CN1160461C - Glucanase gene and lichenbacillus - Google Patents

Abstract

The present invention discloses a gene for coding beta-1, 3-1, 4 glucanase and a bacillus licheniformis strain EGW039 containing the gene. The beta-1, 3-1, 4 glucanase produced by the present invention has high effective decomposition effect on a beta-1, 3 bond and a beta-1, 4 bond, can increase the utilization factor of barley, wheat, etc. as feed grains, can economize feed grains and can solve the problem that Chinese southern animal production greatly depends on northern maize; in addition, the beta-1, 3-1, 4 glucanase can reduce the difficulty of filtration in beer production and increase a raw material utilization factor.

Description

A kind of β-1,3-1,4-glucanase gene and Bacillus licheniformis EGWO39

Technical field

The invention belongs to microorganism field, relate in particular to a kind of β-1,3-1,4-glucanase gene and a kind of Bacillus licheniformis.

Background technology

Beta-glucan is distributed widely in plant and the microorganism wall, the beta-glucan of different sources, and the combination and the ratio of its dextran glycosidic bond are not quite similar.Glucan content is very high in wheat class seeds such as barley and Fructus Hordei Germinatus, and these dextran are via β-1 by glucose, 3 keys and β-1,4 keys, the macromolecular compound that ratio with 30% and 70% is polymerized, have very high viscosity, they can increase filtration difficulty and reduce raw material availability in beer production.Dextran is a kind of antinutritional factor simultaneously, and it can form very heavy-gravity material in animal intestinal, influence absorption of nutrient ingredients, reduce feed conversion rate and breeding performonce fo animals, and make ight soil thickness, not manageability, be harmful to intestinal health, help some pathogenic bacteria breedings, increase sickness rate.

Beta-glucanase is can the degrade enzyme of beta-glucan of a class, adds beta-glucanase and can eliminate above-mentioned disadvantageous effect in barley type feed, reaches the feeding effect the same with corn.Beta-glucanase does not have industrialization so far at home, and owing to the increase of wheat class feedstuff raw material, the application demand of beta-glucanase in feed is increasing, becomes a kind of very important feed enzyme gradually in recent years.Beta-glucanase is that developed country is applied to one of important fodder enzyme preparation that livestock industry produces, as far back as the seventies, the US and European various countries have just carried out the research to beta-glucanase, at present existing many commercially produced products, in addition, also contain beta-glucanase in the compound enzymic preparations such as " love are supported one's family " as " the eight treasures (choice ingredients of certain special dishes) prestige " of the U.S., Holland.Entered period at present about the research of beta-glucanase based on molecular biology, the microbe-derived beta-glucanase gene order of having announced has 120 more than at least, mrna length is generally at 1.2-1.6kbp, the zymoprotein precursor of expressing is generally 400-500 amino acid, wherein signal peptide length is generally 18-24 amino acid, molecular weight is generally 45-55Kda. and has successfully constructed the beta-glucanase engineering strain abroad, genetic donor comprises Oerskovia manthineolytica, Bacillussubtilis, Bacillus licheniforms, Bacillus amyloliquefaciens, Penicillium melinii, Trichoderma reesei, Trichoderma viride, Trichoderma longibrachiatum, especially belong to the in the majority of source with Bacillus genus and Trichoderma, the expressive host bacterium comprises E.coli, Aspergilli, Saccachromyces cerevisiae, especially with in the majority as the expressive host bacterium of E.coli and Saccachromyces cerevisiae, be two systems of Bacillus--E.coli and Trichoderma--Saccachromyces cerevisiae basically.But expression amount is all very low.Domestic since the early 1990s the research of beta-glucanase, obtained bigger progress, be separated to multiple beta-glucanase and produced bacterial strain and done development and applied research.But because of production of enzyme is too low, can't industrialization.The internet retrieval shows: end at famous EMBL to September 20 calendar year 2001,6 β-1 are only arranged in the gene information storehouse of Genbank and ExPASy molecular biology website, 3-1,4-glucanase gene sequence comes from four kinds of microorganism Xanthophyllomycesdendrorhous, Clostridium thermocellum, Bacillus subtilis and T.harzianum; In 1986-2001 United States Patent (USP) database, only find to have only in the genus bacillus Bacillus amyloliquefaciens and Bacillus macerans to produce β-1,3-1,4-dextranase.The dextranase of development nearly all is β-1 more than 90% both at home and abroad, the 4-dextranase, and for the more practical and effective β-1 of degraded dextran, 3-1, the 4-dextranase is seldom studied, rarer industrialization.But dextran is via β-1 by glucose in the wheat class seed, 3 and β-1,4 keys are polymerized with 30% and 70% ratio, so β-1,3-1, the 4-dextranase is than β-1, the 4-dextranase is more with practical value, especially can be cloned into the gene of this enzyme, then is structure high yield β-1,3-1,4-dextranase engineering strain has been established solid foundation.

The object of the invention is to provide a kind of β-1,3-1,4-glucanase gene.

The object of the invention is to provide a kind of can efficiently produce β β-1,3-1, the bacterial strain of 4-dextranase.

Summary of the invention:

A kind of β-1,3-1,4-glucanase gene, its aminoacid sequence are the described sequences of Figure of description Fig. 1.

Above-mentioned β-1,3-1,4-glucanase gene, its nucleotide sequence are the described sequences of Figure of description Fig. 2.

A kind of above-mentioned β-1 that contains, 3-1, the lichem bacillus strain of 4-glucanase gene (Bacilluslicheniformis) EGW039, be deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center September 24 calendar year 2001, it abbreviates CGMCC as, and deposit number is CGMCCNO.0635.，

The invention described above lichem bacillus strain (Bacillus licheniformis) EGW039 is the genus bacillus of the product dextranase selected and remain in the research of screening proteolytic enzyme, the back is as screening β-1,3-1, the starting strain of 4-dextranase, to producing β-1,3-1, the bacterial strain of 4-dextranase carry out directed primary dcreening operation, multiple sieve obtains this bacterial strain after uviolizing, through tame stable after, through identifying and called after lichem bacillus strain (Bacillus licheniformis) EGW039.The main classification foundation that bacterium is planted surely " Bergey ' s bacteriology classification manual " (the 8th edition) and " division bacteria basis " (big self-sown the writing of king, 1977, Science Press).

Bacillus licheniformis bacterium colony of the present invention or morphological features: the invention described above Bacillus licheniformis Bacillus licheniformis is after cultivating 24 hours under 30 ℃, the Gram-reaction positive, shaft-like, chaining not, size is 1.11 * 2.22 microns, give birth in the gemma, size is 1.11 * 2.00 microns, and is aerobic, can utilize glucose, wood sugar, sucrose, pectinose and N.F,USP MANNITOL.On nutrient agar the subcircular bacterium colony, smooth surface, neat, present opaque milk cow look.

Carbon source is produced the effect of dextranase to Bacillus licheniformis EGW039:

In substratum, add different sugar, measure sugar bacterial strain of the present invention is produced β-1,3-1, the influence of 4-dextranase enzymic activity, the effect value of result's (seeing Table 1) high fructose syrup is the highest, is sucrose and glucose secondly, and the two effect is close, semi-lactosi worst.

Table 1, carbon source are produced the effect of dextranase to Bacillus licheniformis EGW039

Carbohydrate, concentration %	Enzymic activity, relative value %	Carbohydrate	Enzymic activity, relative value %
				Glucose, 0.5	406.2 89.07	Cellobiose, 0.5	340.5 74.63
High fructose syrup, 1.0	456.3， 100.00	Cane molasses, 1.0	350.3 76.77
				Wood sugar, 0.5	268.5 58.84	The corn molasses, 1.0	297.8 65.26
Sucrose, 0.5	416.2 91.2	Maltose, 0.5	358.2 78.50
				Lactose, 0.5	372.8 81.7	Raffinose, 0.5	162.4 35.58
Semi-lactosi, 0.5	125.7 27.54

^*Culture condition: 37 ℃, 48h, 250r/min.

Nitrogenous source produces the effect of dextranase to Bacillus licheniformis EGW039:

In substratum, add different nitrogenous sources, measure the effect that nitrogenous source produces dextranase to Bacillus licheniformis EGW039, result's (seeing Table 2) (NH ₄) ₂SO ₄Effect best, secondly be (NH ₄) ₂HPO ₄And yeast extract paste, worst is NaNO ₃

Table 2, nitrogenous source produce the effect of dextranase to Bacillus licheniformis EGW039

Nitrogenous source and concentration, %	Enzymic activity, relative value %	Carbohydrate	Enzymic activity, relative value %
				(NH 4) 2SO 4，0.12	461.5 100.00	NH 4NO 3，0.12	389.0 84.3
(NH 4) 2HPO 4，0.12	454.6 98.50	Peptone, 0.12	378.9 82.1
				Yeast extract paste, 0.12	437.9 94.90	NaNO 3，0.12	291.7 63.2

^*Culture condition: 37 ℃, 48h, 250r/min.

Lichem bacillus strain (Bacillus licheniformis) EGW039 bacterial strain storage conditions: medium component (g/l): barley meal (or Semen Maydis powder) 30, extractum carnis 10, glucose 5, DAP 3, sodium-chlor 5, agar 20, pH nature; Sterilized 20 minutes cooling back microbe inoculation for 121 ℃ down; Cultivated 48 hours down for 37 ℃, about-80 ℃ or-20 ℃, carry out bacterial classification then and preserve.

β-1,3-1,4--glucanase gene clone and order-checking:

Extract total DNA as pcr template according to follow procedure from donor bacterium Bacillus licheniformis EGW039: 6g Bacillus licheniformis EGW039 wet thallus, be suspended in 50ml 0.05molphosphorate buffer (including 0.6mol/l sucrose), add lysozyme0.5mg/ml according to above-mentioned volume, 37 ℃ of reactions 1 hour, centrifugal under 2000r/min then, abandon supernatant, receive the protoplastis precipitation; 50ml deionized water suspension protoplastis, centrifugal 10min under 13000g stays precipitation again, and 50ml of 10% (1.5mol/l) NaCl contains (0.034mol/l Na ₃Citrate), repeat aforementioned centrifugation, precipitation is dissolved in the 0.6-0.8ml deionized water, add 25 microlitre RNase again, cultivate 10-20min down, to wherein adding equivalent phenol, phenol-chloroform, chloroform (each 13000g at 37 ℃, 10min, stay supernatant), 0.54 volume Virahol in aforementioned supernatant liquor, centrifugal 10min under 13000g, stay precipitation, to precipitate with 70% cold washing with alcohol, freeze-drying gets the total DNA of Bacillus licheniformis EGW039.

With Bacillus subtilis (Nucl Acids Res., 1984,12 (13), β 5355-5367)-1,3-1,4--glucanase gene sequence is removed 36 amino acid whose signal coding sequences of a coding of glucanase gene 5 ' end as the foundation of design primer, designs following Auele Specific Primer carries out goal gene by PCR method amplification:

P1：5’CAGAGCTCTATGCAAACAGGTGGATCGTTTTTTGAC3’

P2：5’CAGGATCCTTATTTTTTTGTATAGCGCACCCAGT 3’

PCR reaction system following (50 microlitre): 22.5,10 times of PCR buffer of sterilized water, dNTPs, P1, P2, template DNA, 2.5 μ l Taq ploymerase (5U/ μ l); The PCR program is as follows: mix (back 94 ℃, 5min adds 2.5 μ l Taqploymerase (5U/ μ l) for 6000r/min, 20sec) preceding 6 kinds of components, 6000r/min, and 20sec carries out PCR:94 ℃ then, 1min → 55 ℃, 1min → 72 ℃, 1min; After 30 circulations, 72 ℃, 10min; 4 ℃, 5-30min; Agarose electrophoresis is downcut unique DNA band and is extracted DNA, and fast purifying is cloned on the pUC18 carrier according to ordinary method and is checked order; Dna sequencing is undertaken by Shanghai Genecore Biotech.Inc., and sequencing result is seen Figure of description Fig. 2.

According to above-mentioned sequencing result, from Bacillus licheniformis EGW039 β-1,3-1, the ORF mrna length of 4-glucanase gene is 645 bp, 215 amino acid of encoding, its amino acid sequence coded is seen Figure of description Fig. 1, with Bacillus subtilis the difference of 58 Nucleotide is arranged on dna sequence dna, the principal character of gene structure and Bacillus subtilis (Nucl Acids Res., 1984,12 (13), β 5355-5367)-1,3-1, the 4--glucanase gene is similar.

Advantage of the present invention and beneficial effect:

(1) β of the present invention-1,3-1, the 4--dextranase all has Degradation to β-1,3 key and β-1,4 key of beta-glucan, it is more thorough to degrade, improved the utilization ratio as feed such as barley, wheat, improve utilization ratio of raw materials when utilizing barley to produce beer, and general used dextranase has been only to β-1,4 have effect, and it is not thorough to degrade; (2), the present invention measured β-1,3-1, the amino acid of 4--dextranase and nucleotide sequence are structure high yield β-1,3-1,4-dextranase engineering strain lays the foundation.

Description of drawings

Fig. 1 is β of the present invention-1,3-1, the aminoacid sequence of 4--dextranase;

Fig. 2 is β of the present invention-1,3-1, the nucleotide sequence of 4--dextranase.

Embodiment

Embodiment 1 β of the present invention-1,3-1, the production of 4-dextranase

Second order fermentation is adopted in pilot scale, and seeding tank is 1 cubic metre, and fermentor tank is 20 cubic metres of mechanical stirring standard type fermentor tanks, continuous 5 batches of operations.Is a ring from the inclined-plane to seed bottle inoculum size, is 0.1% from shaking bottle to the seeding tank inoculum size, is 1-2% from seeding tank to secondary jar inoculum size.The fermention medium sterilising temp is 121 ℃, and culture temperature is 37 ℃, and the rotating speed that shakes bottle and fermentor tank is 200-250r/min., may further comprise the steps:

(1) according to following compositions and ratio (g/L) barley meal 30, peptone 10, extractum carnis 10, glucose 5 and NaCl 5 preparation shake-flask seed substratum 1.5L, pH is 7.2. with pack into the triangular flask of 10 1L of shake-flask seed substratum branch, sterilized 20 minutes cooling back inoculation EGW039 bacterial strain 1 ring for 121 ℃ down.37 ℃, 200r/min shakes bottle 12-15h after special-purpose aseptic inoculation bottle is poured in aseptic technique in the lump into, uses for inoculation;

(2) according to following compositions and ratio (g/L) barley meal 40, DAP 5, Sodium phosphate dibasic 25, SODIUM PHOSPHATE, MONOBASIC 2, sal epsom 0.1, trisodium citrate 1 preparation seed tank culture base 220L, the pH nature, with the institute preparation seed tank culture base 1 cubic metre of seeding tank of packing into, 121 ℃ of sterilizations 45 minutes down are cooled to the cultured shake-flask seed liquid 1.5L of the inoculation of back below 37 ℃.37 ℃, 250r/min cultivates 12-16h, tank pressure: 0.6-0.07MMa, air ratio 0-8h: 1: 0.3; 9-12h: 1: 0.4; 12-16h: 1: 0.5 (seed liquor quality detecting index: cell density: 1*10 ⁹-10 ¹⁰Individual/ml; Thalli morphology: stock, quarter butt, link rod, shank diameter are the 1-2.5 micron, all are normal morphology, relative neat and consistent, stalwartness; PH value: about 6.5);

(3) according to following compositions and ratio (g/L) barley meal 45, DAP 5, Sodium phosphate dibasic 25, SODIUM PHOSPHATE, MONOBASIC 2, sal epsom 0.1, trisodium citrate 1,10 cubic metres of defoamer 0.5 preparation fermentation tank culture medium, the pH nature is with 10 cubic metres of 20 cubic metres of seeding tanks of packing into of fermentation tank culture medium of preparation, 121 ℃ of following sterilizations 45 minutes are cooled to then be pressed into the about 250L of cultured seed liquid by seeding tank below 37 ℃; 37 ℃, 200r/min stirs fermentation culture 25-30h, and tank pressure: 0.6-0.07Mma, air ratio 0-8h are 1: 0.45; 9-12h is 1: 0.50; 12-18h is 1: 0.55; 19-30h is 1: 0.50; Reducing sugar content＜0.5% in the fermented liquid that ferments at the end, pH6-6.3;

(4) fermented liquid coagulates wadding and separates: add the agent of wadding a quilt with cotton with fixed attention in step (3) gained fermented liquid, to make precipitations such as thalline, particle type impurity (contain enzyme, thalline, substratum resistates and other impurity and non-desired substance in the fermented liquid effectively, compare thickness), (this experiment selects for use 35 square metres of plastics anti-corrosive type tools to press dry the flame filter press of performance by press filtration then, at first first-class canvas press cloth, evenly squeeze into deployed diatomite (dilute with water) with pump) thalline is separated with enzyme liquid, sophisticated fermented liquid is put to settling tank from fermentor tank, added salt Na ₂HPO ₄(using final concentration is 0.6%) is stirred to dissolving fully, and logical water coolant reduces temperature, adds salt CaCl immediately ₂(use final concentration be 1%) slowly evenly adds by being made into 30% concentration, stops after stirring stirring, and leaves standstill under the room temperature to allow the throw out natural subsidence, and general 3-5h can clarify fully; Filter earlier supernatant liquid, as run into that just filtrate is muddy, filter until filtrate transparently once more, the precipitation part can add about 1% thick diatomite as filtration difficulty, filtration while stirring, and clear filtrate is incorporated into storage tank;

(5) concentrate: cryoconcentration reduces pressure with economic benefits and social benefits low-pressure low-temperature vaporizers (vacuum tightness 〉=700mmHg post height, working efficiency is 500L/h, because the activity of enzyme is confined to 55 ℃) with step (4) gained clear filtrate;

(6) spraying drying: according to the requirement of finished product enzymic activity size and drying process with atomizing; before spraying,, carry out spraying drying with cheap and have the protective enzyme active function and do not have the material after the weighting material of deleterious effect will concentrate to be modulated to the degree that water content is 15-25% at least.The spray tower inlet temperature is 170 ℃, and temperature out is 70 ℃.Spraying drying efficient is 150L/h.

(7) crushing screening: 60 order percent of pass＞90% get β of the present invention-1,3-1,4-dextranase product.

EXPERIMENTAL EXAMPLE 1 the foregoing description 1 β that produces-1,3-1, the 4--dextranase activity is measured

1 unit of enzyme activity is defined as under 40 ℃, per 1 second, every milliliter of enzyme liquid 0.9% barley beta-glucan of degrading discharged 1nmol reducing sugar (glucose). and the reducing sugar in the reaction system (glucose) is measured with the DNS method. and the pH value of reaction system is 7.5, sodium phosphate buffer by 0.1Mol/L provides. substrate preparation: 1.0% barley beta-glucan (Sigma Co.) preparation, accurately take by weighing 1.0000g barley beta-glucan (Sigma product), be dissolved in the 6ml dehydrated alcohol, add 80ml 0.1Mol/L sodium phosphate buffer (pH7.5), put boiling water bath 10min, treat that substrate dissolves postcooling fully to room temperature, and be settled to 100ml with above-mentioned damping fluid.Standby under being stored in 4 ℃.Fehling reagent A, B preparation: according to＜Measurement for Biochemistry〉the method preparation.Be reflected in 40 ℃ the water-bath and carry out, get the substrate 1.0% barley beta-glucan that 0.9ml prepares, add the enzyme liquid of 0.1ml through suitably diluting, reaction 15min, by adding fehling reagent A, each 2ml of B, put boiling water bath color reaction 15min, colour developing liquid is under 3000r/min behind the centrifugal 10min, measure the light absorption value of supernatant liquor under 520nm. and go out glucose yield and enzymic activity size in the reaction system according to the regression equation calculation of setting up by the glucose typical curve, zymin enzyme of the present invention as a result work is 130,000 BU/g.

The experiment of feeding of EXPERIMENTAL EXAMPLE 2 fryer

Carry out in Scientia Agricultura Sinica herding institute in August, 2000-September.Test selects for use 1 age in days AA commodity for 480 of broiler chicken, is divided into 6 groups at random, 80 every group; Each group is established four repetitions (because density is too high, repeating to repartition into 5 repetitions with 4 behind 22 ages in days), and each repeats 20.The I group is corn dregs of beans daily ration control group, the II group is added 0.1% the embodiment of the invention 1 gained β-1 on I group basis, 3-1, the 4-dextranase, the III group is corn-dregs of beans-barley diet control group, the IV group is added 0.1% the embodiment of the invention 1 gained β-1 on the basis of III, 3-1, the 4-dextranase, the V group is added 0.2% the embodiment of the invention 1 gained β-1 on the basis of III, 3-1, the 4-dextranase, the VI group is added 0.25% the embodiment of the invention 1 gained β-1,3-1 on the basis of III, the 4-dextranase, test daily ration composition sees Table 3.

Test is divided into 0-3 week and 4-6 two stages of week, and test chicken is raised in cages, and feeding and management and immunity program are routinely carried out.Test is by duplicate record weightening finish and feed consumption rate, and the record death condition.Observe and write down the quantity of the unclean chicken of anus during 7 ages in days.

Table 3, control group daily ration are formed and nutritive index

Form	Corn-dregs of beans daily ration		Corn-dregs of beans-barley diet
						0-3 week	4-6 week	0-3 week	4-6 week
Corn	59.14	63.52	39.30	32.18
					Dregs of beans	35.50	31.26	34.43	29.99
Barley			20.00	30.00
					Stone flour	1.60	0.93	1.10	0.93
Secondary calcium phosphate	2.13	1.96	2.08	1.90
					Salt	0.30	0.30	0.30	0.30
Vegetables oil		0.72	1.47	3.41
					Methionine(Met)	0.22	0.18	0.22	0.19
Methionin	0.01	0.03		0.01

Preblend	1.00	1.00	1.00	1.00
					Choline chloride 60	0.10	0.10	0.10	0.10
Nutritive index
					Metabolizable energy	2.80	2.90	2.80	2.90
Crude protein	21.00	19.5	21.00	19.5
					Calcium	1.17	0.90	1.00	0.90
Available phosphorus	0.48	0.45	0.48	0.45
					Methionin	1.05	0.97	1.05	0.97
Methionine(Met)	0.50	0.45	0.50	0.45

As can be seen from Table 4, in corn-dregs of beans daily ration, add β-1,3-1, the 4-dextranase can improve broiler growth speed, contrast I group and interpolation β-1,3-1, the weightening finish of 4-dextranase II group 0-21 age in days is respectively 571.03 grams and 602.65 grams, and test group improves 5.54% than the control group weightening finish; The feed efficiency that the 0-21 age in days is two groups is respectively 1.521 and 1.497, and test group reduces by 1.58% than control group.As can be seen from Table 4, the weightening finish of contrast I and test II group 22-42 age in days is respectively 1186.3 grams and 1220.33 grams, the test group comparison improves 2.89% according to weightening finish; 42 age in days mean body weights are respectively 1866.52 grams and 1809.98 for two groups, and the test comparison is tested full phase weightening finish and is respectively 1765.90 grams and 1822.07 grams according to improving 3.13%, and the test group comparison is according to improving 3.18%; Full phase feed efficiency is respectively 2.00 and 1.98, and test group slightly descends than control group.As can be seen from the test results, in corn-dregs of beans daily ration, add the weightening finish that beta-glucanase can improve fryer.Although the content of beta-glucan is lower in corn and the dregs of beans, but it is reported, dregs of beans and corn contain 20% and 4.9% the non-starch polysaccharide of having an appointment in respectively, and these non-starch polysaccharides also can cause the increase of enteron aisle digest viscosity, cause the reduction of feed digestibility and the decline of performance of poultry.

Table 4, test weightening finish in early stage and feed efficiency result

The on average heavy 0-21 age in days weightening finish of average starting weight 21 ages in days of project feed efficiency

I 44.08±0.63 615.10±30.59 571.03±30.05 1.521±0.086

II 44.45±0.78 647.13±17.62 602.65±17.44 1.497±0.041

III 44.30±0.52 640.23±22.55 595.93±22.53 1.494±0.064

IV 43.93±0.68 641.68±20.12 597.75±19.57 1.521±0.056

V 43.30±0.76 661.05±20.37 617.75±20.25 1.5610.056

VI 43.83±1.18 637.50±34.35 593.68±35.02 1.582±0.060

Weightening finish result by table 4 and table 5 finds out, in the 0-21 age in days stage, in corn-dregs of beans-barley diet, add β-1,3-1, the 4-dextranase is best to add 0.2% V group effect, and weightening finish is 617.75 grams, improves 3.67% than 595.93 grams of control group III, the weightening finish of the VI of the IV of interpolation 0.1% and interpolation 0.25% is respectively 597.75 and 593.68 grams, with the control group indifference.In the 22-42 age in days stage, weightening finish is the highest with V group and VI group, is respectively 1324.08 and 1327.38 grams, and comparison improves 5.34% and 5.60% according to III group (1256.97 gram) respectively, and the weightening finish of IV group is 1298.56 grams, improves 3.30% than control group.From full phase weightening finish, in corn-dregs of beans-barley diet group, with V group best results, weightening finish is 1942.83 grams, improves 5.01% than control group (1850.10 gram), is VI and IV secondly, weightening finish is respectively 1921.43 and 1906.55 grams, improves 3.85% and 3.05% than control group respectively.

Table 5, the weightening finish of test later stage and feed efficiency

On average heavy 22-42 age in days weightening finish 22-42 full phase of feed efficiency of the project 42 ages in days full phase feed efficiency that increases weight

I 1809.98±79.54 1186.03±87.20 2.24±0.13 1765.90 2.00

II 1866.52±90.76 1220.33±86.61 2.22±0.12 1822.07 1.98

III 1894.40±40.16 1256.97±45.31 2.20±0.09 1850.10 1.97

IV 1950.48±69.45 1298.56±58.23 2.15±0.15 1906.55 1.88

V 1986.13±56.58 1324.08±56.23 2.20±0.10 1942.83 2.00

VI 1965.26±118.8 1327.38±86.92 2.20±0.09 1921.43 2.01

From the 0-21 age in days, in corn-dregs of beans-barley diet, add the trend that beta-glucanase has the feed efficiency of making to increase, be 1.494 not add the zymin group minimum, add 0.25% zymin group and be up to 1.582.At the 22-42 age in days, add 0.1% β-1,3-1, the feed efficiency of 4-dextranase group is 2.15, descends to some extent than control group, is 2.2 but the feed efficiency of other two test group is consistent with control group.Full phase feed efficiency is also minimum with IV, is 1.88.

Table 6, mortality ratio and the unclean number of 7 age in days anuses

Group I II III IV V VI

Full phase surviving rate 97.5% 95.0% 93.75% 97.5% 87.5% 85.0%

7 age in days anuses unclean several 258628

The result of table 6 shows, corn-dregs of beans daily ration adds β-1,3-1, the 4-dextranase to mortality ratio to influence difference not remarkable.In corn-dregs of beans-barley diet, add 0.1% and can reduce the fryer mortality ratio, but the mortality ratio of adding 0.2% and 0.25% group rises to some extent, and the unclean chicken number of 7 age in days anuses that adds 0.25% group of chicken is than other two test group height, and the unclean chicken number of 7 age in days anuses is minimum to add 0.2% group.

The result shows, the weightening finish 3.18% that the beta-glucanase of interpolation 0.1% can improve fryer in corn-dregs of beans daily ration.Feed at fryer and to contain 20% barley and later stage early stage when containing 30% barley diet, all can obtain best gaining effect, the comparable control group raising 5.01% of increasing weight to add 0.2% beta-glucanase.

The experiment of EXPERIMENTAL EXAMPLE 3 animal toxicities

(1) with the LD50 acute toxicity test of the embodiment of the invention 1 gained enzyme preparation product to mouse, 40 of the mouse of 20 ± 2 gram body weight are divided into 4 groups at random, male and female half and half, it is 2.15 that the filling stomach is tried the agent amount, 4.64,10.0 and 21.5g/kg, mouse is not affected as a result, shows this zymin safety non-toxic.

(2) with the embodiment of the invention 1 gained enzyme preparation product to mouse marrow cell micro nuclear test: 50 of the mouse of 21 ± 1 gram body weight are divided into 5 groups at random, male and female half and half, irritating stomach, to be tried the agent amount be 1.0,2.0,4.0g/kg.Positive controls is fed the 80mg/kg endoxan, and negative control group is fed with amount distilled water, and the result does not detect mutagenicity, shows that this zymin finished product is nontoxic to people and animals' animal safety.

Reference

1.Argos et al.″Thermal Stability and Protein Structure″，Biochemistry，18：5698-5703(1979).

2.Borriss″Purification and characterization of an extracellularbeta-glucanase from Bacillus IMET B376.sup.1)″，Z.Alg.Mikrobiologie 21：7-17(1981).

3.Borriss et al.″.beta.-1，3-1，4-glucanase in sporeformingmicroorganisms.V.The efficiency of.beta.-glucanase in reducingthe viscosity of wort″Zbl.Bakt II Abt.136：324-329(1981).

4.Borriss et al.″Expression in Escherichia coli of acloned.beta.-glucanase gene from Bacil lus Amyloliquefaciens″Appl.Microbiol.Biotechnol.22：63-71(1985).

5.Borriss et al.″Molecular cloning of a gene coding for thermostablebeta-glucanase from Bacillus macerans″J.Basic Microbiol.28：3-10(1988).

6.Cantwell et al.″Molecular cloning and expression of a Bacillussubtilis. beta.-glucanase gene in Escherichia coli″Gene23：211-219(1983).

7.Classen H L，G L Campbell，J W D Grootwassink. 1988. Improved feedingvalue of saskatchewen-grown barley for broiler chickens withdietary enzyme supplement. Can. J Anmi. Sic.，65：725-733

8. Godfrey ″On comparison of key characteristics of industrial enzymesby type and source，″Industrial Enzymology，5：466-569 (1983).

9. Hofemeister″The. beta.-glucanase gene from Bacillusamyloliquefaciens shows extensive homology with that of Bacillussubtilis″Gene 49：177-187(1986).

10.Honda et al.″Cloning and expression in Escherichia coli of aThermoanaerobacter cellulolyticus gene coding for heat-stable. beta.-glucanase″Appl Microbiol. Biotechnol. 25：480-483(1987).

11.Hortonet al.″Engineeringhybridgeneswith the use of restrictionenzymes：Gene splicing by overlap extension″Gene 77：61-68(1989).

12.Imanaka et al.″A new way of enhancing the thermostability ofproteases″Nature，324：695-697(1986).

13.Klyosov et al.″A thermostable endo-1，4-.beta.-glucanase fromMyceliophtora thermophilia″ Chemical Abstracts 109：50624w(1988).

14.Loi et al.″Survival of barley (1-3，1-4).beta.-D-glucanaseisoenzymes during kilning and mashing″J.Cereal Sci.5：45-50(1987).

15.Matthews et al.″Enhanced protein thermostability from site-directed mutations that decrease the entropy of unfolding″Proc.Natl. Acad. Sci. 84：6663-6667(1987).

16. McFadden et al.″Expression sites and developmental regulation ofgenes encoding(1-3，1-4)-.beta.-D-glucanases in germinatedbarley″Planta 173：500-508(1988).

17. McNabJM. 1992. Barleyβ-glucanase：an antinutritional factorin poultry feeding. Nutrition Research Rewiews，5：45-50

18. Miller″Use of dinitrosalicylic acid reagent for determination ofreducing sugars″Analytical Chemistry 31：426-428 (1959).

19.Murphy″The DNA sequence of the gene and genetic control sites forthe excreted B. subtilis enzyme.beta.-glucanase″Nucleic AcidsRes. 12：5355-5367(1984).

20.Petre et al. ″Purification and properties of an endo-.beta.-1，4-glucanase from Clostridium thermocellum″，(abst.)7-Enzymes95：145879q(1981)，Biochemie 63：629-639(1981).

21.Politz，O.，et al.，(1993)Eur. J. Biochem 216，829-834.22. Querol ″Tentative rules for increasing the thermostability ofenzymes by protein engineering″Enzyme Microb. Technol. 9：238-244(1987).

23.Schwarz et al. ″Isolation of a Clostridium thermocellum geneencoding a thermostable. beta.-1，3-glucanase(laminarinase)″Chemical Abstracts 108：217067k(1988)，Biotechnology Letters10(4)：225-230 (1988).

24.Tikhomirov et al.″Endo-1，4-.beta.-glucanases of the anaerobicbacterium Clostridium thermocellum st.No.3 with high heatstability″Chemical Abstracts 110：168879g(1989).

Claims (3)

1, a kind of β-1,3-1,4-glucanase gene, the aminoacid sequence that it is characterized in that this gene are the described sequences of Figure of description 1.

2, according to the described gene of claim 1, the nucleotide sequence that it is characterized in that this gene is the described sequence of Figure of description 2.

3, the Bacillus licheniformis that contains the described gene of claim 1 is characterized in that the bacterial strain preserving number is CGMCC NO.0635 (the Latin formal name used at school is Bacillus licheniformis).