CN1401662A - Anticoagulation and thrombolytic thrombus target fusion mA5UKB - Google Patents

Abstract

A thrombus target fusion mA5UKB with both anticoagulating and thrombolytic functions is prepared from the mutant mAnxA5 of AnnexinA5 having anti-coagulating function and the urokinase B chain (UKB) having thrombolytic function through fusing. It can be used to prepare the thrombolytic medicine.

Description

The thrombus target fusion mA5UKB of anticoagulant and thrombolytic dual-use function holds concurrently

Technical field:

The present invention relates to the medical bioengineering technical field, is a kind of mutant mAnxA5 of annexin A5 (AnnexinA5) and the fusion rotein mA5UKB of urokinase B chain (UKB), and this fusion rotein has the thrombolytic effect of targeting thrombus, with anticoagulation.

Background technology:

Thrombosis is the cardiovascular disorder that a class seriously jeopardizes human health and life as Acute Myocardial Infarction (AMI), venous thromboembolism etc.In western countries, the death that causes because of thrombus has accounted for crude death rate's first place.In China, along with Economic development and the aging of population trend, the thrombosis patient is increasing, and is also increasing to the demand of antithrombotic reagent.Thrombolytic drug commonly used clinically at present is mainly plasminogen activator, as streptokinase (SK), urokinase (UK), single chain urokinase type plasminogen activator (scu-PA), tissue-type plasminogen activator (t-PA) etc., though these medicines all have stronger thrombolysis effect, but all there are the following problems: (1) is hemorrhage: because these medicines Profibrinolysin in the activation fiber albumen grumeleuse not only, also activate simultaneously the Profibrinolysin in the blood plasma, make that plasmin activity increases in the blood plasma, the blood plasma plasmin can hydrolysis proconvertin etc., cause thrombin to reduce and cause bleeding.(2) transformation period is short in the body, so the treatment consumption is big.(3) re-infarction: activated blood platelet simultaneously after the plasmin system is activated, make the Fibrinogen and the Von Willebrand factor be gathered in thrombocyte GpIIb/IIIa acceptor, thereby impel thrombosis, behind thrombolysis, form thrombus in the short period of time easily once more, make the treatment failure.Therefore, how can make the effectiveness of Profibrinolysin in the activation thrombus of thrombolytic drug target, development of new stronger, the thrombolysis specificity better, and effectively to prevent the thrombolysis preparation of embolism be the focus of present antithrombotic reagent research again.

Summary of the invention:

As everyone knows, the blood coagulation process is a cascade reaction: at first be platelet activation, make the membrane phospholipid of plasma membrane inboard such as phosphatidylserine (PS) be exposed to the thrombocyte outside; Next plasma thromboplastin component, X etc. constantly are activated on the surface of membrane phospholipid; Thrombogen is activated be zymoplasm.Therefore, hematoblastic membrane phospholipid has crucial effects in coagulation process, is a kind of effective function target spot of thrombolysis and anticoagulant.Based on this fact, the present invention has designed a kind of fusion rotein with target thrombolysis and anticoagulation.This fusion rotein is formed by two kinds of albumen fusions, and one is the mutant mAnxA5 of AnnexinA5, and another is the B chain UKB of urokinase.

One, AnnexinA5 mutant mAnxA5

AnnexinA5 is the abundantest a kind of calcium binding protein of content in the annexin family (Annexin family), under the situation that calcium ion exists, can high-affinity ground be exposed after with platelet activation the membrane phospholipid combination.Studies confirm that, the surface of each activated blood platelet has the binding site of 200,000 AnnexinA5 approximately, approximately is 10 times of (Shattil SJ.et al., 1985 of antiplatelet glycoprotein iib/iiia monoclonal antibody binding site, J Biol Chem, 260:11107).Experimentation on animals also shows, mainly be gathered in after the isotope-labeled AnnexinA5 intravenous injection aortic blood spigot position (TaitJF, et al.1994, Thromb Res., 75:491).Therefore, AnnexinA5 can be used as the target thrombolytic drug of a kind of " biological missile " development arterial thrombus.But have a problem can not be ignored: the molecular weight of AnnexinA5 is 34kDa, so and thrombolytic drug merges back molecular weight often too big (being generally about 90kDa), not only bad for Expression of Fusion Protein, also caused the shortening of its transformation period like this, thereby thrombolysis efficient reduces.At this situation, the present invention has the characteristics of four homeodomains AnnexinA5 has been carried out genetic modification according to AnnexinA5, obtained a sequence deletion mutant mAnxA5 who only comprises first, second structural domain, its molecular weight only is original half, but has kept thrombus target function and the anticoagulation function of AnnexinA5.

Except the sequence deletion sudden change, mAnxA5 also contains a point mutation, also Xie Ansuan-Gly-Asp (V-G-D) sequence that is about in second structural domain is transformed into arginine-glycine-aspartic acid (R-G-D) sequence, to strengthen the blood coagulation resisting function of mAnxA5.Its theoretical foundation is: in coagulation process, thrombocyte combines with " arginine-glycine-aspartic acid (R-G-D) " sequence in scleroproein and the Von Willebrand factor adhesion molecules such as (vWF) by its film integrin receptor GP IIb/IIIa, can mediate hematoblastic adhesion and gathering.Experimental results show that the natural and artificial small peptide that contains the R-G-D sequence can significantly suppress hematoblastic aggreation, have anticoagulant function (Collen D et al., Thromb Haemost, 1994,71:95).Therefore, mAnxA5 not only has targeting thrombus, and very strong anticoagulant active, and molecular weight in addition only is AnnexinA5 half, so be very suitable for the carrier as thrombolytic drug.

Two, urokinase B chain (UKB)

Scu-PA is a kind of thrombolytic drug commonly used clinically at present, has stronger thrombolysis activity and certain fibrin-specific.Urokinase B chain (UKB) is the derivative of Scu-PA (Scu-PA), is made up of the 159th～411 amino acids residue of Scu-PA.Kenji etc. (Kenji et al., Biochemistry, 1996,35:924) studies show that UKB has the thrombolysis activity similar with Scu-PA.Because its molecular weight is 30kDa only, thereby be to make up mosaic thrombolytics molecule commonly used at present.

The present invention utilizes targeting thrombus and the anticoagulating active of mAnxA5, utilizes the thrombolysis function of urokinase B chain (UKB), is prepared into a kind of thrombus target fusion mA5UKB that has anti-freezing, thrombolysis dual-use function concurrently.Because this albumen also has the characteristic of thrombus target, so thrombolysis efficient is better than general thrombolytics.

Fusion rotein mA5UKB of the present invention prepares by engineered method, and concrete preparation process is:

One, gene fusion construct mA5UKB

1, the structure of gene mutation body mAnxA5

The mAnxA5 gene is based on AnnexinA5 gene (GenBank No.M18366), obtains by methods such as rite-directed mutagenesis and PCR.Whole building process is in two steps:

The first step: carrying out point mutation, is " R-G-D " sequence with " V-G-D " series jump in AnnexinA5 gene second structural domain

Xie Ansuan (V) is sported arginine (R) adopts overlap gene amplification method, need synthetic four primers altogether, be respectively:

Wherein:

P1 is consistent with 5 ' end of AnnexinA5 gene, and introduces Nco I restriction enzyme site CCATGG.

P2 contains the complementary nucleotide sequence ACG of arginine codon.

With the plasmid pUC119-AnxA5 that contains the AnnexinA5 gene is template, P1, and P2 is a primer amplification, the sequence that obtains is called P1P2.

P3 contains arginine codon sequence C GT.

P4 is with 3 ' the terminal complementation of AnnexinA5.With the plasmid pUC119-AnxA5 that contains the AnnexinA5 gene is template, P3, and P4 is a primer amplification, the sequence that obtains is called P3P4.

Primer P2, P3 have one section complementary sequence (hypographous part in the primer), so also there is this complementary sequence in the sequence of P1P2 and P3P4.With P1P2 and P3P4 sex change after annealing, can form double-stranded in the complementary district of this section.PCR is provided reaction conditions, and P1P2 and P3P4 primer each other increase, and the product after the amplification is P1P4.By this method, be " R-G-D " sequence with " V-G-D " series jump in AnnexinA5 second structural domain.

Second step: first and second structural domain in the pcr amplification P1P4 sequence obtains mutant gene mAnxA5

With P1P4 is template, and with P1, P5 is that primer carries out pcr amplification, and the product that obtains is mutant gene mAnxA5 gene of the present invention, and its nucleotide sequence and amino acid sequence corresponding see Table 1 and table 2 respectively.

P1：5’GC? CCATGGATGGCACAGGTTCTCAG?3’

P5：5’ACCGCCACCGGATCCGCCACTACCCTGAAGGAGA?3’

The used P1 of P1 and the first step is identical, the nucleotide sequence complementation of P5 and coding AnnexinA5 154-157 amino acids residue.

2, the acquisition of urokinase B chain (UKB) gene

The nucleotide sequence of coding 159-411 aminoacid sequence among the synthetic human urokinase protogene (GenBank No.M15476), this gene order promptly is called the UKB gene, and its nucleotide sequence and amino acid sequence corresponding see Table 3 and table 4 respectively.

3, the structure of fusion gene mA5UKB gene

The gene order of pcr amplification UKB, used primer is:

P6：5’GGATCCGGTGGCGGTCCATCACCGCCTAGGCC?3’

P7：5’GC GTCGACTTAGAGGGCCAGGCCATTCTC?3’

The sequence of pcr amplification mAnxA5, used primer is:

P1：5’GC CCATGGATGGCACAGGTTCTCAG?3’

P5：5’ACCGCCACCGGATCCGCCACTACCCTGAAGGAG?3’

Because primer P6 and P5 have one section sequence complementation,, can form the complementary two strands so utilize mAnxA5 that aforesaid method obtains and UKB at the sex change after annealing.PCR is provided condition, can obtains the fusion gene mA5UKB of mAnxA5 and UKB, and introduce NcoI and SalI restriction enzyme site respectively at its two ends.Can the correct space structure of each self-sustaining for making two genes connect the coded fusion roteins in back, the present invention based on the G-S-G-G-S-G-S of glycine and Serine as connection peptides (oblique line part), the fusion gene called after mA5UKB gene that finally obtains, its nucleotide sequence and amino acid sequence corresponding see Table 5 and table 6 respectively.

Two, make up prokaryotic expression plasmid pET28a-mA5UKB and engineering bacteria BL21 (mA5UKB)

Fusion gene mA5UKB is utilized NcoI and Sal I double digestion, insert the prokaryotic expression plasmid pET28a through corresponding double digestion, resulting recombinant plasmid is pET28a-mA5UKB.With plasmid pET28a-mA5UKB transformed competence colibacillus bacterium BL21 (DE3), by blocking that resistance screening positive recombinant.The e. coli bl21 (DE3) that contains plasmid pET28a-mA5UKB is engineering bacteria BL21 (mA5UKB).

Three, the preparation of fusion rotein mA5UKB

1, cultivate thalline, induce expressing fusion protein:

The a small amount of engineering bacteria BL21 of picking (mA5UKB) 37 ℃ of shaking culture in LB substratum (containing that 100 μ g/ml of card) are spent the night, and transfer in LB substratum (containing that 100 μ g/ml of card) according to 1% inoculum size then, and 37 ℃ of shaking culture 3 hours are to A ₆₀₀=0.5-0.6, adding IPTG is 0.5mmol/L to final concentration, 30 ℃ of inducing culture 8 hours.

2, preparation inclusion body:

Centrifugal collection thalline adds 3ml lysis buffer (50mmol/L Tris-HCl, pH8.0 according to the wet bacterium of every gram, 1mmol/L EDTA, 100mmol/L NaCl, add proteinase inhibitor PMSF to final concentration be 1mmol/L) ratio add lysis buffer, precipitation suspends.Ice-bath ultrasonic is with broken thalline, centrifugal collecting precipitation.

The adding washings (0.5%Triton X-100,10mmol/L EDTA, 50mmol/L Tris-HCl, pH8.0) the suspended centrifugal washing is 3 times, can get the inclusion body of preliminary purification.

3, dissolving inclusion body:

Inclusion body is dissolved in (8M urea, 0.5M NH in the sex change liquid ₄Cl, 50mmol/L Tris-HCl, pH8.5,100mmol/L beta-mercaptoethanol), room temperature insulation 4 hours, then 12, centrifugal 10 minutes of 000g gets supernatant liquor, obtains crude protein solution.

4, molecular sieve purification:

By Sephacryl S-200 molecular sieve, balance and elutriant are (5M urea, 0.5M NH to the supernatant liquor of above-mentioned acquisition under denatured state ₄Cl, 50mmol/L Tris-HCl, pH8.0,0.5mmol/L EDTA, 10mmol/L beta-mercaptoethanol), collect the elution peak sample liquid, obtain the albumen of preliminary purification.Adding beta-mercaptoethanol to final concentration is 100mmol/L.

5, dilution refolding:

Above-mentioned sample liquid is to 5M urea, 0.5M NH ₄Cl, 50mmol/L Tris-HCl, pH8.0,0.5mmol/LEDTA, 10mmol/L beta-mercaptoethanol dialysed overnight.

Splash into renaturation solution (2.5M urea, the 0.5M NH of 100 times of volumes ₄Cl, 10mmol/L Tris-HCl, pH8.0) in, 4 ℃ left standstill 24 hours.

6, ion-exchange is further purified

Sample liquid after the renaturation is carried out ion exchange chromatography with weak anionic exchange column DEAE-Sephoarose.Collection contains the elution peak of fusion rotein mA5UKB, utilizes the hollow fiber ultrafiltration cellulosic ultrafiltration to concentrate, and concentrated solution is added 80% ammoniumsulphate soln precipitate, place-20 ℃ frozen.

Four, the biological activity determination of fusion rotein mA5UKB

Fusion rotein mA5UKB provided by the present invention mainly has three kinds of biological activitys: the one, with the similar thrombolysis activity of uPA, this activity can utilize fibrin plate method to confirm, utilize technology purifying protein provided by the present invention, can reach 40,000 IU/mg albumen than work.The 2nd, anticoagulant active.Anti-freezing experiment shows that fusion rotein mA5UKB and AnnexinA5 are similar, can significant prolongation white bole activated partial prothrombin time (KPTT), illustrate that this albumen has stronger anticoagulant active.The 3rd, activated blood platelet is had higher avidity.The film binding specificity studies show that, therefore the downtrending basically identical of mA5UKB and AnnexinA5 illustrates that mA5UKB is suitable to the avidity and the AnnexinA5 of activated blood platelet.

Above experiment confirm, mAnxA5 with uPA B chain amalgamation and expression after, expression product can keep biologic activity separately, thereby obtains a kind of novel thrombolytic albumen that has anti-freezing and thrombolysis dual-use function and have thrombus target.According to same thinking, the carrier of mAnxA5 as a kind of thrombus target can be made up the target thrombolytic medicine with some other thrombolytics such as tissue-type plasminogen activator (t-PA), streptokinase etc.

In sum, compare with existing thrombolytic drug, the present invention has following advantage: 1, mAnxA5 has higher avidity to the activatory thrombocyte, thus can targeting in the thrombus position, improved thrombolysis efficient, reduced consumption; 2, reduced activation, reduced the systemic hemorrhage untoward reaction that waits Profibrinolysin in the blood; 3, the thrombolytics of utilization of the present invention is a urokinase B chain, has lacked the site of zymoplasm sensitivity, thereby can prolong the transformation period of fusion rotein mA5UKB; 4, mAnxA5 itself has very strong anticoagulant active, has reduced after the thrombolysis probability of embolism more greatly.Therefore, mA5UKB of the present invention can be used for preparing the thrombolytic drug of targeting thrombus.

The present invention adopts the highest T7 phage prokaryotic expression system of present expression efficiency, thereby expression amount is higher than the expression amount of urokinase in other expression systems far away, helps large-scale production.

Description of drawings:

The structural representation collection of illustrative plates of Fig. 1 recombinant plasmid pET28a-mA5UKB

The anticoagulating active column diagram of Fig. 2 mA5UKB

Fig. 3 mA5UKB is to the graphic representation of activated blood platelet avidity

1：mA5UKB；2：AnnexinA5

Fig. 4 mA5UKB thrombolysis measurement result synoptic diagram

1: positive control (urokinase 20IU); 2: negative control (1 * PBS)

3:0.3 μ g albumen mA5UKB; 4:0.4 μ g mA5UKB

Embodiment:

Reagent and material:

The used plasmid pUC119 of the present invention is available from invitrogen company; Prokaryotic expression plasmid pET28a and host bacterium BL21 (DE3) are available from Novagen company; Restriction enzyme, T4 dna ligase, pfu archaeal dna polymerase are all available from TaKaRa company, and dNTP is available from Shanghai lottery industry bio-engineering corporation.Synthetic and the nucleotide sequence order-checking of primer is finished by last sea base Kanggong department.The chromatography column that purifying is used and filler Sephacryl S-400, DEAE are available from Pharmacia company.The antiurokinase monoclonal antibody is available from Huamei Bio-Engrg Co..

Embodiment 1 makes up the mAnxA5 mutant gene

The gene order of people AnnexinA5 utilizes the RT-PCR method to obtain from human placenta, for operations such as convenience further increase, enzyme is cut, this gene is inserted plasmid pUC119, obtains recombinant plasmid pUC119-AnxA5.(referring to " molecular cloning " related Sections, Science Press, 1992 publish).

1, " V-G-D " series jump with 142-144 position in the AnnexinA5 gene is " R-G-D " sequence

In the PCR reaction system of 100 μ l, add primer P1, each 2 μ l (15pmol/ μ l) of P2, pUC119-AnxA5 template DNA 1 μ l (50ng/ μ l), 15mM MgCl ₂10 μ l, 3 units of high-fidelity pfu archaeal dna polymerase, 10mMdNTP is 5 μ l, 10 * PCR damping fluid, 10 μ l mend distilled water to 100 μ l.The PCR condition is: 94 ℃ of sex change of first circulation 4 minutes, and second circulation is: 94 ℃ of sex change 45 seconds; Annealed 45 seconds for 55 ℃; 72 ℃ were extended 1 minute.Carry out 30 circulations altogether, last circulation was extended 10 minutes for 72 ℃, and the reaction after product carries out 1% agarose gel electrophoresis, and glue reclaims PCR product, called after P1P2.

In the PCR reaction system of 100 μ l, add primer P3, each 2 μ l (15pmol/ μ l) of P4, pUC119-AnxA5 template DNA 1 μ l (50ng/ μ l), 15mM MgCl ₂10 μ l, 3 units of high-fidelity pfu archaeal dna polymerase, 10mMdNTP is 5 μ l, 10 * PCR damping fluid, 10 μ l mend distilled water to 100 μ l.The PCR condition is: 94 ℃ of sex change of first circulation 4 minutes, and second circulation is: 94 ℃ of sex change 45 seconds; Annealed 45 seconds for 55 ℃; 72 ℃ were extended 1 minute.Carry out 30 circulations altogether, last circulation was extended 10 minutes for 72 ℃, and the reaction after product carries out 1% agarose gel electrophoresis, and glue reclaims PCR product, called after P3P4.

Because primer P2 and P3 have one section nucleotide sequence of complementary, thereby can make the strand of P1P2 and the strand of P3P4 form local double-stranded in the complementation district after the annealing.In 100 μ l reaction systems, respectively get P1P2, the P3P4 product that 5 μ l (500ng) reclaim and mix, 94 ℃ of sex change 5 minutes, 50 ℃ of annealing 1 minute.Add primer P1 then, each 2 μ l (15pmol/ μ l) of P4,15mM MgCl ₂10 μ l, 4 units of high-fidelity pfu archaeal dna polymerase, 10mM dNTP is 5 μ l, 10 * PCR damping fluid, 10 μ l mend distilled water to 100 μ l.The PCR condition is: 94 ℃ of sex change of first circulation 4 minutes, and second circulation is 94 ℃ of sex change 45 seconds; Annealed 45 seconds for 55 ℃; 72 ℃ were extended 2 minutes.Carry out 30 circulations altogether, last circulation was extended 10 minutes for 72 ℃, and the reaction after product carries out 1% agarose gel electrophoresis, and glue reclaims PCR product, called after P1P4." V-G-D " stream cipher sports " R-G-D " sequence in PCR product A nnexinA5 second structural domain that order-checking confirms to obtain, and this gene fragment becomes P1P4.

2, pcr amplification obtains gene mutation body mAnxA5

In the PCR reaction system of 100 μ l, primer P1, each 2 μ l (15pmol/ μ l) of P5, P1P4 template DNA 1 μ l (50ng/ μ l), 15mM MgCl ₂10 μ l, 3 units of high-fidelity pfu archaeal dna polymerase, 10mM dNTP is 5 μ l, 10 * PCR damping fluid, 10 μ l mend distilled water to 100 μ l.The PCR condition is: 94 ℃ of sex change of first circulation 4 minutes, and second circulation is 94 ℃ of sex change 45 seconds; Annealed 45 seconds for 55 ℃; 72 ℃ were extended 1 minute.Carry out 30 circulations altogether, last circulation was extended 10 minutes for 72 ℃, and the reaction after product carries out 1% agarose gel electrophoresis, and glue reclaims the PCR product, confirmed that through order-checking the product that obtains is the mAnxA5 gene mutation body.

Embodiment 2 gene fusion construct mA5UKB

1, pcr amplification urokinase B chain gene

The urokinase B chain gene of synthetic inserts plasmid pUC119 and obtains recombinant plasmid pUC119-UKB.In the 100 μ lPCR reaction systems, add the P6 of 15pmol/ μ l, each 2 μ l of P7 primer, template plasmid DNApUC119-UKB 1 μ l (50ng), 10mM dNTP 5 μ l, 10 * PCR damping fluid, 10 μ l, 15mM MgCl ₂10 μ l.The PCR condition is: 94 ℃ of sex change of first circulation 4 minutes, and second circulation is: 94 ℃ of sex change 45 seconds; Annealed 45 seconds for 55 ℃; 72 ℃ were extended 1 minute.Carry out 30 circulations altogether, last circulation was extended 10 minutes for 72 ℃, and the reaction after product carries out 1% agarose gel electrophoresis, and glue reclaims the PCR product, and the PCR product that obtains turns out to be urokinase B chain gene (UKB gene) through order-checking.

2, gene fusion construct mA5UKB gene

Because primer P5 and P6 have the complementary partial sequence, so the strand of annealing back mAnxA5 gene can be annealed with the strand of urokinase B chain gene, template is extended to both sides each other then, finally obtains the fusion gene mA5UKB gene of mAnxA5 gene and urokinase B chain gene.The gene mutation body mAnxA5 gene of pcr amplification and each 10 μ l (500ng) of UKB gene are mixed 94 ℃ of sex change 5 minutes, 50 ℃ of annealing 1 minute.In the 100 μ l PCR reaction systems, add the P1 of 10pmol/ μ l, each 2 μ l of P7 primer, 10mM dNTP 5 μ l, 10 * PCR damping fluid, 10 μ l, 15mM MgCl ₂10 μ l.The PCR condition is: 94 ℃ of sex change of first circulation 4 minutes, and second circulation is: 94 ℃ of sex change 45 seconds; Annealed 45 seconds for 55 ℃; 72 ℃ were extended 2 minutes.Carry out 30 circulations altogether, last circulation was extended 10 minutes for 72 ℃, the reaction after product carries out 1% agarose gel electrophoresis, glue reclaims the PCR product, confirm that through order-checking the PCR product that obtains is the fusion gene mA5UKB of urokinase B chain gene UKB and mAnxA5, and introduced the restriction enzyme site of Nco I and Sal I at 5 ' and 3 ' end respectively.

Embodiment 3 makes up prokaryotic expression plasmid pET28a-mA5UKB and engineering bacteria BL21 (mA5UKB)

The present invention adopts IPTG induction type coli expression carrier pET-28a.This plasmid total length 5396bp (base pair) contains phage t7 promotor, Luc repressor gene LucI, plasmid replication starting point (ori) and card that resistant gene (kanr).With fusion gene mA5UKB Nco I, Sal I double digestion that embodiment 2 obtains, glue reclaims endonuclease bamhi.Mix (molecule number 5: 1) with same carrier pET28a with Nco I, Sal I double digestion, in the 20ul linked system, add the T4 ligase enzyme, 14 ℃ of connections are spent the night, and get recombinant plasmid pET28a-mA5UKB (Fig. 1).

The preparation competent cell BL21 (DE3): the single bacterium colony of picking e. coli bl21 (DE3), in 3ml LB substratum (contain 1% Tryptones, 0.5% yeast extract and 1% sodium-chlor, pH7.0) in 37 ℃ of shaking culture spend the night.Be inoculated in 50ml LB substratum according to 3% inoculum size then, 37 ℃ are continued shaking culture, to OD ₆₀₀=0.4.Centrifugal 10 minutes of 4 ℃ of rotating speeds with 4000rpm; After removing supernatant, thalline is resuspended with the calcium chloride solution of the 100mM of 1～2ml ice precooling, promptly gets the competent cell of e. coli bl21 (DE3).

Transform: with above-mentioned connection mixed solution 20ul and 200ul competent cell mixing, ice bath 30 minutes.42 ℃ of heat-shockeds 90 seconds, and then in ice bath 10 minutes.Get 0.2ml conversion mixed solution and coat on the LB agar plate that contains kantlex 100ug/ml, cultivated 12-15 hour for 37 ℃, picking list bacterium colony spends the night in 37 ℃ of shaking culture of LB substratum of that resistance of 3ml card.The extracting plasmid can cut out the band of a 1260bp with Nco I, Sal I double digestion.This transformant is the engineering bacteria BL21 (mA5UKB) that contains recombinant plasmid pET28a-mA5UKB.

The abduction delivering of embodiment 4 fusion rotein mA5UKB

Single bacterium colony of picking e. coli bl21 (mA5UKB) contains in the LB substratum of kantlex 100 μ g/ml 37 ℃ of shaking culture in 3ml and spends the night.Inoculum size according to 1% is inoculated in 500ml LB substratum (containing that 100 μ g/ml of card), continues shaking culture 2-3 hour.To OD ₆₀₀, add inductor IPTG at=0.6 o'clock to final concentration 1mM.Continue to cultivate 5-6 hour.The BL21 (DE3) that contains plasmid pET28a cultivates, induces with similarity condition, and thalline is after supersound process, and cleer and peaceful precipitation is done SDS-PAGE and Western Blot analysis thereof on the sample thief.The result shows, engineering bacteria induces the back at the 56kDa place one obvious expression band to be arranged, and mainly be present in the ultrasound precipitation, and the contrast thalline that contains the pET28a plasmid do not have this band.Illustrate that expressing protein is fusion rotein mA5UKB, expression amount accounts for about 25% of bacterial protein, main formal representation with inclusion body.

The separation and purification of embodiment 5 fusion rotein mA5UKB

1, carrying out ultrasonic bacteria breaking

Centrifugal 10 minutes of bacterium liquid 7700g behind the inducing culture collects thalline.

Add the ratio of 3ml damping fluid according to every gram weight in wet base thalline, with buffered soln (50mM Tris-HCl, 1mM EDTA, 100mM NaCl, pH8.0) suspended bacteria precipitation.Add N,O-Diacetylmuramidase again to final concentration 1mg/ml, 0 ℃ of ice bath 15 minutes; Carrying out ultrasonic bacteria breaking, ultrasonic power 100W, 30 seconds/time, microscopy bacterial cell disruption situation.After the basic fragmentation of thalline, stop ultrasonic.

2, inclusion body preparation

Ultrasonic liquid centrifugal 15 minutes through 10000g, supernatant discarded.Inclusion body precipitation with the washings of 9 times of volumes (50mM Tris-HCl, 10mM EDTA, 100mM NaCl, 0.5%Triton X-100, pH8.0) centrifuge washing twice, abandons supernatant.

According to the ratio of every gram weight in wet base inclusion body 9ml damping fluid, with 12ml lysate (8M urea, 0.5MNH ₄Cl, 500mM Tris-HCl, pH8.5) suspension precipitation, room temperature vibration 4 hours.7700g is centrifugal then removes insoluble part.Utilize this method can prepare the crude protein of content about 70%.

3, fusion rotein mA5UKB is through molecular sieve purification

Crude protein under denatured state further through Sephacryl S-400 gel chromatography column purification.Balance and elutriant are 5M urea, 0.5 NH ₄Cl, 50mM Tris-HCl, pH8.0,0.5mM EDTA, 10mM DTT.Analyze according to SDS-PAGE, collect the protein sample liquid of peak value ,-20 ℃ of preservations.

4, albumen dilution refolding

Above-mentioned sample dialysis 12 hours, dialyzate is the 5M urea of 10 times of volumes, 0.5 NH ₄Cl, 50mMTris-HCl, pH8.5.UPA contains 12 pairs of disulfide linkage, therefore should note removing oxygen in the dialyzate in dialysis procedure.With the ultrasonic degasification of dialyzate 10 minutes, feed N then earlier ₂5 minutes, at last with of the Erlenmeyer flask sealing of parafilm film with dialysis.

Dialyzed sample dropwise adds the damping fluid of 100 times of volumes, contains 2M urea, 0.5 NH ₄Cl, 50mMTris-HCl, 0.5mM EDTA, 1.25mM reduced glutathion, 0.5mM Sleep-promoting factor B, pH8.5.4 ℃ were stirred 24 hours gently, and then added the 0.5mM Sleep-promoting factor B, continued to stir 24 hours.At last, sample is at the buffered soln 10mM of 12 times of volumes Tris-HCl, and dialysis is 12 hours among the pH8.0.Dialyzed sample utilizes ultra-filtration membrane to concentrate.

5, ion-exchange is further purified

Above-mentioned sample uses diethylin ethyl agarose (DEAE Sepharose) weak anionic exchange column to carry out ion exchange chromatography again.Chromatography column 50mM TrisHCl, the pH8.0 balance.The wash-out salt concn is carried out the isoconcentration gradient elution from 0～1mol/L NaCl, and flow velocity is 1ml/ minute.Utilize polyacrylamide gel electrophoresis (SDS-PAGE) to determine the peak value of recombinant protein wash-out, find that recombinant protein is eluted when salt concn is 0.4mol/L.Collect the peak value elutriant, through the 10%SDS-PAGE electrophoretic separation, examine the single protein band that the dyeing of Ma Shi light blue is shown as 51kDa, this proteic purity of gel scanning discovery reaches 95%.

The biological activity of embodiment 6 fusion rotein mA5UKB is identified

The fusion rotein mA5UKB of escherichia coli expression has three kinds of significant biological activitys:

(1) thrombolysis activity.Standard method (the Chinese biological goods rules 2000 editions that adopt fibrinolytic to measure, the Chinese biological standard of articles council compiles, Chemical Industry Press, 423 pages): the 125mg agarose, add the 23ml physiological sodium chloride solution, boil dissolving, 60 ℃ of water-bath balances add zymoplasm 14ul (100IU/ml), Profibrinolysin 280ul (0.5mg/ml), want the limit edged to shake up, add 2.2ml human fibrinogen (6mg/ml) then, do not stop (should within two days, use).Standard substance are diluted to following 5 extent of dilution (IU/ml) with normal saline solution: 1000,250,62.5,15.6,3.9 samples to be checked are diluted to the concentration of about 100IU/ml or 1ug/ml according to labelled amount, and are stand-by.

Punching (diameter 2mm) in the scleroproein plate that forms, every hole point sample 10ul, two holes of each sample to be checked and standard substance each point, 37 ℃ of wet boxes (in lunch box, adding less water) horizontal positioned 24 hours to keep certain humidity.

Measure the solusphere diameter in length and breadth for twice, with each dilution active logarithm (X) is X-coordinate, logarithm with the mean number of solusphere diameter (4 times measure value) is ordinate zou (Y), by the biometrical method analytical results, and try to achieve a and b and linear regression coeffficient r value among the y=a+bx, can try to achieve the activity of sample to be checked according to the solusphere diameter of sample to be checked.The fusion rotein mA5UKB of experiment confirm escherichia coli expression has with the similar thrombolysis activity of urokinase, is about 40,000 IU/mg (Fig. 2) than living.

(2) anticoagulating active.Part activated thrombokinase test (KPTT) method is adopted in anti-freezing test, gets the activated partial thromboplastin reagent of 100ul, adds the testing sample of 100ul, 37 ℃ of incubations 3 minutes; The reference blood plasma that adds 100ul, 37 ℃ of incubations 3 minutes; Add 100ul CaCl ₂Solution, assaying reaction thing setting time.Test shows, fusion rotein mA5UKB can the significant prolongation KPTT time, and anticoagulant active is better than AnnexinA5 (Fig. 3).

(3) mA5UKB energy specificity is in conjunction with the activatory thrombocyte, so the aorta thrombus based on activated blood platelet is had targeting thrombus.The specific analysis of film adopts thrombocyte to carry out in conjunction with test, and method is as follows: preparation separates ¹²⁵The albumen of I mark ¹²⁵I-AnnexinA5, according to document (Patrick J etc., Thrombin stimulates theintracellular relocation of annexin V in human platelets, Biochimica etBiophysica Acta, method 1222:135) prepares the thrombocyte 5 * 10 of activated by thrombin ⁷/ ml is in following reaction system: 10mmol/L Na-HEPES (pH7.4), 150mmol/L NaCl, 2.5mmol/L CaCl ₂, 2.7mmol/LKCl, 2mmol/L MgCl ₂, 1mmol/L NaH ₂PO ₄5mmol/L glucose, the AnnexinA5 and the mA5UKB that add different concns among the 5mg/ml BSA, centrifugal collection thrombocyte and supernatant, measure its radioactivity respectively, the AnnexinA5 of calculations incorporated hundred and mA5UKB, centrifugal collection thrombocyte and supernatant, measure its radioactivity respectively, calculations incorporated per-cent.The film binding specificity studies show that the mA5UKB fusion rotein is to the avidity and the AnnexinA5 suitable (Fig. 4) of activated blood platelet.

The above results shows that the mA5UKB fusion rotein not only has the target thrombolytic effect that with the activated blood platelet is the aorta thrombus of main component, and with the anti-freezing function, available its preparation novel thrombolytic drug.

The nucleotides sequence tabulation of table 1 mAnxA5 gene

ATGGCACAGGTTCTCAGAGGCACTGTGACTGACTTCCCTGGATTTGATGAGCGGGCTGAT?60

GCAGAAACTCTTCGGAAGGCTATGAAAGGCTTGGGCACAGATGAGGAGAGCATCCTGACT?120

CTGTTGACATCCCGAAGTAATGCTCAGCGCCAGGAAATCTCTGCAGCTTTTAAGACTCTG?180

TTTGGCAGGGATCTTCTGGATGACCTGAAATCAGAACTAACTGGAAAATTTGAAAAATTA?240

ATTGTGGCTCTGATGAAACCCTCTCGGCTTTATGATGCTTATGAACTGAAACATGCCTTG?300

AAGGGAGCTGGAACAAATGAAAAAGTACTGACAGAAATTATTGCTTCAAGGACACCTGAA?360

GAACTGAGAGCCATCAAACAAGTTTATGAAGAAGAATATGGCTCAAGCCTGGAAGATGAC?420

GTGGTGGGGGACACTTCAGGGTACTACCAGCGGATGTTGGTGGTTCTCCTTCAG

The aminoacid sequence table of table 2 mAnxA5

5 10 15 20

METAlaGlnValLeuArgGlyThrValThrAspPheProGlyPheAspGluArgAlaAsp

25 30 35 40

AlaGluThrLeuArgLysAlaMETLysGlyLeuGlyThrAspGluGluSerIleLeuThr

45 50 55 60

LeuLeuThrSerArgSerAsnAlaGlnArgGlnGluIleSerAlaAlaPheLysThrLeu

65 70 75 80

85 90 95 100IleValAlaLeuMETLysProSerArgLeuTyrAspAlaTyrGluLeuLysHisAlaLeu

105 110 115 120LysGlyAlaGlyThrAsnGluLysValLeuThrGluIleIleAlaSerArgThrProGlu

125 130 135 140GluLeuArgAlaIleLysGlnValTyrGluGluGluTyrGlySerSerLeuGluAspAsp

145 150 155 160ValValGlyAspThrSerGlyTyrTyrGlnArgMETLeuValValLeuLeuGln

The nucleotides sequence tabulation of table 3 UKB gene GGCGGATCCGGTGGCGGTAAGATTATTGGGGGAGAATTTACCACCATCGAGAACCAGCCC 60TGGTTTGCGGCCATCTACAGGAGGCACCGGGGGGGCTCTGTCACCTACGTGTGTGGAGGC 120AGCCTCATCAGCCCTTGCTGGGTGATCAGCGCCACACACTGCTTCATTGATTACCCAAAG 180AAGGAGGACTACATCGTCTACCTGGGTCGCTCAAGGCTTAACTCCAACACGCAAGGGGAG 240ATGAAGTTTGAGGTGGAAAACCTCATCCTACACAAGGACTACAGCGCTGACACGCTTGCT 300CACCACAACGACATTGCCTTGCTGAAGATCCGTTCCAAGGAGGGCAGGTGTGCGCAGCCA 360TCCCGGACTATACAGACCATCTGCCTGCCCTCGATGTATAACGATCCCCAGTTTGGCACA 420AGCTGTGAGATCACTGGCTTTGGAAAAGAAAATTCTACCGACTATCTCTATCCGGAGCAG 480CTGAAAATGACTGTTGTGAAGCTGATTTCCCACCGGGAGTGTCAGCAGCCCCACTACTAC 540GGCTCTGAAGTCACCACCAAAATGCTATGTGCTGCTGACCCCCAATGGAAAACAGATTCC 600TGCCAGGGAGACTCAGGGGGACCCCTCGTCTGTTCCCTCCAAGGCCGCATGACTTTGACT 660GGAATTGTGAGCTGGGGCCGTGGATGTGCCCTGAAGGACAAGCCAGGCGTCTACACGAGA 720GTCTCACACTTCTTACCCTGGATCCGCAGTCACACCAAGGAAGAGAATGGCCTGGCCCTC 780TAA

The aminoacid sequence table of table 4 UKB

5 10 15 20 GlyGlySerGlyGlyGlyLysIleIleGlyGlyGluPheThrThrIleGluAsnGlnPro

25 30 35 40TrpPheAlaAlaIleTyrArgArgHisArgGlyGlySerValThrTyrValCysGlyGly

45 50 55 60SerLeuIleSerProCysTrpValIleSerAlaThrHisCysPheIleAspTyrProLys

65 70 75 80LysGluAspTyrIleValTyrLeuGlyArgSerArgLeuAsnSerAsnThrGlnGlyGlu

85 90 95 100MetLysPheGluValGluAsnLeuIleLeuHisLysAspTyrSerAlaAspThrLeuAla

105 110 115 120HisHisAsnAspIleAlaLeuLeuLysIleArgSerLysGluGlyArgCysAlaGlnPro

125 130 135 140SerArgThrIleGlnThrIleCysLeuProSerMetTyrAsnAspProGlnPheGlyThr

145 150 155 160SerCysGluIleThrGlyPheGlyLysGluAsnSerThrAspTyrLeuTyrProGluGln

165 170 175 180LeuLysMETThrValValLysLeuIleSerHisArgGluCysGlnGlnProHisTyrTyr

185 190 195 200GlySerGluValThrThrLysMetLeuCysAlaAlaAspProGlnTrpLysThrAspSer

205 210 215 220CysGlnGlyAspSerGlyGlyProLeuValCysSerLeuGlnGlyArgMETThrLeuThr

225 230 235 240GlyIleValSerTrpGlyArgGlyCysAlaLeuLysAspLysProGlyValTyrThrArg

245 250 255 260ValSerHisPheLeuProTrpIleArgSerHisThrLysGluGluAsnGlyLeuAlaLeu*

The nucleotide sequence Table A TGGCACAGGTTCTCAGAGGCACTGTGACTGACTTCCCTGGATTTGATGAGCGGGCT GAT 60GCAGAAACTCTTCGGAAGGCTATGAAAGGCTTGGGCACAGATGAGGAGAGCATC CTGACT 120CTGTTGACATCCCGAAGTAATGCTCAGCGCCAGGAAATCTCTGCAGCTTTTAA GACTCTG 180TTTGGCAGGGATCTTCTGGATGACCTGAAATCAGAACTAACTGGAAAATTTGA AAAATTA 240ATTGTGGCTCTGATGAAACCCTCTCGGCTTTATGATGCTTATGAACTGAAACA TGCCTTG 300AAGGGAGCTGGAACAAATGAAAAAGTACTGACAGAAATTATTGCTTCAAGGAC ACCTGAA 360GAACTGAGAGCCATCAAACAAGTTTATGAAGAAGAATATGGCTCAAGCCTGGA AGATGAC 420GTGGTGGGGGACACTTCAGGGTACTACCAGCGGATGTTGGTGGTTCTCCTTCA GGGTAGT 480 of table 5 mA5UKB geneGGCGGATCCGGTGGCGGTAAGATTATTGGGGGAGAATTTACCACCATCGAGAACCAGCCC 540TGGTTTGCGGCCATCTACAGGAGGCACCGGGGGGGCTCTGTCACCTACGTGTGTGGAGGC 600AGCCTCATCAGCCCTTGCTGGGTGATCAGCGCCACACACTGCTTCATTGATTACCCAAAG 660AAGGAGGACTACATCGTCTACCTGGGTCGCTCAAGGCTTAACTCCAACACGCAAGGGGAG 720ATGAAGTTTGAGGTGGAAAACCTCATCCTACACAAGGACTACAGCGCTGACACGCTTGCT 780CACCACAACGACATTGCCTTGCTGAAGATCCGTTCCAAGGAGGGCAGGTGTGCGCAGCCA 840TCCCGGACTATACAGACCATCTGCCTGCCCTCGATGTATAACGATCCCCAGTTTGGCACA 900AGCTGTGAGATCACTGGCTTTGGAAAAGAAAATTCTACCGACTATCTCTATCCGGAGCAG 960CTGAAAATGACTGTTGTGAAGCTGATTTCCCACCGGGAGTGTCAGCAGCCCCACTACTAC 1020GGCTCTGAAGTCACCACCAAAATGCTATGTGCTGCTGACCCCCAATGGAAAACAGATTCC 1080TGCCAGGGAGACTCAGGGGGACCCCTCGTCTGTTCCCTCCAAGGCCGCATGACTTTGACT 1140GGAATTGTGAGCTGGGGCCGTGGATGTGCCCTGAAGGACAAGCCAGGCGTCTACACGAGA 1200GTCTCACACTTCTTACCCTGGATCCGCAGTCACACCAAGGAAGAGAATGGCCTGGCCCTC 1260TAA

The aminoacid sequence table of table 6 mA5UKB

5 10 15 20METAlaGlnValLeuArgGlyThrValThrAspPheProGlyPheAspGluArgAlaAsp

25 30 35 40AlaGluThrLeuArgLysAlaMETLysGlyLeuGlyThrAspGluGluSerIleLeuThr

45 50 55 60LeuLeuThrSerArgSerAsnAlaGlnArgGlnGluIleSerAlaAlaPheLysThrLeu

65 70 75 80PheGlyArgAspLeuLeuAspAspLeuLysSerGluLeuThrGlyLysPheGluLysLeu

85 90 95 100IleValAlaLeuMETLysProSerArgLeuTyrAspAlaTyrGluLeuLysHisAlaLeu

105 110 115 120LysGlyAlaGlyThrAsnGluLysValLeuThrGluIleIleAlaSerArgThrProGlu

125 130 135 140GluLeuArgAlaIleLysGlnValTyrGluGluGluTyrGlySerSerLeuGluAspAsp

145 150 155 160ValValGlyAspThrSerGlyTyrTyrGlnArgMETLeuValValLeuLeuGln GlySer

165 170 175 180 GlyGlySerGlyGlyGlyLysIleIleGlyGlyGluPheThrThrIleGluAsnGlnPro

185 190 195 200TrpPheAlaAlaIleTyrArgArgHisArgGlyGlySerValThrTyrValCysGlyGly

205 210 215 220SerLeuIleSerProCysTrpValIleSerAlaThrHisCysPheIleAspTyrProLys

225 230 235 240LysGluAspTyrIleValTyrLeuGlyArgSerArgLeuAsnSerAsnThrGlnGlyGlu

245 250 255 260MetLysPheGluValGluAsnLeuIleLeuHisLysAspTyrSerAlaAspThrLeuAla

265 270 275 280HisHisAsnAspIleAlaLeuLeuLysIleArgSerLysGluGlyArgCysAlaGlnPro

285 290 295 300SerArgThrIleGlnThrIleCysLeuProSerMetTyrAsnAspProGlnPheGlyThr

305 310 315 320SerCysGluIleThrGlyPheGlyLysGluAsnSerThrAspTyrLeuTyrProGluGln

325 330 335 340LeuLysMETThrValValLysLeuIleSerHisArgGluCysGlnGlnProHisTyrTyr

345 350 355 360GlySerGluValThrThrLysMetLeuCysAlaAlaAspProGlnTrpLysThrAspSer

365 370 375 380CysGlnGlyAspSerGlyGlyProLeuValCysSerLeuGlnGlyArgMETThrLeuThr

385 390 395 400GlyIleValSerTrpGlyArgGlyCysAlaLeuLysAspLysProGlyValTyrThrArg

405 410 415 420ValSerHisPheLeuProTrpIleArgSerHisThrLysGluGluAsnGlyLe uAlaLeu* annotate: intermediary glycine and Serine joint when the line part is represented two gene fusion.

Claims (2)

1, a kind of thrombus target fusion mA5UKB of double anticoagulant and thrombolytic dual-use function is characterized in that aminoacid sequence is as follows:

5 10 15 20METAlaGlnValLeuArgGlyThrValThrAspPheProGlyPheAspGluArgAlaAsp

25 30 35 40AlaGluThrLeuArgLysAlaMETLysGlyLeuGlyThrAspGluGluSerIleLeuThr

45 50 55 60LeuLeuThrSerArgSerAsnAlaGlnArgGlnGluIleSerAlaAlaPheLysThrLeu

65 70 75 80PheGlyArgAspLeuLeuAspAspLeuLysSerGluLeuThrGlyLysPheGluLysLeu

85 90 95 100IleValAlaLeuMETLysProSerArgLeuTyrAspAlaTyrGluLeuLysHisAlaLeu

105 110 115 120LysGlyAlaGlyThrAsnGluLysValLeuThrGluIleIleAlaSerArgThrProGlu

125 130 135 140GluLeuArgAlaIleLysGlnValTyrGluGluGluTyrGlySerSerLeuGluAspAsp

145 150 155 160ValValGlyAspThrSerGlyTyrTyrGlnArgMETLeuValValLeuLeuGlnGlySer

165 170 175 180GlyGlySerGlyGlyGlyLysIleIleGlyGlyGluPheThrThrIleGluAsnGlnPro

185 190 195 200TrpPheAlaAlaIleTyrArgArgHisArgGlyGIySerValThrTyrValCysGlyGly

205 210 215 220SerLeuIleSerProCysTrpValIleSerAlaThrHisCysPheIleAspTyrProLys

225 230 235 240LysGluAspTyrIleValTyrLeuGlyArgSerArgLeuAsnSerAsnThrGlnGlyGlu

245 250 255 260MetLysPheGluValGluAsnLeuIleLeuHisLysAspTyrSerAlaAspThrLeuAla

265 270 275 280HisHisAsnAspIleAlaLeuLeuLysIleArgSerLysGluGlyArgCysAlaGlnPro

285 290 295 300SerArgThrIleGlnThrIleCysLeuProSerMetTyrAsnAspProGlnPheGlyThr

305 310 315 320SerCysGluIleThrGlyPheGlyLysGluAsnSerThrAspTyrLeuTyrProGluGln

325 330 335 340LeuLysMETThrValValLysLeuIleSerHisArgGluCysGlnGlnProHisTyrTyr

345 350 355 360GlySerGluValThrThrLysMetLeuCysAlaAlaAspProGlnTrpLysThrAspSer

365 370 375 380CysGlnGlyAspSerGlyGlyProLeuValCysSerLeuGlnGlyArgMETThrLeuThr

385 390 395 400GlyIleValSerTrpGlyArgGlyCysAlaLeuLysAspLysProGlyValTyrThrArg

405 410 415 420ValSerHisPheLeuProTrpIleArgSerHisThrLysGluGluAsnGlyLeuAlaLeu

2, the thrombus target fusion mA5UKB of the described double anticoagulant and thrombolytic dual-use function of claim 1 is used to prepare the purposes of thrombolytic drug.

Images