CN1786175A - Plasmid for expressing recombination human tPA and its construction method - Google Patents

Abstract

The invention discloses an expression recombination human tPA plasmid and making method. The plasmid pETrtPAm-1, CCTCC M205111 is cloned a recombination mutation tPA gene. The gene has nucleotide sequence placed in SEQ ID NO.1. The plasmid can transform to acceptor to gain engineering strain, and can effectively express recombination mutation tPA albumen by inducing. The produced recombination tPA molecule has small molecular weight, strong activity, long half life, and high stability.

Description

A kind of plasmid of express recombinant buman tPA and construction process

Technical field

The invention belongs to the genetically engineered field, the plasmid that relates to a kind of express recombinant buman tPA, this plasmid transforms engineering strain can produce recombination mutation tPA albumen, can be used for treating clinically diseases such as Acute Myocardial Infarction, cerebral thrombosis, pulmonary infarction, medically has important use value; The present invention also relates to the construction process of this plasmid simultaneously.

Background technology

Buman tPA is that (tissue type plasminogen activator tPA), is a kind of serine protease for people's tissue-type plasminogen activator.It contains 527 amino acid, molecular weight 68KD, can become the activation of the Profibrinolysin of non-activity plasmin and bring into play the thrombus dissolving effect, be used for thromboembolism treatments such as Acute Myocardial Infarction, cerebral thrombosis apoplexy, pulmonary infarction clinically, be present good in the world thrombolytic drug, it is fast, safe to have a thrombolysis, more the back disability rate is low, to advantages such as people's no antigens.

TPA is mainly by the vascular endothelial cell expression-secretion, and concentration is very low in the blood plasma, is about 5ng/ml, about 5 minutes of transformation period, and therefore from blood plasma or tissue, directly extract tPA and can not be used for producing, can only adopt genetic engineering technique production.1987, the Recomposed tPA that the U.S. takes the lead in ratifying first genetic engineering technique production is used for the clinical treatment Acute Myocardial Infarction, commodity are called alteplase (Activase), and this product belongs to the original tPA of total length, belong to tPA first-generation product, significantly shortcoming is transformation period short (3-6 minute), active low, to the tPA inhibition PAI non-resistant of higher concentration in patient's blood plasma, thereby using dosage is very big, every pin contains tPA 150-200mg, and the price of every pin is also very expensive.

In order to solve the problem that original tPA exists, on the basis of tPA structure and functional study, the researchist further carries out aminoacid deletion and replaces Study on Variation tPA.TPA structurally can be divided into (finger plot structure territory, F district, 4-49aa), E district (somatomedin functional domain, 50-86aa), K1 district (kringle1,87-175aa), (kringle 2 in the K2 district, 176-261aa) with (proteolytic enzyme district, P district, 262-527aa) five functional domains (naming ﹠ numbering of structural domain is according to gene pool Genbank login number GI137119 or document Pennica D.et al.Nature 301:214,1983) independently.Each ad hoc structure territory of t-PA and the relation between the various biologic activity of t-PA are illustrated, F district and K2 district all can specificity be incorporated into fibrin clot, K1 district and liver receptor are in conjunction with relevant, P contains serine protease in the district, be responsible for the fiber proenzyme is cut into cellulase, contain the binding site (aa296-299) of the active inhibition PAI of tPA on it.The disappearance in any one district or variation do not influence other regional structure and activity among the tPA, and this provides the foundation for the reorganization of tPA, transformation (being referred to as the tPA mutant).Countries such as the U.S., Germany, Japan, Britain all improve the performance of tPA by reorganization and variation in research, and have separately an intellecture property, as the reteplase of German Pola graceful (Boehringer Mannheim) company exploitation (Reteplase, rPA), nPA enzyme (Lanoteplase), the Japan of the TNK enzyme (Tenecteplase) of U.S.'s Genentech (Genentech) company exploitation, U.S.'s Bristol-mayer Si Pubo (Bristol-MyersSpuibb) company exploitation defends the Monteplase (Monteplase) etc. that material (Eisai) is built the exploitation of ripple institute.Reteplase (Reteplase) is a kind of Recomposed tPA product of producing with the intestinal bacteria system expression, form by two structural areas of K2P, disappearance F, E, three zones of K1, contain 355 amino acid (Kohnert U, et al.Protein Engineering 5:93,1992, the patent No.: EP 0 382 174 A1).Its character and natural tPA molecule have had bigger change, stability is improved, transformation period rises to 15-18 minute, but bigger decline is arranged with fibrinous avidity, it is combined into reversible the combination with fibrinous, binding ability is significantly less than natural tPA, and still contains the binding site of the active inhibition PAI of tPA in the reteplase structure, and in vitro tests shows that the PAI-1 of 5U/ml just can make the reteplase inactivation of 5ng/ml.Its specific activity is 5 * 10 ⁵IU/mg, using dosage 20-40mg, preparation was preserved validity period 2 years at 2 ℃, and the dissolving rear stability is poor, requires clinically to use in 4 hours.The TNK enzyme is a kind of total length tPA that produces with Chinese hamster cell (CHO), contain 527 amino acid, variation takes place to replace in totally 6 amino acid three positions, and promptly the Thr103 in K1 district and Asn117 are replaced by Asn and Glu respectively, and the Lys296-His-Arg-Arg299 in P district is replaced by 4 Ala.Compare with original t-PA, the activity of the external anti-PAI of TNK enzyme improves 80 times, and the transformation period prolongs 4 times, and activity has only 82% of original tPA in vivo, and binding fiber albumen ability keeps 87% (Keyt.B.A.et al.PNAS, USA, 91:3670,1994).TNK enzyme using dosage is still bigger clinically, and every pin content reaches 50mg.Monteplase is a kind of total length tPA that is produced by body hamster kidney cell, contain 527 amino acid, the Cys84 in E district is replaced into Ser, its action effect is similar to t-PA, the ability of plasminogen activation is strong 14.9 times when not having than scleroproein when scleroproein exists, but itself and scleroproein combination rate are about 1/3 of original t-PA, and it is descended to some extent to the thrombus site specific.More than three kinds of tPA mutant all go on the market, also has a kind of tPA mutant nPA enzyme (Lanoteplase) that waits for U.S. food and drug administration (FDA) approval in addition, F, E district have been lacked, and modified the glycosylation site in K1 district, compare with original t-PA, its transformation period prolongs 37min, and has improved thrombolysis activity, but reduced fibrinous avidity, and the rate of intracranialing hemorrhage that causes is higher than t-PA.

Although various tPA mutant improve the performance of tPA aspect different, s-generation Recomposed tPA still exists poor heat stability, the problem that specificity is not high, using dosage is big and production cost is high.

Summary of the invention

The object of the present invention is to provide the plasmid pETrtPAm-1 of a kind of energy express recombinant tPA.Plasmid transforms engineering strain, can express Recomposed tPA high-levelly, the Recomposed tPA molecule that produces is different from existing other recombination buman tPA (as rt-PA, TNK enzyme, reteplase reteplase etc.), has little, active strong, the long half time of molecular weight, characteristics that stability is high.

Another object of the present invention is to provide a kind of method of construction expression Recomposed tPA plasmid, and method is simple and direct, has repeatability.Plasmid pETrtPAm provided by the invention is stored in intestinal bacteria (Escherichiacoli) bacterial strain DH5 α, DH5 α/pETrtPAm-1 has submitted Chinese typical culture collection center preservation to, preservation address: China. Wuhan. Wuhan University, preservation date: on October 09th, 2005, deposit number is CCTCCM205111, classification name: Escherichia coli DH5 α/pETrtPAm-1.

Contain recombination mutation tPA gene on the plasmid pETrtPAm-1, this recombination has been removed K1 and two structural areas of K2 of natural tPA gene, only comprise F, E, P-structure district, total length 1083bp (seeing SEQ IDNO.1), 360 amino acid of encoding altogether, and cause amino acid to replace three positions, be R298E (AGG-GAG), R299E (AGG-GAG), S262G (TCC-GGT) (digitized representation is the amino acid position in the original tPA molecule), wherein latter two site mutation causes the bonding force of tPA inhibition PAI-1 to descend.TPA is all different with the sudden change tPA of at present existing patent in this reorganization variation, as reteplase (reteplase, rPA) form by two structural areas of K2P, disappearance F, E, three zones of K1, contain 355 amino acid (KohnertU, et al.Protein Engineering 5:93,1992, the patent No.: EP 0 382 174 A1); TNK enzyme (Tenecteplase) is total length tPA, contains 527 amino acid, and variation takes place to replace totally 6 amino acid three positions, and promptly the Thr103 in K1 district and Asn117 are replaced by Asn and Glu respectively, and the Lys296-His-Arg-Arg299 in P district is replaced by 4 Ala; Monteplase (Monteplase) is a kind of total length tPA, is that the Cys84 with the E district is replaced into Ser; NPA enzyme (Lanoteplase) is made up of K1, K2, P district, has lacked F, E district, and has modified the glycosylation site in K1 district.

The Recomposed tPA gene downstream is right after a translation termination sign indicating number TGA in the plasmid.The translation initiation region of recombinant plasmid contains Kozak sequence C CATGG, and Kozak sequence upstream is ribosome binding sequence and T7 promoter sequence, can produce recombination mutation tPA albumen by high level expression when the T7 transcriptase exists.

The sequence of the recombination mutation tPA gene that the present invention relates to, tPA complete genome sequence and structural domain numbering that main reference gene storehouse Genbank login number GI 137119 and document (Pennica D.et al.Nature 301:214,1983) provide are carried out.Extract total RNA from the cord vessels endotheliocyte, the sequences Design primer according to the tPA gene cDNA amplifies full length cDNA sequence with the RT-PCR method, be the sequence construct recombination mutation buman tPA gene that sets out.After obtaining recombination mutation tPA gene, it is cloned into the expression plasmid pET-His (the pET-His plasmid is available from gene Dynamic Test Chamber company limited) that process is transformed, obtain recombinant plasmid pETrtPAm-1.The structure flow process of plasmid pETrtPAm-1 is as follows:

1.tPA the FE fragment of gene and the segmental pcr amplification of P.

Design two pairs of primers:

Primer 1:GAATTC GGATCCATGGGAAGATCTTACCAAGTGATC (the underscore place is BamHI cutting sequence GGATCC, after connect codon ATG, and contain Kozak sequence C CATGG, see that oblique bold-type letter shows)

Primer 2: GTCGAC GGTACCCGTGGCCCTGGTATC (containing KpnI cutting sequence GGTACC)

Primer 3:GTCGAC GGTACCTGCGGCCTGAGACAG (containing KpnI cutting sequence GGTACC)

Primer 4:AGATCT AAGCTTCTCGAGTCACGGTCGCATGTTGTC (containing HindIII cutting sequence A AGCTT)

Amplify the FE fragment (with primer 1 and 2) and the P fragment (with primer 3 and 4) of tPA gene respectively with PCR method.

2. acquisition Recomposed tPA gene.

With restriction enzyme BamHI and KpnI cutting FE fragment, with restriction endonuclease KpnI and HindIII cutting P fragment, with restriction endonuclease BamHI and HindIII cutting pQE30 plasmid (available from QIAGEN company), carrying out three fragments with the T4 ligase enzyme connects, make up osculant recombinant plasmid pQErtPA, on contain Recomposed tPA gene (rtPA gene), by F, E, the P-structure district of natural tPA gene forming, do not contain K1 and K2 structural area, have Kozak sequence C CATGG at the initiation codon place).

3. obtain recombination mutation tPA gene (rtPAm-1 gene).

Design two mutagenic primers:

Primer 5:CTCTCCGGGCGA CTCCTCGTGCTTGGCAAAGATGGC

Primer 6:GCCATCTTTGCCAAGCAC GAGGAGTCGCCCGGAGAG

Adopt the PCR fixed-point mutation method on Recomposed tPA gene, the R298 of original tPA molecule, R299 coding place all to be sported E coding (password becomes GAG by CTC), obtain recombination mutation tPA gene, i.e. the rtPAm-1 gene.

4. obtain recombinant plasmid pETrtPAm-1

At first plasmid pET-His is transformed, remove the coding region of 6His on it.Design a pair of primer according to the pET-His plasmid sequence:

Primer 7:CGCTCCAGGGATCCGCAGAATTC (forward)

Primer 8:CATGAGCGGGATCCTTCTTAAAGTTAAAC (oppositely)

Utilize the pET-His plasmid DNA to be template, carry out pcr amplification, then with BamHI and HindIII cutting amplified production, obtain pET plasmid fragment through transforming, the recombination mutation tPA gene (rtPAm-1 gene) of the 1.1kb that PCR is produced cuts with restriction endonuclease BamHI and HindIII again, connect two fragments with the T4 ligase enzyme, obtain recombinant plasmid pETrtPAm-1.

5. identify recombinant plasmid pETrtPAm-1: with double digestion, PCR method recombinant plasmid is carried out preliminary evaluation, carry out finally determining through dna sequencing again.

Order-checking proof recombination mutation buman tPA gene order meets design in advance fully.With recombinant plasmid pETrtPAm-1 transformed into escherichia coli (Escherichia coli) the bacterial strain BL21 (DE3) (available from gene Dynamic Test Chamber company limited) that obtains, under the inducing of inductor isopropylthio-(IPTG), can produce rtPAm-1 albumen high-levelly, molecular weight of albumen 38kD, form with inclusion body exists, and expression amount accounts for more than 30% of total tropina.Utilize the 10L fermentor tank to carry out pilot scale fermentation production, the fermentation expression level of producing tPA can reach 1100mg/L.The rtPAm-1 inclusion body detects with molten fine circle method through renaturation and purifying, has the effect that activates the former cellulolytic activity of fibrinolytic enzyme, and activity reaches 5-6 * 10 ⁵IU/mg reaches or is better than international like product level.Animal experiment shows the rtPAm-1 nontoxicity, has no side effect, and the transformation period reaches 20-30 minute in the body.Above result shows, the ability of plasmid pETrtPAm-1 express recombinant sudden change tPA provided by the invention is strong, the novel recombination mutation tPA molecule that produces is compared with existing tPA product, have that molecular weight is little, active strong, long half time, characteristics that stability is high, on every index, meet or exceed international like product level, possess production application and be worth.Appearance has repeatability within the present invention, and those of ordinary skill can make up this plasmid according to step provided by the present invention.

Description of drawings

Fig. 1 plasmid pETrtPAm-1 makes up synoptic diagram

1. the acquisition of Recomposed tPA gene (rtPA gene).

Design two pairs of primers, primer 1 and the primer 2 FE fragment that is used to increase, the primer 3 and 4 P fragment that is used to increase.With tPAcDNA is template, and by FE district, the P district fragment of PCR method acquisition tPA gene, two fragments are through the restriction enzyme cutting, carrying out three fragments with pQE30 plasmid that enzyme is cut is connected, obtain recombinant plasmid pQErtPA, on contain Recomposed tPA gene, by F, E, the P district of original tPA gene forming.

2. the acquisition of recombination mutation rtPAm-1 gene (rtPAm-1 gene).

Adopt the PCR fixed-point mutation method.Designing two mutagenic primer primers 5 and primer 6, is template with pQErtPA, carries out pcr amplification with primer 1 and 5, primer 4 and 6 respectively.And then, carry out the PCR second time with two kinds of PCR products mixing, template---primer extends two fragments each other, produces the recombination mutation tPA gene (rtPAm-1 gene) of 1.1Kb.The position in the mutational site of round dot display design.

3. expression plasmid pET-His is transformed, remove the coding region of 6His on it.

According to a pair of primer of pET-His grain sequences Design: primer 7 and primer 8 are template with the pET-His plasmid DNA, carry out pcr amplification.With BamHI and HindIII cutting amplified production, obtain not having the pET plasmid fragment of 6His coding region then.

4. the acquisition of plasmid pETrtPAm-1.

The recombination mutation tPA gene (rtPAm-1 gene) of the 1.1kb that PCR is produced connects the pET plasmid fragment of transforming with restriction endonuclease BamHI and HindIII cutting with the T4 ligase enzyme, obtains recombinant plasmid pETrtPAm-1.

The enzyme of Fig. 2 plasmid pETrtPAm-1 is cut and is identified and PCR evaluation (0.7% agarose gel electrophoresis)

1. through the pET plasmid of transformation.Removed the 6His coding region, its big or small 2.6kb.

2.DNA molecular weight sign (Marker)

3, the 4.pETrtPAm-1 plasmid is through the fragment of KpnI and the generation of HindIII double digestion.Wherein the band of 0.8kb is the P fragment in the rtPAm-1 gene, and the band of 2.9kb then is that the FE fragment of tPA adds pET plasmid fragment.

5,6. be the PCR product of template with pETrtPAm-1.1.1kb amplified band be the rtPAm-1 gene fragment.

Fig. 3. coli strain BL21/rtPAm-1 abduction delivering produces rtPAm-1 albumen (detection of 10%SDS-polyacrylamide gel electrophoresis)

1. cultivate through LB, 2YT liquid nutrient medium, rtPAm-1 albumen does not appear in the tropina of the coli strain BL21/rtPAm-1 before isopropylthio-(IPTG) is induced.

2. isopropylthio-(IPTG) is induced 6h, ultrasonic disruption coli strain BL21/rtPAm-1 cell, the albumen in the centrifugal supernatant that obtains.There is not rtPAm-1 albumen.

3. isopropylthio-(IPTG) is induced 6h, ultrasonic disruption coli strain BL21/rtPAm-1 cell, the albumen in the centrifugal precipitation that obtains.RtPAm-1 albumen occurs, the arrow place shows rtPAm-1 albumen.RtPAm-1 albumen accounts for more than 30% of total cell protein, and its size is about 38kD.

4. will induce the rtPAm-1 inclusion body sex change of acquisition to be dissolved in 8M urea, and, utilize molecular sieve chromatography G50-Sephadex to carry out the rtPAm-1 albumen of purifying again with phosphate buffered saline buffer (PBS) the dialyzed overnight renaturation of pH8.0.Through above-mentioned processing, the proteic purity of rtPAm-1 reaches more than 95%.

5. protein molecule quantitative character (Marker)

Fig. 4. detect the effect of the proteic plasminogen activation cellulolytic activity of rtPAm-1 with molten fine circle method

1. negative control: physiological sodium chloride solution, point sample 2 μ l.Molten fine circle does not appear.

2. standard control: standard buman tPA sample, point sample 10 units (10IU).Molten fine circle appears.

3. experimental group: through the rtPAm-1 albumen of renaturation and purifying, point sample 5 μ l.Molten fine circle appears.

The result shows that the rtPAm-1 albumen of the present invention's plasmid pETrtPAm-1 expression has the effect of plasminogen activation cellulolytic activity.

Embodiment

Below in conjunction with accompanying drawing the present invention is described in further detail.Experimental technique among the embodiment, condition is carried out routinely, with reference to as Sa nurse Brooker etc., the experimental technique described in the molecular cloning experiment guide (second edition,, Science Press in 1992).

Structure and the evaluation of embodiment 1. plasmid pETrtPAm-1

Fig. 1 has shown the structure principle and the process of recombination mutation tPA gene.Natural sophisticated buman tPA contains 527 amino acid, form (F, E, K1, K2 and P) by 5 independent structures districts, the P district contains inhibition PAI land and the enzymic activity district of tPA, K2 contains PAI zone of action and scleroproein land, K1 is relevant with liver removing tPA, F district (referring to the type structural area) is relevant with protein interaction, and when K1K2 lacked, the F district still can interact with scleroproein, Profibrinolysin.The recombination mutation rtPAm-1 gene that the present invention is designed is to consider stability, prolong half-life and the increase of the increase tPA resistance to inhibition PAI.When the design gene is rebuild and is made a variation, carry out in two steps, at first construction goes out to contain the Recomposed tPA gene (disappearance K1 and K2) of F, E, P, and then the replacement of encoding at PAI action site introducing amino acid suddenlys change, the gene order of acquisition shown in SEQ ID NO.1, at last this gene is connected in the expression plasmid, is built into plasmid pETrtPAm-1.Embodiment is as follows:

1.tPA the segmental pcr amplification of gene FE fragment and P

At first synthetic two pairs of primers are used for two segmental amplifications

Primer 1:GAATTC GGATCCATGGGAAGATCTTACCAAGTGATC (the underscore place is BamHI cutting sequence GGATCC, after connect codon ATG, and contain Kozak sequence C CATGG)

Primer 2: GTCGAC GGTACCCGTGGCCCTGGTATC (containing KpnI cutting sequence GGTACC)

Primer 3:GTCGAC GGTACCTGCGGCCTGAGACAG (containing KpnI cutting sequence GGTACC)

Primer 4:AGATCT AAGCTTCTCGAGTCACGGTCGCATGTTGTC (containing HindIII cutting sequence A AGCTT)

With tPA cDNA is amplification template, add primer 1 and primer 2 in one set of reaction tubes, the FE fragment that is used to increase, another group adds primer 3 and 4, the P fragment is used to increase, two groups of PCR reaction conditionss are identical: 94 ℃ of 5min, 94 ℃ of 1min afterwards, 55 ℃ of 1min, 72 ℃ of 1min totally 33 circulations, last 72 ℃ of 10min, pcr amplification product are through the phenol extracting, and 1% low melting-point agarose gel electrophoresis is reclaimed.

2. the structure of recombinant plasmid pQErtPA

With restriction endonuclease BamHI and KpnI cutting FE fragment, with KpnI and HindIII cutting P fragment, with BamH I and KpnI cut vector plasmid pQE30, utilizing the T4 ligase enzyme to carry out three fragments connects, obtain the pQErtPA recombinant plasmid, transformed into escherichia coli DH5a competent cell, positive bacterium colony is obtained in screening on penbritin (Amp)-LB flat board.

3. on Recomposed tPA gene, the R298 of original tPA molecule, R299 coding place are all sported the E coding

Adopt the PCR fixed-point mutation method to suddenly change.At first synthetic two mutagenic primers (representative sudden change place of underscore place):

Primer 5:CTCTCCGGGCGA CTCCTCGTGCTTGGCAAAGATGGC

Primer 6:GCCATCTTTGCCAAGCAC GAGGAGTCGCCCGGAGAG

With the pQErtPA plasmid is template, uses primer 1 and 5 respectively, and primer 4 and 6 carries out pcr amplification, and the PCR reaction conditions is: 94 ℃ of 5min, 94 ℃ of 1min afterwards, 52 ℃ of 1min, 72 ℃ of 1min totally 33 circulations, last 72 ℃ of 10min.Pcr amplification product is through the phenol extracting, and 1% low melting-point agarose gel electrophoresis is reclaimed.Two kinds of PCR products that will reclaim then mix, and carry out the PCR second time, and the PCR reaction conditions is: 94 ℃ of 10min, 94 ℃ of 1min afterwards, 53 ℃ of 1min, 72 ℃ of 1min totally 33 circulations, last 72 ℃ of 10min.Template---primer extends two fragments each other, produces the recombination mutation tPA gene of 1.1Kb, i.e. the rtPAm-1 gene.

4. expression plasmid pET-His is transformed

Expression plasmid pET-His is available from gene Dynamic Test Chamber company limited.Primary pET-His plasmid can give expression to continuous 6 Histidines so that protein purification, but does not meet biological products pharmacy requirement, increases operation and significantly improves production cost and cut fusogenic peptide Duan Zehui after purifying again.Therefore the main purpose of this step is the coding region of removing 6 Histidines on the pET-His plasmid.Shown in Figure 1, respectively design a primer according to the sequence of the left and right sides, 6His coding region of pET-His plasmid:

Primer 7:CGCTCCAGGGATCCGCAGAATTC (forward)

Primer 8:CATGAGCGGGATCCTTCTTAAAGTTAAAC (oppositely)

Utilizing above-mentioned primer, is that template is carried out PCR with the pET-His plasmid, and the PCR reaction conditions is: 94 ℃ of 10min, 94 ℃ of 1min afterwards, 53 ℃ of 1min, 72 ℃ of 3min totally 33 circulations, last 72 ℃ of 10min.PCR can obtain a linear DNA amplified production, and an end contains restriction enzyme site BamH I, and the other end contains restriction enzyme site BamHI and HindIII (Fig. 1).

5. the structure of recombinant expression plasmid pETrtPAm-1:

The linear DNA amplified production that previous step PCR obtains cuts with BamHI and HindIII, and reclaims with 0.7% low melting-point agarose gel electrophoresis, and the rtPAm-1 gene that PCR obtains in going on foot the 3rd is used behind BamHI and the HindIII double digestion and reclaimed.Connect two fragments with the T4 ligase enzyme, obtain recombinant plasmid pETrtPAm-1, transformed into escherichia coli DH5 α competent cell obtains positive bacterium colony with penbritin (Amp)-LB plate screening, through identifying (step as follows), called after DH5 α/rtPAm-1.

6. the evaluation of plasmid pETrtPAm-1:

Alkaline lysis is (with reference to Sa nurse Brooker etc., the molecular cloning experiment guide, second edition, 1992, Science Press) extraction plasmid pETrtPAm-1 from positive bacterium colony DH5 α/rtPAm-1 culture, with KpnI and HindIII double digestion, 0.7% agarose gel electrophoresis inspection, the result produces 0.8Kb and 2.9Kb two bands (Fig. 2), conforms to the expection size, wherein the band of 0.8kb is represented the P fragment in the rtPAm-1 gene, and the band of 2.9kb then is that the FE fragment adds pET plasmid fragment.Further identifying with PCR, is template with the recombinant plasmid, carries out PCR with primer 1 and primer 4, can obtain size and be the amplified band of 1.1kb (Fig. 2), conforms to the expection size.

The order-checking of rtPAm-1 gene is undertaken by handsome (invitrogen) Bioisystech Co., Ltd on the plasmid.Sequencing primer is the t7 rna polymerase sequence universal primer that utilizes on the pET-His plasmid, sequencing result shows that the rtPAm-1 gene order and the desired design of acquisition is in full accord, rtPAm-1 full length gene 1083nt (comprising termination codon TGA), 360 the amino acid whose albumen of encoding.With the plasmid called after pETrPAm that produces.

Embodiment 2 plasmid pETrtPAm-1 abduction delivering rtPAm-1 albumen in intestinal bacteria

1. the extraction of plasmid pETrtPAm-1

Coli strain DH5 α/rtPAm-1 is inoculated into the LB liquid nutrient medium, and 37 ℃ of incubated overnight adopt alkaline lysis method of extracting plasmid (with reference to Sa nurse Brooker etc., molecular cloning experiment guide, second edition,, Science Press in 1992).

2. plasmid pETrtPAm-1 transformed into escherichia coli BL21 (DE3)

Be equipped with BL21 (DE3) competent cell with cold CaCl2 legal system,, obtain positive bacterium colony with penbritin (Amp)-LB plate screening with pETrtPAm-1 plasmid transformation escherichia coli bacterial strain BL21 (DE3).The bacterial strain called after BL21/rtPAm-1 that obtains (with reference to Sa nurse Brooker etc., molecular cloning experiment guide, second edition,, Science Press in 1992).

3. from the rapid penbritin of previous step (Amp)-LB flat board, select single bacterium colony, being inoculated into 5ml contains in the LB liquid nutrient medium of 100 μ g/ml penbritins (Amp), cultivated 14 hours for 37 ℃, press 1: 40 transferred species then in the 2YT substratum, cultivate 2～3h for 37 ℃, add inductor isopropylthio-(IPTG) to final concentration 1mM, induce 6h for 37 ℃.Centrifugal collection thalline, be suspended in buffer A (20mMTris, 0.5M NaCl, pH8.0), the ultrasonic disruption thalline, centrifugal collecting precipitation is with 10%SDS-polyacrylamide gel electrophoresis analysing protein expression.

Fig. 3 shows that after inducing through isopropylthio-(IPTG), coli strain BL21/rtPAm-1 efficiently expresses out rtPAm-1 albumen.The expressed proteins molecular weight is about 38kD, conforms to the expection size.Expressing protein is the inclusion body form, after cytoclasis, all appears in the precipitation, and expression amount accounts for more than 30% of total protein of cell.

The production level of embodiment 3 coli strain BL21/rtPAm-1 in 10 liters of fermentor tanks

1. inclined-plane seed culture.In penbritin (Amp)-LB flat board, select the single colony inoculation of BL21/rtPAm-1 to LB inclined-plane solid medium, contain penbritin (Amp) 100 μ g/ml, cultivated 16 hours for 37 ℃.

2. shake-flask seed is cultivated: the 2YT liquid nutrient medium, contain penbritin (Amp) 100 μ g/ml, every bottle of 100ml substratum, inoculation one ring inclined-plane seed, 37 ℃ shaking culture 12-14 hour.

3. fermentation culture, used substratum is a fermention medium: peptone 20g/L, yeast extract 8g/L, NaCl2g/L, MgSO ₄0.2g/L, bubble enemy 20 μ l/L, pure water preparation, 10 liters of culture volumes.Regulate pH value to 7.0 before the sterilization.Steam sterilizing, cylinder was pressed 0.1mpa (120 ℃) 20 minutes.

The control condition of fermentation culture and parameter:

10 liters of culture volumes, pH6.8-7.0;

Inoculum size 5%-10%;

Stirrer rotating speed 40Hz;

Temperature controlling range 35-37 ℃;

Tank pressure 0.05-0.07Mpa;

Air flow 3-5 liter/min (1: 0.3-1: 0.5)

By above-mentioned condition and parameter, be cultured to that bacterium amount 6-8 grams per liter, pH value rise to 7.2, DO drops to 20% when following, adds isopropylthio-(IPTG) to final concentration 1mM, 35-37 ℃ is continued cultivation, induced protein expression 6-8 hour.Fermentation whole process is 10-12 hour.

Fermentation can obtain the inclusion body of Recomposed tPA.Continuously ferment with 10 liters of automatic fermenters and to produce 10 batches, thalline output (centrifugation weight in wet base) is stabilized in 8.0-10.0g/L, and tPA crystal (behind the purifying, weight in wet base) is stabilized in 900-1200mg/L, and mean yield reaches 1100mg/L.The tPA crystal checks that through the 10%SDS-polyacrylamide gel electrophoresis tPA protein content is about 90%.

Proteinic renaturation of embodiment 4rtPAm-1 and purifying

1. centrifugal collection is through isopropylthio-(IPTG) inductive e. coli bl21/rtPAm-1 thalline, be suspended in buffer A (20mM Tris, 0.5M NaCl, pH8.0).

2. ultrasonic disruption cell behind the centrifugal collecting precipitation, distilled water wash 3 times, is dissolved in 8M urea, under 4 ℃ of conditions, with phosphate buffered saline buffer (PBS) the dialyzed overnight renaturation of pH8.0.

3. utilize with molecular sieve chromatography G50-Sephadex (available from peace agate West Asia company) and carry out purifying, pillar 10mMTris-Cl (pH7.5) balance, upper column quantity is a column volume 20%, with 10mMTris-Cl (pH7.5), 0.15-0.5M NaCl gradient elution, monitor collection with nucleic acid protein detector (wavelength 280nm), tPA directly flows out from post at first, and the back is the following albumen of molecular weight 30KD.

Fig. 3 swimming lane 4 shows that through the rtPAm-1 albumen behind sex change dissolving, renaturation and the purifying, behind the sieve chromatography purifying, the proteic purity of rtPAm-1 can reach more than 95%.

Proteic active detection of embodiment 5rtPAm-1

Adopt the solusphere method to carry out, step is as follows:

1.tPA standard substance: available from Beijing pharmaceutical biological product calibrating institute of the Ministry of Health, every bottle contains tPA30000IU, and with the dissolving of 3ml physiological sodium chloride solution, making tPA concentration is 10IU/ μ l.

2. human thrombin: be made into 100IU/ml with physiological sodium chloride solution, in-20 ℃ of preservations.

3. Profibrinolysin:, be made into 0.5mg/ml with physiological sodium chloride solution available from Beijing pharmaceutical biological product calibrating institute.

4. human fibrinogen: 30mg/ props up, Nat'l Pharmaceutical ﹠ Biological Products Control Institute's preparation standard reagent.Configuration before the experiment, earlier at 37 ℃ of water-bath preheating 15min, physiological sodium chloride solution is preheating simultaneously also before the configuration, and every adds the 5ml physiological sodium chloride solution then, and insulation 30min is left standstill in 37 ℃ of water-baths dissolves it fully, is configured to 6mg/ml solution.

5. fibrin plate preparation: take by weighing the 125mg agarose, add the 23ml physiological sodium chloride solution, boil dissolving, 60 ℃ of water-bath balances, add 280ul scleroproein (0.5mg/ml), add 14 μ l zymoplasms (100IU/ml), do not stop to shake up, muddy back is fallen dull and stereotyped, horizontal positioned, and room temperature is solidified.

6. active the detection: punch on fibrin plate with punch tool, diameter 2mm, in tPA sample and standard substance point hand-hole, 37 ℃ 8 hours, measurement transparent circle diameter.Transparent circle diameter according to standard tPA and rtPAm-1 sample calculates the sample activity.

The results are shown in Figure 4, can produce molten fine circle by plasminogen activation through the rtPAm-1 behind sex change, renaturation and the purifying, through with the conversion of standard tPA, activity reaches 5-6 * 10 ⁵IU/mg reaches the level of international like product.

Embodiment 6 animal experiments

1.rtPAm-1 body in the transformation period

Get three of rabbit, dosage by 100,000 unit/kilograms is injected from ear vein, injection finishes back 5 minutes blood-sample withdrawals for the first time, be added in the tubule of antithrombotics, centrifugal 1500 rev/mins of sedimentation cells, get 5 μ l supernatants and survey the tPA activity, adopted a blood sample and survey the tPA activity, the mean time of the active decline 50% of calculating tPA in later per 5 minutes.Through measuring rtPAm-1 at the intravital transformation period 20-30 of rabbit minute.

2. abnormal toxicity test:

Undertaken by tail vein injection and two test group of abdominal injection, by the injection of per kilogram of body weight 50,000 tPA of unit dosage, 20 of each sample injections are that contrast is rented with 20 injection stroke-physiological saline solution in addition, observe continuously 7 days.The mouse of two test group of result is all strong depositing in 7 days, no abnormal reaction, body weight gain is movable normal with feed.

SEQUENCE?LISTING

＜110〉Wuhan University Wuhan terrestrial life Engineering Co., Ltd

＜120〉a kind of plasmid of express recombinant buman tPA and construction process

＜130〉a kind of plasmid of express recombinant buman tPA and construction process

<160>1

<170>PatentIn?version?3.1

<210>1

<211>1083

<212>DNA

<213>Artificial

<400>1

atgggaagat?cttaccaagt?gatctgcaga?gatgaaaaaa?cgcagatgat?ataccagcaa 60

catcagtcat?ggctgcgccc?tgtgctcaga?agcaaccggg?tggaatattg?ctggtgcaac 120

agtggcaggg?cacagtgcca?ctcagtgcct?gtcaaaagtt?gcagcgagcc?aaggtgtttc 180

aacgggggca?cctgccagca?ggccctgtac?ttctcagatt?tcgtgtgcca?gtgccccgaa 240

ggatttgctg?ggaagtgctg?tgaaatagat?accagggcca?cgggtacctg?cggcctgaga 300

cagtacagcc?agcctcagtt?tcgcatcaaa?ggagggctct?tcgccgacat?cgcctcccac 360

ccctggcagg?ctgccatctt?tgccaagcac?gaggagtcgc?ccggagagcg?gttcctgtgc 420

gggggcatac?tcatcagctc?ctgctggatt?ctctctgccg?cccactgctt?ccaggagagg 480

tttccgcccc?accacctgac?ggtgatcttg?ggcagaacat?accgggtggt?ccctggcgag 540

gaggagcaga?aatttgaagt?cgaaaaatac?attgtccata?aggaattcga?tgatgacact 600

tacgacaatg?acattgcgct?gctgcagctg?aaatcggatt?cgtcccgctg?tgcccaggag 660

agcagcgtgg?tccgcactgt?gtgccttccc?ccggcggacc?tgcagctgcc?ggactggacg 720

gagtgtgagc?tctccggcta?cggcaagcat?gaggccttgt?ctcctttcta?ttcggagcgg 780

ctgaaggagg?ctcatgtcag?actgtaccca?tccagccgct?gcacatcaca?acatttactt 840

aacagaacag?tcaccgacaa?catgctgtgt?gctggagaca?ctcggagcgg?cgggccccag 900

gcaaacttgc?acgacgcctg?ccagggcgat?tcgggaggcc?ccctggtgtg?tctgaacgat 960

ggccgcatga?ctttggtggg?catcatcagc?tggggcctgg?gctgtggaca?gaaggatgtc 1020

ccgggtgtgt?acaccaaggt?taccaactac?ctagactgga?ttcgtgacaa?catgcgaccg 1080

tga 1083

Claims (3)

1, a kind of plasmid of express recombinant buman tPA is characterized in that plasmid pETrtPAm-1, and this plasmid is stored in coli strain DH5 α, and DH5 α/pETrtPAm-1 deposit number is CCTCC M205111.

2. the plasmid of a kind of express recombinant buman tPA according to claim 1 is characterized in that: plasmid pETrtPAm-1 contains a kind of recombination mutation buman tPA gene, and it has the nucleotide sequence shown in the SEQ ID NO.1.

3. construction process that is used to realize the described plasmid of claim 1, it comprises the following steps:

The FE fragment of A.tPA gene and the segmental pcr amplification of P:

Design two pairs of primers:

Primer 1:GAATTCGGATCCATGGGAAGATCTTACCAAGTGATC;

Primer 2: GTCGACGGTACCCGTGGCCCTGGTATC;

Primer 3:GTCGACGGTACCTGCGGCCTGAGACAG;

Primer 4:AGATCTAAGCTTCTCGAGTCACGGTCGCATGTTGTC;

With buman tPA cDNA is template, uses PCR method, amplifies the FE fragment of tPA gene with primer 1 and 2, with primer 3 and 4 amplification P fragments;

B. obtain Recomposed tPA gene:

With restriction enzyme BamHI and KpnI cutting FE fragment, with restriction endonuclease KpnI and HindIII cutting P fragment, with restriction endonuclease BamHI and HindIII cutting pQE30 plasmid, carrying out three fragments with the T4 ligase enzyme connects, construction recombination plasmid pQErtPAm-1, on contain Recomposed tPA gene, by F, E, the P district of natural tPA gene forming, do not contain K1 and K2 district, have Kozak sequence C CATGG at the initiation codon place;

C. obtain recombination mutation tPA gene:

Design a pair of mutagenic primer:

Primer 5:CTCTCCGGGCGACTCCTCGTGCTTGGCAAAGATGGC

Primer 6:GCCATCTTTGCCAAGCACGAGGAGTCGCCCGGAGAG

Adopt the PCR fixed-point mutation method, on Recomposed tPA gene, the R298 in the original tPA molecule, R299 coding place are all sported the E coding, obtain recombination mutation tPA gene, i.e. the rtPAm-1 gene;

D. obtain recombinant plasmid pETrtPAm-1:

At first plasmid pET-His is transformed, removes the coding region of 6His on it, design a pair of primer according to the pET-His plasmid sequence:

Primer 7:CGCTCCAGGGATCCGCAGAATTC;

Primer 8:CATGAGCGGGATCCTTCTTAAAGTTAAAC;

Utilize the pET-His plasmid DNA to be template, carry out pcr amplification, then with BamHI and HindIII cutting amplified production, the pET plasmid fragment that obtains transforming, the recombination mutation tPA gene of the 1.1kb that PCR is produced cuts with restriction endonuclease BamHI and HindIII again, connect two fragments with the T4 ligase enzyme, obtain recombinant plasmid pETrtPAm-1.

Images