such as nineteen ninety Luthi attempt expressing the heat resistant xylanase gene xynA that derives from Caldocellum sacharolyticum for recipient bacterium, and the promotor of control xynA adopts expression vector P ^JLA602On thermoinducible pR and pL promotor.The expression amount of xynA can reach more than 20% of total protein of cell.And the XYNA that expresses has normal biologic activity, does not have significant difference (L ü thi E et al.Appli.and EnviroMicrobio, 56:2677～2683,1990) with original natural enzyme.Sung in 1993 etc. are according to colibacillary codon deflection synthetic Bacillus circulans (Bacillus circulans) Xylanase coding gene, and employing lac promotor, the expression amount of recombined xylanase in the cell pericentral siphon is up to 300mg/L fermented liquid (Sung W L et al.Protein Expr.Purif. as a result, 4:200～206,1993).Shendye, Lapidotd in 1996 in 1993 etc. utilize intestinal bacteria to express the heat resistant xylanase that derives from Bacillus respectively as recipient bacterium too, and the latter uses T7 promoters driven xylanase gene, and expression amount reaches 70% of total protein of cell.(Shendye?A?et?al.Biochem.Biophys.Res.Commun.，，195：776～784，1993；Shendye?A，et?al.FEMS?Microbiol.Lett.，108：297～302，1993；Lapidot?A?et?al.J.Biotechnol.51：259～264，1996)。Wakarchuk in 1994 etc. introduce Ser in zytase, forming does not influence its active disulfide linkage, make its thermotolerance improve 15 ℃.(Wakarchuk?WW?et?al.Protein?Engineering，7：1379～1386，1994)。Sung in 1999 etc. improve the XYNII that derives from Trichoderma reesei and the zytase of Bacillus circulans, form heterozyme, add 10 methods such as amino acid that are no more than by point mutation, the segment of getting different zytases, the thermotolerance of enzyme has been improved 28 ℃ more than at enzyme N end.(Sung?et?al.UnitedStates?patent，5866408，1999)。In the same year, the specific enzymes activity that Moreau etc. will derive from the XYLA of Streptomyces lividans by difference sudden change has improved 10% to 25% and has not waited, and the transformation period of enzyme is the highest has improved 47%, and the pH character of mutant enzyme enzyme reaction is identical with natural enzyme.(Moreau?A?et?al.Enzyme?Microb.Technol，16：420～424.，1994)

In China, the nearest more than ten years of the research of zytase are just begun, but now also be limited to basically on the screening, zytase purifying and the property analysis that produce the natural strain excellent of zytase, only cloned the minority xylanase gene, the utilization genetic engineering means comes industrialization production zytase product to yet there are no report.

The research of the zytase of feed special use just began in recent years, was different from the zytase of using on food, papermaking, the energy industry, and the zytase that is applied in the feed has special requirement in nature.The various zymins such as zytase that comprise that really are suitable for using in feed must possess following 3 special propertys simultaneously: 1. enzyme has good thermostability and must possess high reactivity at normal temperatures.On fodder production, feed processing all needs through a granulating process, and it is several minutes pyroprocess that a time length is arranged in pelletization, general in 75～93 ℃ scope, and this just requires fodder enzyme must energy high temperature resistant.But then, fodder enzyme must have higher enzymic activity again at normal temperatures, because the final effect place of fodder enzyme is in the intestines and stomach of animal normal body temperature, these are different with the industrial more employed high temperature enzyme that reacts under hot conditions.2. enzyme all has high reactivity in acid and neutral scope.The environment of fodder enzyme is the gi tract of animal, it is acid that the stomach of monogastric animal is, the pH value is 2.0～3.5, the pH value raises gradually after entering enteron aisle, reach 6.5-7.0 until pH, this just requires optimal pH of good fodder enzyme to be acidity, and all can keep high reactivity in this scope of pH2.0 to 6.5, like this action time of enzyme the longest, can superlatively bring into play its efficient.3. enzyme has stronger protease inhibitor degradation capability.Animal secretes multiple protein enzymes such as stomach en-, trypsinase with digest food in gi tract, fodder enzyme itself is exactly a kind of protein, also might be lost activity by these proteasome degradations, this must have certain resistance to the proteolytic enzyme in the animal gastrointestinal tract with regard to requiring fodder enzyme.In addition, mixed feed then also need consider in zymin all feeds with enzyme to the resistance towards proteases problem in the prozyme.The report that up to the present, the zytase that possesses above-mentioned 3 specific characters is not simultaneously also arranged.

Summary of the invention

The purpose of this invention is to provide a kind of character zytase good, that be suitable in feed, using and encoding gene thereof, by engineered method, utilize the reorganization bio-reactor to come the cheap neutral phytase of producing of industrialization that genetic resources is provided for further.

The inventor screens a kind of natural bacterial strain, and the zytase that it produced is suitable for using in feed.This Xylanase XYNB has good thermostability simultaneously and must possess high reactivity at normal temperatures, all has characteristics such as high reactivity, protease inhibitor degraded in acidity and neutral scope.The zytase that the streptomycete Streptomyces olivaceoviridis A1 that the present invention screens is produced, its optimum pH is 4.6, keeps the enzymic activity more than 60% in the scope of pH2～7; Optimum temperuture is 50 ℃, handles 30 minutes down at 80 ℃, and enzymic activity maintains more than 80%; With stomach en-and trypsin treatment 30 minutes, enzymic activity maintained 98%.The also unprecedented report of the zytase of this character.The aminoacid sequence of this enzyme is shown in SEQ ID NO:2.

The encoding gene that is isolated and cloned into this zytase of the present invention, it has the nucleotide sequence shown in the SEQ ID NO:1, for this reason the transformation of gene and efficiently express the genetic material that provides good in various heterologous gene expression systems.Method separating clone by PCR this xylanase gene xynB, the DNA complete sequence analysis is the result show, 576 Nucleotide of the proteic structure gene total length of encoding mature, 191 amino acid of encoding.Aminoacid sequence shows, N holds preceding ten amino acid and the G/11 group zytase albumen n end sequence of reporting at present that derives from streptomycete that very high homology is arranged, but aminoacid sequence that the XYNB maturation protein is complete and GeneBank go up various zytase amino acid sequence homologies relatively, the highest is 86% only, illustrates that XYNB is a kind of new zytase.Catalytic domain is only arranged in the aminoacid sequence of XYNB, do not have cellulose binding (CBD).

The SDS-PAGE of the zytase behind Brief Description Of Drawings Fig. 1 purifying analyzes 1. standard protein molecular weight; 2. medium supernatant; 3.85% (NH ₄) ₂SO ₄Precipitation; 4. ion exchange chromatography; 5. optimal pH Fig. 3 of gel chromatography Fig. 2 zytase. optimal reactive temperature Fig. 5 of pH stability diagram 4 zytases of zytase. thermostability Fig. 6 of zytase. the proteic gene order Fig. 7 of zytase encoding mature. the zytase maturation protein aminoacid sequence of deriving

Embodiment

Experiment one

This description of test produces the screening procedure of the natural bacterial strain of zytase.

Coat after soil sample and compost sample dilute routinely and produce enzyme substratum (2% xylan, 1% beef peptone, 0.3% yeast culture, 1% dipotassium hydrogen phosphate, 0.05% sal epsom, 1.5% agarose, pH5.0) on the flat board, cultivate 5～6d for 35 ℃, picking produces the transparent circle bacterium colony and is producing enzyme culture medium flat plate line separation, the sepn process 3 that repeats to rule is taken turns, and makes the bacterial strain purifying.Screen bacterial strain 230 strains of secretion zytase by this method.

Produce bacterial strain in order therefrom to screen the satisfactory zytase of zymologic property, these bacterial strains produce in the enzyme substratum at liquid respectively and cultivated 7 days, and nutrient solution carries out the preliminary judgement of zymologic property after dilution.Enzymatic determination adopts international Somogyi-Nelson method, solubility 4-O-Me-D-glucurono-D-xylan (Sigma company with 0.25ml 0.5%, From birchwood) solution and 0.2ml citric acid-Sodium phosphate dibasic damping fluid adds test tube, puts into 55 ℃ of water-bath preheating 3min.0.05ml having been diluted good enzyme liquid joins in the test tube again, continuation is reacted 10min in 37 ℃ of water-baths, in test tube, add 0.5ml Somogyi reagent (alkaline copper reagent) termination reaction, test tube is heated 15min in boiling water, use the flowing water cool to room temperature immediately, in test tube, add 0.5ml Nelson reagent (arsenomolybdate reagent) colour developing, place 10min under the vigorous stirring on Voltex mixer, room temperature, add 1ml distilled water, centrifugal 5 minutes of 10000rpm removes floss.The 500nm place surveys light absorption value.Contrast is boiled deactivation in 20 minutes for earlier 0.05ml enzyme liquid being joined in 0.2ml citric acid-Sodium phosphate dibasic damping fluid in 100 ℃ of boiling water, add the substrate insulation with volume again.Xylanase activity unit (U) is defined as: under certain condition, per minute discharges the required enzyme amount of 1 μ mol wood sugar by xylan.

The pH that at first carries out enzymatic reaction measures, the zytase that each bacterial strain produced is all measured enzymic activity simultaneously in the buffering system of pH3 and pH6.5, if a kind of zytase mutual difference of enzymic activity under these two pH conditions surpasses 25%, then eliminating, is all to have the active zytase of high enzyme under acid and neutrallty condition because we will screen.By this method, preliminary screening may satisfactory bacterial strain 22 strains to the pH characteristic.

Next step carries out the primary dcreening operation of enzyme heat stability, the zytase that above-mentioned 22 strain bacterial strains are produced, be incubated 30 minutes down at 70 ℃ respectively, measure enzymic activity more at normal temperatures, compare with the enzymic activity of the same zytase of not doing 70 ℃ of processing, screening residual enzyme activity reaches the zytase more than 70%, and this zytase may have thermostability preferably.By this method, from 22 strain bacterial strains of previous step, screen 7 strains.

Further zytase protease inhibitor ability is carried out rough determination again, the zytase that the 7 strain bacterial strains that previous step screens produce, get the 0.5ml diluent respectively, each adds 0.5ml stomach en-and 0.5ml trypsin 0.1mg/ml, with pH2.0, the preparation of 0.1mol/L Gly-HCl damping fluid), mix back pH about 3.5, handle 30min in 37 ℃, survey enzymic activity with ordinary method again, with the enzymic activity that does not deal with is contrast, and it has stronger antipepsin and trypsinase ability to loss of enzyme activity with interior explanation 5%.By this step screening, be separated to satisfactory bacterial strain one strain, be Streptomyces olivaceoviridis through preliminary evaluation, called after Streptomyces olivaceoviridis A1, and as the material of further research.

Experiment two

The purifying procedure of this description of test zytase.

At first carry out the ammonium sulfate precipitation of zytase, bacterial strain shaking table in producing the enzyme substratum was cultivated after 6～7 days, clear enzyme solution on the centrifuging and taking, crude enzyme liquid is placed ice bath, slowly add ammonium sulfate to 50% saturation ratio while stirring, put 2 hours on ice, the centrifugal 30min of 13000rpm then, get precipitation, precipitation is heavy molten with citric acid-Sodium phosphate dibasic damping fluid, becomes to concentrate enzyme liquid.Then carry out the ion exchange chromatography purifying, will concentrate HiTrap Q Sepharose XL (amersham pharmaciabiotech prepacked column) anion column on the enzyme liquid.Application of sample 0.5ml with the Tris-HCl buffered soln wash-out balance pillar of pH9.0,0.02mol/L, uses 0～1mol/L NaCl gradient elution of same buffer preparation instead earlier, and flow velocity is 2ml/min, fraction collection, every pipe 1ml.Then the solution in the collection tube is surveyed enzyme work and carried out the protein electrophoresis analysis.Carrying out gel chromatography at last separates, detection behind ion-exchange chromatography there is enzyme collection sample alive again through molecular sieve Superdex 75 HR 10/30 (amersham pharmacia biotech prepacked column), application of sample 0.5ml, with pH5.7 citric acid-Sodium phosphate dibasic buffer solution elution, flow velocity is 0.4ml/min, fraction collection, every pipe 1ml obtains pure Xylanase XYNB.

Respectively go on foot enzyme activity, the protein content of sample more than having measured respectively and carried out SDS-PAGE.Purification result sees Table 1, and crude enzyme liquid is brought up to 2869.78/mg than living from 154.64U/mg behind a few step purifying, and the purifying multiple is 18.56 times, yield 8.6%.Protein electrophoresis result (Fig. 1) shows that the zytase albumen behind the purifying is single band on electrophoresis, molecular weight is about 23kD.

Table 1: Xylanase XYNB purification step and result

Volume, (ml) total enzyme is lived, (U) than living, (U/mg) yield, (%) crude enzyme liquid 10 749.67 154.64 100 concentrated solutions 0.5 171.34 162.40 22.9 are crossed ion column 5 130.50 1124.20 17.4 and crossed molecular sieve 12 64.32 2869.78 8.6 notes: protein concn is measured with the Coomassie brilliant blue method

Experiment three

The measuring method of the zymologic property of this description of test zytase.

The measuring method of the optimal pH of zytase and pH stability is as follows:

Purified zytase carries out enzymatic reaction to measure its optimal pH under different pH values.The substrate xylan carries out Xylanase activity mensuration under in 0.1mol/L citric acid-Sodium phosphate dibasic damping fluid of different pH 37 ℃.Result (Fig. 2) shows that the optimal pH of XYNB is 4.6, and in the scope of pH2～7, enzymic activity all maintains more than 60% of maximum enzyme activity.Zytase is 37 ℃ of processing 30min in the damping fluid of above-mentioned various different pH, measure enzymic activity again under 37 ℃ in the pH4.6 buffer solution system, with the pH patience of research enzyme.Result (Fig. 3) shows that zytase is stable in the scope of pH1～9, illustrates that this enzyme has resistance to acids and bases preferably.

The optimum temperuture of zytase and thermal stability determination method are as follows:

Enzymatic reaction is carried out in being determined as under citric acid-Sodium phosphate dibasic damping fluid (pH4.6) buffer solution system and differing temps of the optimum temperuture of zytase.Temperature tolerance is determined as zytase and handles different time under differing temps, carries out enzyme assay again under 37 ℃.Enzyme reaction optimum temperuture measurement result (Fig. 4) shows that its optimum temperuture is 50 ℃.The thermostability test of enzyme shows (Fig. 5), and behind 80 ℃ of processing 30min, residual enzyme is lived and also had about 85%, and behind the processing 60min, enzymic activity still maintains more than 70%.

The K of zytase _mValues determination method is as follows:

Xylan (4-O-Me-D-glucurono-D-xylan, Sigma Frombirchwood) with different concns is a substrate, in citric acid-Sodium phosphate dibasic damping fluid (pH4.6) buffer solution system, measures enzymic activity down, calculates its k under 37 ℃ for 37 ℃ _mValue.After measured, this zytase is the k of substrate with the xylan under 37 ℃ _mValue is 22.1 (g/Kg), maximum reaction velocity V _MaxBe 105.26 (μ mol/mlmin)

The influence that different chemical reagent is lived to the XYNB enzyme is measured as follows:

All cpds (final concentration is 1mmol/L) is incubated 30min with enzyme liquid down at 37 ℃, measures enzyme activity then according to a conventional method, is 100% with the enzyme activity that contrasts.Result's (table 2) shows to have only Mg ²⁺, Cr ³⁺XYNB is had slight activation, and all the other are significantly effect not.

The various chemical reagent of table two are to the influence of Xylanase XYNB vigor

Concentration residual enzyme activity

Reagent

(mol/L) (％)

CK 100

KCl 10 ^-3 100

MgCl ₂ 10 ^-3 115

CaCl ₂ 10 ^-3 104

ZnSO ₄ 10 ^-3 97

CrCl ₃ 10 ^-3 110

EDTA 10 ^-3 107

CuSO ₄ 10 ^-3 92

SDS 10 ^-3 101

The cellulase activity measuring method of zytase is as follows:

Make substrate with 0.5% methylcellulose gum M20, all the other and the identical cellulase activity of surveying of survey xylanase activity, the result shows this zytase cellulose-less enzymic activity.

Zytase antipepsin and trypsinase ability are measured as follows:

0.5ml zytase solution, add 0.5ml stomach en-, trypsin 0.1mg/ml, with pH2.0, the preparation of 0.1mol/L Gly-HCl damping fluid), mix back pH about 3.5, handle 30min in 37 ℃, and then survey enzyme with ordinary method and live, the result shows enzyme nothing influence alive, illustrates that this enzyme has good antipepsin, trypsinase ability.

XYNB maturation protein N behind purifying end has been carried out determined amino acid sequence, and the result shows that preceding 10 aminoacid sequences of its N-end are: A-T-V-I-T-T-N-Q-T-G.

Experiment four

The separating clone program of this description of test zytase maturation protein encoding gene xynB

Bacterial strain liquid medium within (xylan 20g/L, beef peptone 10g/L, yeast culture 3g/L, dipotassium hydrogen phosphate 10g/L, sal epsom 0.5g/L, pH5.4) in 35 ℃, 240rpm cultivated 3～4 days, thalline is collected in 10000rpm centrifugation, get the 500mg bacterial sediment, the sterilized water washing, centrifugation, precipitation is resuspended in 5mL lysozyme soln (2mg/mL N,O-Diacetylmuramidase, 50 μ g/mL RNase, 0.3mol/L sucrose, 25mmol/L Tris-HCl, 25mmol/L EDTA, pH8.0) in, 37 ℃ are incubated 30 minutes down, add the 1mL lysozyme soln again, and 45 ℃ are incubated 30 minutes down, add 3mL 2%SDS and stirring, significantly descend up to strength of solution, add 9mL phenol (Tris is saturated), the centrifuging and taking supernatant, with isopyknic phenol-chloroform, chloroform is extracting successively, is dissolved among the TE of pH8.0 standby behind the alcohol precipitation DNA.

According to the synthetic degenerated primer of this zytase N terminal amino acid sequence of measuring (P1:5 ' ATCACCACCAACCAGACCGGC 3 '), the primer of the other end adopts 20 random primers, right with primer P1 group respectively, with the total DNA of Streptomyces olivaceoviridis A1 is template, carries out pcr amplification.The PCR reaction parameter is: 94 ℃ of sex change 1min, 50 ℃ of annealing 45sec, 72 ℃ of extension 1min; Back 72 ℃ of insulation 10min are taken turns in circulation 30.Wherein one group of primer amplification has arrived the PCR fragment of about 1kb.According to this proteic molecular weight of measuring, infer that this zymoprotein amino acid number should be about 200, corresponding mrna length is no more than about 1.kb, infers the Xylanase coding gene of this PCR fragment for intending cloning for us.Show by sequencing, 576 Nucleotide of this gene length, 191 amino acid of encoding, the n terminal amino acid sequence of deriving according to nucleotide sequence is consistent with the determined amino acid sequence result of purifying protein.This gene of being cloned into and the xylanase gene sequence on the Genebank are carried out homology relatively, the result shows, it has homology with the zytase that derives from streptomycete of report, illustrate that the gene that we are cloned into is the encoding gene of zytase, but what its nucleotide sequence homology and amino acid sequence homology were the highest all only is 86%, significant difference on comprehensive its zymologic property illustrates that this xylanase gene is a new gene.

We have further verified its gene function this gene in intestinal bacteria.Zytase at expression in escherichia coli has normal biologic activity, and this has proved that further the gene that we are cloned into is the xylanase gene that function is arranged.

Sequence table＜110〉Biological Technology institute, Chinese Academy of Agricultural Sciences of Institute of Feeds,China Academy of Agriculture Sciences＜120〉a kind of acidity-middle body acidic xylanase and gene＜130 thereof of Nai Re antiprotease〉I2001244＜160〉3＜170〉PatentIn version 3.1＜210〉1＜211〉576＜212〉DNA＜213〉Streptomyces olivaceoviridis＜220〉＜221〉CDS＜222〉(1) .. (576)＜223〉＜400〉1gcc acg gtc atc acc acc aac cag acc ggc acc aac aac ggg ttc tac 48Ala Thr Val Ile Thr Thr Asn Gln Thr Gly Thr Asn Asn Gly Phe Tyr1,5 10 15tac tcc ttc tgg acc gac ggc ggc ggt tcg gtc tcg atg acc ctg aac 96Tyr Ser Phe Trp Thr Asp Gly Gly Gly Ser Val Ser Met Thr Leu Asn

20 25 30tcc?ggc?ggc?aac?tac?agc?acc?tcg?tgg?acg?aac?tgc?ggg?aac?ttc?gcc 144Ser?Gly?Gly?Asn?Tyr?Ser?Thr?Ser?Trp?Thr?Asn?Cys?Gly?Asn?Phe?Ala

35 40 45gcc?ggc?aag?ggc?tgg?agc?aac?ggc?gga?cgc?agg?aac?gtg?cag?tac?tcg 192Ala?Gly?Lys?Gly?Trp?Ser?Asn?Gly?Gly?Arg?Arg?Asn?Val?Gln?Tyr?Ser

50 55 60ggc?agc?ttc?tac?ccg?tcc?ggc?aac?ggc?tac?ctg?gcg?ctg?tac?ggg?tgg 240Gly?Ser?Phe?Tyr?Pro?Ser?Gly?Asn?Gly?Tyr?Leu?Ala?Leu?Tyr?Gly?Trp65 70 75 80acc?tcg?aac?ccg?ctc?gtc?gag?tac?tac?atc?gtc?gac?aac?tgg?ggc?aac 288Thr?Ser?Asn?Pro?Leu?Val?Glu?Tyr?Tyr?Ile?Val?Asp?Asn?Trp?Gly?Asn

85 90 95tac?cgg?ccc?acc?gga?acg?tac?aag?ggc?acg?gtc?acc?agc?ggc?ggc?ggc 336Tyr?Arg?Pro?Thr?Gly?Thr?Tyr?Lys?Gly?Thr?Val?Thr?Ser?Gly?Gly?Gly

100 105 110acg?tac?gac?gtc?tac?cag?acg?acg?cgg?tac?aac?gcc?ccc?tcc?gtg?gaa 384Thr?Tyr?Asp?Val?Tyr?Gln?Thr?Thr?Arg?Tyr?Asn?Ala?Pro?Ser?Val?Glu

115 120 125ggc?acc?aag?acc?ttc?aac?cag?tac?tgg?agc?gtc?cgg?cag?tcc?aag?cgg 432Gly?Thr?Lys?Thr?Phe?Asn?Gln?Tyr?Trp?Ser?Val?Arg?Gln?Ser?Lys?Arg

130 135 140acc?ggc?ggc?acc?atc?acc?acc?ggc?aac?cac?ttc?gac?gcc?tgg?gcc?cgc 480Thr?Gly?Gly?Thr?Ile?Thr?Thr?Gly?Asn?His?Phe?Asp?Ala?Trp?Ala?Arg145 150 155 160tac?ggc?atg?caa?ctg?ggc?agc?ttc?agc?tac?tac?atg?atc?ctc?gcc?acc 528Tyr?Gly?Met?Gln?Leu?Gly?Ser?Phe?Ser?Tyr?Tyr?Met?Ile?Leu?Ala?Thr

165 170 175gag?ggc?tac?cag?agc?agc?ggc?tcc?tcc?aac?atc?acg?gtc?agc?ggc?tga 576Glu?Gly?Tyr?Gln?Ser?Ser?Gly?Ser?Ser?Asn?Ile?Thr?Val?Ser?Gly

180 185 190<210>2<211>191<212>PRT<213>Streptomyces?olivaceoviridis<400>2Ala?Thr?Val?Ile?Thr?Thr?Asn?Gln?Thr?Gly?Thr?Asn?Asn?Gly?Phe?Tyr1 5 10 15Tyr?Ser?Phe?Trp?Thr?Asp?Gly?Gly?Gly?Ser?Val?Ser?Met?Thr?Leu?Asn

20 25 30Ser?Gly?Gly?Asn?Tyr?Ser?Thr?Ser?Trp?Thr?Asn?Cys?Gly?Asn?Phe?Ala

35 40 45Ala?Gly?Lys?Gly?Trp?Ser?Asn?Gly?Gly?Arg?Arg?Asn?Val?Gln?Tyr?Ser

50 55 60Gly?Ser?Phe?Tyr?Pro?Ser?Gly?Asn?Gly?Tyr?Leu?Ala?Leu?Tyr?Gly?Trp65 70 75 80Thr?Ser?Asn?Pro?Leu?Val?Glu?Tyr?Tyr?Ile?Val?Asp?Asn?Trp?Gly?Asn

85 90 95Tyr?Arg?Pro?Thr?Gly?Thr?Tyr?Lys?Gly?Thr?Val?Thr?Ser?Gly?Gly?Gly

100 105 110Thr?Tyr?Asp?Val?Tyr?Gln?Thr?Thr?Arg?Tyr?Asn?Ala?Pro?Ser?Val?Glu

115 120 125Gly?Thr?Lys?Thr?Phe?Asn?Gln?Tyr?Trp?Ser?Val?Arg?Gln?Ser?Lys?Arg

130 135 140Thr?Gly?Gly?Thr?Ile?Thr?Thr?Gly?Asn?His?Phe?Asp?Ala?Trp?Ala?Arg145 150 155 160Tyr?Gly?Met?Gln?Leu?Gly?Ser?Phe?Ser?Tyr?Tyr?Met?Ile?Leu?Ala?Thr

165 170 175Glu?Gly?Tyr?Gln?Ser?Ser?Gly?Ser?Ser?Asn?Ile?Thr?Val?Ser?Gly

180 185 190<210>3<211>21<212>DNA<213>Artificial<400>3atcaccacca?accagaccgg?c 21

Claims (4)

1. zytase, it has the aminoacid sequence shown in the SEQ ID NO:2.

2. gene of the described zytase of claim 1 of encoding.

3. according to the described gene of claim 2, it has the nucleotide sequence shown in the SEQ ID NO:1.

4. animal-feed, it contains the described zytase of claim 1.

Images