CN1384200A - Genetically engineered body of farm animal castration gene vaccine (DNA vaccine) - Google Patents
Genetically engineered body of farm animal castration gene vaccine (DNA vaccine) Download PDFInfo
- Publication number
- CN1384200A CN1384200A CN 02103725 CN02103725A CN1384200A CN 1384200 A CN1384200 A CN 1384200A CN 02103725 CN02103725 CN 02103725 CN 02103725 A CN02103725 A CN 02103725A CN 1384200 A CN1384200 A CN 1384200A
- Authority
- CN
- China
- Prior art keywords
- lhrh
- hbs
- gene
- pbs
- plasmid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The present invention belongs to biological hi-tech field. The construction process of farm animal castration gene vaccine includes artificial synthesis of livestock-type LHRH(M) gene and fowl-type LHRH(A) gene and construction of pBS-LHRH plasmid; slicing HBs segment from pWR-HBs plasmid and inserting into pBS-LHRH plasmid to constitute pBS-HBs/LHRH plasmid; and final PCR amplification of HBs/LHRH fusion gene segment from pBS-HBs/LHRH plasmid and inserting it into pcDNA3.1 plasmid to obtain recombinant pcDNA3.1-HBs/LHRH(M) and pcDNA3.1-HBs/LHRH(A) plasmids, which are utilized to convert coliform bacteria to constitute the gene engineering antibody Ecoli-pcDNA3.1-HBs/LHRH(M) and Ecoli-pcDNA3.1-HBs/LHRH(A).
Description
The present invention produces the engineering body that is used for livestock and poultry castration gene vaccine (dna vaccination) for making up, and belongs to the highly sophisticated products of biological high-technology field.
Castration is commonly called as castrating, behind the animal's castration, and behavior docility, efficiency of feed utilization height, fast gaining, meat is good, convenient management.For centuries, take method castration, but the operation castration easily causes wound, infection, causes windfall loss with the surgical removal sexual gland always.It is then more dangerous to be used for sexually matured animal.
Use immunity neutralization (HIN) technology immunity castration and do not have this danger, not only can be used for growing animal, also can be used for sexually matured animal.This method, not only easy and simple to handle, and hemorrhage, the weight loss that infects and stress cause of having avoided that the operation castration causes.
The immunity castration is mainly used luteinising hormone-releasing hormo (LHRH).LHRH is a kind of 10 peptide hormones of being made up of 10 amino acid, it is a kind of high-order hormone of regulating, it is secreted that it regulates the maincenter hypothalamus by a high position, act on hypophysis, promote the release of lutropin (LH) and follicle stimulating hormone (FSH), the latter then acts on the animal sexual gland, impels sexual organ development's maturation, induction of ovulation and spermatogenesis.
In order to make full use of the LHRH biological activity, people have synthesized a lot of LHRH analogues, and some is the high reactivity analogue, is mainly used in induction of ovulation.Some flying up and down property analogue can be competitive and the LHRH receptors bind of pituicyte, thereby suppress the effect of endogenous LHRH, and blocking-up LH and FSH discharge, and suppress ovulation.But in view of the characteristics of hormonal action, a large amount of long-term prescriptions will bring bad side effect, need not so how to have abandoned.
What replace it is the HIN technology of anti-LHRH.LHRH by in the antibody and after, the synthetic of hypophysis LH and FSH and secretion are descended, thereby the growth of inhibition organ finally causes most atrophy, reaches immune castration purpose.See Fig. 1.This technology has the following advantages: 1. a shot can be kept the long period effectively; 2. regulate the release of endogenous hormone, need not to continue medication, the possibility of side effect does not take place, also do not cause hormone residues; 3. concerning sexually matured animal, have reversibility, immunizing power can be recovered reproductive performance and sexual function after disappearing; 4. easy to use, expense is cheap, is suitable for applying.
Since the eighties in 20th century, used the existing report of research of the multiple animal of LHRH synthetic peptide vaccine active immunity.One of inventor Du Nianxing was taught in the later stage eighties, directed study to give birth to carry out castration vaccine research, and being Liu Gong equality the earliest is covalently attached to the LHRH of synthetic on the bovine serum albumin, makes synthetic peptide vaccine, exempts from order to immune 2 monthly age public affairs.Immunity afunction as a result, testicular atrophy, the sex change of androgone bubble sample, no spermatogenesis in the production of sperm pipe; Anti-LHRH antibody significantly raises, and testosterone levels descends.Also can make LH and testosterone levels reduce to minimum level with the passive epidemic disease of anti-LHRH antibody.The existing LHRH synthetic peptide vaccine of foreign country is sold, but is mainly used in the mankind, treatment prostate cancer, hyperplasia of prostate and prostatomegaly.Because of its production cost height, price is very expensive, can't use on the animal doctor.
In order to reduce the seedling cost, again further the research poultry with and fowl with two kinds of castration recombinant vaccines.And the screening and the evaluation work of the recombinant baculovirus of in silkworm baculovirus, expressing have been finished.After the silkworm body surface reached, expression product-HBsAg/LHRH fusion rotein was virus-like particle under Electronic Speculum, have good immunogenicity.
But because this vaccine needs to produce with silkworm, be not suitable for large-scale industrial production, and extraction process is loaded down with trivial details, cost cost costliness, thereby fail to be converted into productivity.Continue it, change this HBs/LHRH gene over to escherichia coli expression,, extract difficulty, and abandon also because of expression level is not high.Finally made up again with Trx (TRX) is the LHRH genetic engineering subunit vaccine of carrier.Not only expression level height, and extraction is convenient, low production cost, and immune effect is good.Now apply for pilot scale, might become the castration gene engineering vaccine that first comes into the market.Application for a patent for invention number: 00107831.3.
Because the life science development rapidly, the novel gene vaccine (also claiming dna vaccination) that is described as third generation seedling in recent years causes global attention once emerging.Gene vaccine can continuous expression in zooblast 2~3 months, and constantly secretory immune is former.The reinforced immunological effect.Once immune validity period can reach 5 months.This is the great advantage of gene vaccine.Do not see the report that the animal's castration gene vaccine is arranged at present both at home and abroad as yet.
The purpose of this invention is to provide the engineering body that is used to produce the farm animal castration gene vaccine.Its expression product can be assembled in animal body be the graininess multivalent immunogen former, exposing at particle surface has a plurality of LHRH epi-positions, and its immunogenicity is better than conventional engineering subunit vaccine.And the plasmid of this engineering body can be in zooblast continuous expression 2~3 months, constantly secretory immune is former, a shot can reach the purpose of immune castration.Available fermentative production reclaims thalline, behind the extraction plasmid, can directly join seedling.Technology is simple, is suitable for scale operation.Low production cost, easy to use, no hormone residues, no potential danger danger, security is good.
The engineering body of farm animal castration gene vaccine of the present invention, it is characterized in that: will raise, luteinising hormone-releasing hormo (LHRH) gene of 2 types of fowl inserts respectively after the 223rd codon of people's hbsag gene (HBs), be built into 2 strain HBs/LHRH fusion genes, and with its insert respectively can be in eukaryotic cell the pcDNA3.1 plasmid of continuous expression, the transformed competence colibacillus intestinal bacteria are built into poultry, fowl 2 strain gene engineering body-E.coli-pcDNA3.1-HBs/LHRH (M) and E.coli-pcDNA3.1-HBs/LHRH (A) poultry are used the engineering body of castration gene vaccine
Bacterium classification: bacillus coli
Name: E.coli-pcDNA3.1-HBs/LHRH (M)
Depositary institution: China Committee for Culture Collection of Microorganisms common micro-organisms center
Preservation address: China. Beijing. Zhong Guan-cun .2714 mailbox postcode: 100080
Preserving number: 0711 fowl is used the engineering body of castration gene vaccine
Bacterium classification: bacillus coli
Name: E.coli-pcDNA3.1-HBs/LHRH (A)
Depositary institution: China Committee for Culture Collection of Microorganisms common micro-organisms center
Preservation address: China. Beijing. Zhong Guan-cun .2714 mailbox postcode: 100080
Preserving number: 0710
Its key-gene is the LHRH gene, and it is the little peptide molecule by 10 amino-acid residues, and LHRH chemical constitution and the structure of Mammals (mammal.M) are identical, and the 8th amino acids of bird (avian.A) LHRH is different with Mammals.Its amino acid composition and codon are as follows:
LHRH (M) gene 123456789 10pGlu His Trp Ser Tyr Gly Leu Arg Pro Gly-NH
25 '-CAG CAC TGG TCC TAT GGA CTG CGC CCT GGA-3 '
LHRH (A) gene pGlu His Trp Ser Tyr Gly Leu Glu Pro Gly-NH
25 '-CAG CAC TGG TCC TAT GGA CTG CAG CCT GGA-3 '
The building process of this engineering body is: the structure 1.1 synthetic LHRH genes of 1 pBS-LHRH plasmid
Operation for the ease of gene reaches the chimeric of later and HBs gene, in the LHRH gene of test design, is added with the BamHI restriction enzyme site at 5 ' end, and 3 ' end is added with 2 terminator codons and Hind III restriction enzyme site.Design is as follows:
LHRH (M) gene 5 '-AA
GGATCCTCAGCACTGGTCCTATGGACTGCGCCCTGGA
TAATGAAAGCTTAT-3 '
BamHI3’-TTCCTAGGAGTCGTGACCAGGATACCTGACGCGGGACCT
ATTAC
TTCGAATA-5’
LHRH (A) gene terminator Hind III5 '-AA
GGATCCTCAGCACTGGTCCTATGGACTGCAGCCTGGA
TAATGAAAGCTTAT-3 '
BamHI3’-TTCCTAGGAGTCGTGACCAGGATACCTGACGTCGGACCT
ATTACTTTCGAATA-5’
Terminator Hind III
By above-mentioned design requirements, synthetic L
1, L
2, L
3Article 3, oligonucleotide fragment.L
1Be poultry type (M) and the common normal chain of fowl type (A), L
2Be the minus strand of M type, L
3Minus strand for the A type.It is complementary that 9 bases are arranged between normal chain and the minus strand.M type L1:5 '-AAGGATCCTCAGCACTGGTCCTATGGACTG-3 '
L2 3 '-ATACCTGACGCGGGACCTATTACTTTCGAATA-5 ' A type L1 5 '-AAGGATCCTCAGCACTGGTCCTATGGACTG-3 '
L3 3’-ATACCTGACGTCGGACCTATTACTTTCGAATA-5’
With above-mentioned artificial synthetic oligonucleotide's fragment L1 and L2, behind L1 and L3 annealing, extension, the polishing, LHRH (M) and 2 genes of LHRH (A) of above design.1.2 make up the pBS-LHRH plasmid
Above-mentioned LHRH (M) gene and LHRH (A) gene are used BamHI and HandIII double digestion respectively, reclaim the LHRH gene of band sticky end.Extract the pBS plasmid,, reclaim enzyme and cut product with BamHI and HandIII double digestion, respectively with LHRH (M) with after LHRH (A) gene is connected, obtain 2 strain pBS-LHRH plasmids.With its transformed competence colibacillus intestinal bacteria.Cut evaluation and sequential analysis through enzyme, confirm to successfully construct.See Fig. 2.The structure of 2 pBS-HBs/LHRH plasmids
Extract the pWR13-HBs plasmid, with SacI and BglII double digestion, electrophoresis reclaims the HBs endonuclease bamhi.
With pBS-LHRH (M) and 2 kinds of plasmids of pBS-LHRH (A) of SacI and the above-mentioned structure of BamHI double digestion, electrophoresis reclaims the big fragment of pBS-LHRHs plasmid respectively.
The HBs fragment is connected with pBS-LHRH (A) plasmid fragment with pBS-LHRH (M), forms pBS-HBs/LHRH (M) and 2 recombinant plasmids of pBS-HBs/LHRH (A).
With pBS-HBs/LHRH (M) and 2 recombinant plasmids difference of pBS-HBs/LHRH (A) transformed into escherichia coli DH5a, cut 2 strains reorganization large intestine bar-Ecoli-HBs/LHRH (M) and the Ecoli-HBs/LHRH (A) that screening obtains 2 strain band LHRH and HBs fusion gene through enzyme.
Extract pBS-HBs/LHRH (M) and pBS-HBs/LHRH (A) plasmid, identify with Bgl II, BamHI, HindIII single endonuclease digestion with BamHI and HindIII double digestion, and adhere to specification fully with two deoxidation cessation method sequencing analysis results, show the construction of recombinant plasmid success.See Fig. 5.The structure 3.1 pcr amplification HBs/LHRH fusion genes of 3 pcDNA3.1-HBs/LHRH plasmids synthesize HBs/LHRH fusion gene primer upstream primer
Downstream primer
Extract pBS-HBs/LHRH (M) and pBS-HBs/LHRH (A) plasmid respectively from above-mentioned 2 strain recombination bacillus colis.Primer L0+L1 is a template with pBS-HBs/LHRH (M); L0+L2 is a template with pBS-HBs/LHRH (A), makes PCR respectively, amplifies HBs/LHRH (M) and HBs/LHRH (A) 2 strain fusion genes.3.2 pcDNA3.1-HBs/LHRH plasmid and engineering body make up
Extract the pcDNA3.1 plasmid from E.coli-pcDNA3.1 (+) recombination bacillus coli.With HindIII and EcoRI double digestion, reclaim the plasmid fragment, be connected with the above-mentioned pcr amplification product of same double digestion respectively, obtain pcDNA3.1-HBs/LHRH (M) and pcDNA3.1-HBs/LHRH (A) 2 strain recombinant plasmids; The transformed competence colibacillus intestinal bacteria obtain E.coli-pcDNA3.1-HBs/LHRH (M) and E.coli-pcDNA3.1-HBs/LHRH (A) 2 strain gene engineering bodies.Extract plasmid from this engineering body, be not cut open with the BamHI enzyme person of cutting plasmid, when cutting with HindIII and EcoRI enzyme, plasmid is cut open, with HindIII and EcoRI double digestion person, then visible one is with the little band of 720bp size, is used for 2 strain gene engineering bodies of production castration DNA seedling.Insert 3 of gene ' check order from recombinant plasmid, result and original designly meet fully shows that the 2 strain gene engineering bodies that are used for production castration DNA seedling successfully construct.See Fig. 6.
The engineering body that the present invention is constructed behind bulk fermentation, reclaims thalline, extracts plasmid, can be in order to preparation livestock and poultry castration dna vaccination (gene vaccine).This vaccine is compared with existing like product and is had the following advantages and positively effect:
1. the expression product of this engineering body-HBs/LHRH fusion rotein can be assembled into the virus-like particle (VLP) about big or small 20mm.Exposing a plurality of LHRH epitopes at particle surface, is a kind of multivalence particulate antigen, and its immunogenicity is better than free unit price or divalent, 3 valency antigens.Expression product is designed to the shining point that the multivalence particulate antigen is this research.
2. the expression plasmid in this vaccine can be in host's muscle cell or epithelial cell, continuous expression 2~3 months, and constantly secretory immune is former, the reinforced immunological effect.A shot can reach immune castration purpose.Intracellular recombinant plasmid dna after stopping to express, can be degraded voluntarily, and the unconformability cell DNA does not have hormone and other residues, no potentially dangerous, and security is good.
3. after the engineering body fermentation, reclaim thalline, extract plasmid, can directly join seedling.Production technique is easy, is suitable for large-scale industrial production, and is with low cost.In the production process, toxin expelling is diffusing not malicious, free from environmental pollution.
Be respectively applied for livestock and poultry 4.2 plant the DNA seedling, wide application, in order to substitute the operation castration, market outlook are very broad.Also can squeeze into the international market, gain foreign exchange.
5. the external at present castration vaccine of producing is for synthetic peptide seedling, because of the production cost height, so be mainly used in the treatment human prostata cancer, prostatomegaly and hyperplasia of prostate.Every injection one pin needs 1000 yuan of Renminbi, and every injection in 20 days once, need inject 5 a course of treatment.This vaccine can be applicable to the people fully, and in order to the synthetic peptide vaccine of import outside the subrogate country, a shot can reach the effect of a course of treatment.Concerning sexually matured people, after the immune validity period, i.e. restorability function.
Fig. 1 LHRH immunoregulation principle
Fig. 2 pBS-LHRH construction of recombinant plasmid
The enzyme of Fig. 3 pBS-LHRH recombinant plasmid is cut evaluation
A:pBS-LHRH B:pBS-LHRH+SmaI?C:pBS-LHRH+BamHI
D:pBS-LHRH+Hind?II?E:pBS-LHRH+PstI
The sequential analysis of Fig. 4 pBS-LHRH recombinant plasmid
Fig. 5 pBS-HBs/LHRH construction of recombinant plasmid
Fig. 6 pcDNA3.1-HBs/LHRH construction of recombinant plasmid
Embodiment: 1 synthetic LHRH gene
Operation for the ease of gene reaches the chimeric of later and HBs gene, in the LHRH gene of test design, is added with the BamHI restriction enzyme site at 5 ' end, and 3 ' end is added with 2 terminator codons and Hind III restriction enzyme site.Design is as follows:
LHRH (M) gene 5 '-AA
GGATCCTCAGCACTGGTCCTATGGACTGCGCCCTGGA
TAATGAAAGCTTAT-3 '
BamHI3’-TTCCTAGGAGTCGTGACCAGGATACCTGACGCGGGACCT
ATTAC
TTCGAATA-5’
LHRH (A) gene terminator Hind III5 '-AA
GGATCCTCAGCACTGGTCCTATGGACTGCAGCCTGGA
TAATGAAAGCTTAT-3 '
BamHI3’-TTCCTAGGAGTCGTGACCAGGATACCTGACGTCGGACCT
ATTACTTTCGAATA-5’
Terminator Hind III
Chemosynthesis is that β-cyanoethyl-phosphoramidite is the condensation monomer with the protection nucleosides, after the tetrazole activation, prolongs oligonucleotide chain one by one on solid phase carrier, at 380A type automatic dna synthesizer, presses the following formula L of synthetic LHRH respectively
1, L
2And L
3The oligonucleotide fragment of 3 30 bases.To be synthesized to desired length, take off carrier, add strong aqua.Put 50~55 ℃ of processing and spend the night, can obtain oligo DNA fragment crude product.Behind the PAGE electrophoresis, obtain pure product.On Sephadex G-25 post, desalt then, behind the dehydrated alcohol concentrating and precipitating, be dissolved in respectively in TM (0.5mol/L Tris-HCl, the 0.1mol/L MgCl2) damping fluid of a certain amount of pH8.0 with the redistilled water wash-out.Promptly get L1, L2 and L3.Wherein L1 is M, the common normal chain of A two types, and L2 is the minus strand type of M type, and L3 is the minus strand type of A.L1 and L2, it is complementary that 9 bases are arranged between L1 and the L3. behind annealing, extension, the polishing, poultry with LHRH (M) and fowl usefulness LHRH (A) gene.Poultry is used L1:5 '-AAGGATCCTCAGCACTGGTCCTATGGACTG-3 '
L2 3 '-ATACCTGACGCGGGACCTATTACTTTCGAATA-5 ' fowl is used L1 5 '-AAGGATCCTCAGCACTGGTCCTATGGACTG-3 '
L3 3’-ATACCTGACGTCGGACCTATTACTTTCGAATA-5’
Respectively L1, L2 and L1, L3 are annealed according to a conventional method.Earlier by " method of introducing on the molecular cloning experiment guide " preparation 10 * dsDNA building-up reactions damping fluid, then by laxative remedy preparation reaction solution:
Dna fragmentation 50 μ l after the annealing
10 * dsDNA building-up reactions damping fluid, 10 μ l
10mmol/LdNTP 10μl
Sterilization ultrapure water 20 μ l
Archaeal dna polymerase Klenew1 fragment 1.5 μ l
Behind the mixing, put 37 ℃ of water-bath 1.5h, with this dna fragmentation extension, polishing.And then add 5mmol/L NaCl6 μ l, and dehydrated alcohol 300 μ l put in the ice bath and spend the night, and the centrifugal 15min of 12000g gets precipitation, adds 70% ethanol, the 200 μ l of precooling again, mixing, the same method is centrifugal, gets precipitation and is suspended in the TME damping fluid of 20 μ l pH8.0.Promptly obtain the CHRH gene that poultry is used and fowl is used by design requirements.-20 ℃ frozen standby.2 enzymes that make up pBS-LHRH plasmid 2.1 LHRH genes are cut
Poultry behind synthetic, the polishing is used (A) LHRH gene with (M) and fowl, uses BamHI and Hand III double digestion respectively, reclaims the LHRH gene of band sticky end, can be directly used in ligation.2.2 the extraction of pBS plasmid, enzyme are cut and are reclaimed
The method that the extraction of plasmid is introduced by " molecular cloning experiment guide " is carried out, with BamHI and Hind III double digestion.Get 10 μ l enzymes and cut product and carry out 1% agarose electrophoresis, reclaim enzyme and cut big fragment, put freezing 10min in the liquid nitrogen, put then in 37 ℃ of water-baths and melt, the centrifugal 10min of 10000r/min draws supernatant, put-20 ℃ frozen standby.2.3 connect
Connect the medicine box specification sheets by DNA and carry out, its reaction system is as follows:
The pET32c double digestion reclaims product 2.5 μ l
Two valency SS Gene Double enzymes cut back to close product 7.8 μ l
DNA connects solution 1 10 μ l
Behind the mixing, put 16 ℃ of reaction 30min after, be pBS-LHRH and can be used for immediately transforming.2.4 the preparation of competent cell
The method of introducing with reference to " molecular cloning experiment guide " prepares the escherichia coli DH5a competent cell.2.5 transform
Get 10 μ l connection product and transform 200 μ l BL21 (DE3) competent cells, the method that concrete operations are introduced with reference to " molecular cloning experiment guide " is carried out.
Get 200 μ l transformed into escherichia coli, coating contains the LB agar plate of Amp 50mg/ml, establishes unconverted competence intestinal bacteria simultaneously and compares (negative control), and the rearmounted 37 ℃ of liquid casees of inoculation are cultivated 18h.2.6 the enzyme of recombinant plasmid is cut evaluation
Insert among site BamHI and the HindIII at the LHRH gene, 2 sites of SamI and PstI are still arranged.After selecting single colony inoculation after the conversion and containing the LB meat intestines substratum enlarged culturing of Amp, extract plasmid, respectively with making agarose electrophoresis behind BamHI, HindIII, SamI and the PstI single endonuclease digestion, SmaI and PstI restriction enzyme site disappear as a result, and BamHI and HindIII still exist, and show to clone successfully.See Fig. 2 and Fig. 3.2.7 the sequential analysis of recombinant plasmid
Through the positive recombinant plasmid that screening obtains, go in the M13 phage with the fragment cloning of BamHI and Hind III double digestion, extract the strand order-checking, the results are shown in Figure 4.The base sequence of clone gene meets fully with CHRH of design (M) and LHRH (A).Show the success of pBS-LHRHs plasmid construction.3 LHRH genes and HBsAg gene fusion and the recovery of the structure 3.1 HBsAg genes of pBS-HBs/LHRHs plasmid
The method of the introduction of reference " molecular cloning experiment guide " is extracted pWR13-HBs plasmid (Xu Wenzhong provides by this group) in a large number, and with SacI and BglII double digestion, electrophoresis reclaims the HBs endonuclease bamhi about 0.7kb.3.2 the enzyme of pBS-LHRHs plasmid is cut, is reclaimed
A large amount of pBS-LHRH (M) and 2 kinds of plasmids of pBS-LHRH (A) that extract above-mentioned structure with SacI and the two enzymes of BamHI, reclaim the big fragment of plasmid by 2.2 method electrophoresis respectively.3.3 connect
By 2.3 methods the HBs fragment is connected with pBS-LHRH (A) plasmid fragment with pBS-LHRH (M), forms pBS-HBs/LHRH (M) and 2 recombinant plasmids of nBS-HBs/LHRH (A).3.4 transform
With above-mentioned 2 plasmids difference transformed into escherichia coli DH5a, cut 2 strain recombination bacillus colis---Ecoli-HBs/LHRH (M) and the Ecoli-HBs/LHRH (A) that screening obtains 2 strain band LHRH and HBs fusion gene by 2.4,2.5,2.6 supervisors through enzyme.3.5 enzyme is cut evaluation
Extract pBS-HBs/LHRH (M) and pBS-HBs/LHRH (A) plasmid respectively, with BglII, BamHI, HindIII single endonuclease digestion with BamHI and HindIII double digestion, the HBs fragment that SacI and BglII downcut, two sticky end can link to each other with the pBS-LHRH sticky end that the BamHI enzyme is cut respectively with SacI.Connect back fusion site BglII and BamHI site and disappear, and the 5 ' end of HBs still has a BamHI site, LHRH gene 3 ' that a Hind III site is arranged.BglII can not cut as a result; BamHI and Hind III single endonuclease digestion can cut plasmid; And when double digestion, the HBs/LHRH fusion gene band of a then visible 720bp.Show the construction of recombinant plasmid success.3.6 sequential analysis
Recombinant plasmid begins to read from 3 ' of gene-end with two deoxidation cessation method order-checkings, reads over the sequence that is fusion gene behind the gene of LHRH, and hepatitis B virus surface antigen gene 3 '-end process transformation has added the BglII joint, made the reading frame of whole gene be:
1234 217 218 219 220 221 222 223 Ser Asp Pro5 '-ATG GAG AAC ACA---ATT TTC TTT TGT CCT TGG GTA
TAC GAT CCT HBsAgGene ... BglII/BamHI 123456789 10CAG CAC TGG TCC TAT GGA CTG CGC CCT GGA
TAA-3 ' LHRH gene ... Stop
The sequencing results meets with it fully.Show that recombinant plasmid pBS-HBs/LHRH (M) and pBS-HBs/LHRH (A) successfully construct, and see Fig. 5.The structure 4.1 synthetic HBs/LHRH fusion gene primers that 4 pcDNA3.1-HBs/LHRH plasmids and castration engineering body make up
Design 2 pairs of HBs/LHRHs fusion gene primers, (L0) is shared for upstream primer, downstream primer L1 HBs/LHRH (A) fusion gene that is used to increase; DL2 HBs/LHRH (A) fusion gene that is used to increase.Design of primers is as follows: upstream primer L0:
Downstream primer
Above-mentioned primer is widely collected biotech company by Shanghai and is synthesized.4.2 extract the pBS-HBs/LHRHs plasmid
From the method for recombination bacillus coli Ecoli-HBs/LHRH (M) and Ecoli-HBs/LHRH (A) reference " molecular cloning guide " introduction, extract pBS-HBs/LHRH (M) and pBS-HBs/LHRH (A) plasmid, be made for the template DNA of PCR.4.3 pcr amplification HBs/LHRHs gene
Get 10 * reaction buffer and (contain 15mmol/L MgCl
2) 3 μ l, 2.5mmol/L dTNP 2ml, TaqDNA polysaccharase 3 μ l (1U), each 1 μ l of upstream primer and downstream primer, template DNA 0.1 μ g adds sterilization distilled water 25 μ l, and mixing in reaction tubes is put the automatic PCR instrument of the GENINS of TECHNIE company.Reaction conditions: 1 circulation of 94 ℃ of sex change 5min; 94 ℃ of sex change 40s, 60 ℃ of renaturation 40s, 72 ℃ are extended 45s, 30 circulations; Last 72 ℃ are extended 10min.Respectively get 10 μ l PCR products with marker after 1.5% agarose electrophoresis, use ethidium bromide staining, under ultraviolet lamp, observe.As seen the band about 730pb.4.4 the extraction of pcDNA3.1 plasmid
With reference to the method that " molecular cloning experiment guide " introduced, carry out with alkaline lysis, with RNA enzymic digestion RNA, remove the RNA enzyme through the extracting of phenol chloroform, the dehydrated alcohol post precipitation adds an amount of TE damping fluid dissolving, promptly obtains the pcDNA3.1 plasmid of purifying.4.5 the enzyme of pcDNA3.1 plasmid is cut, is reclaimed
Above-mentioned plasmid purification reclaims the big fragment after enzyme is cut with Hind III and Eco RI double digestion, reference 2.2 methods.4.6 connect and conversion
Be connected with the pcDNA3.1 plasmid with HBs/LHRH (A) gene with the HBs/LHRH (M) of method shown in 2.4 by 2.3, obtain pcDNA3.1-HBs/LHRH (M) and pcDNA3.1-HBs/LHRH (A) 2 strain recombinant plasmids pcr amplification.And, obtain the engineering body that Ecoli-pcDNA3.1-HBs/LHRH (M) and Ecoli-pcDNA3.1-HBs/LHRH (A) 2 strains are used to produce the castration DNA seedling that poultry usefulness and fowl uses by method transformed competence colibacillus intestinal bacteria shown in 2.5.4.7 the enzyme of recombinant plasmid is cut evaluation
After the expression plasmid pcDNA3.1 that cuts with HBs/LHRH gene fragment behind Hind III and the EcoRI double digestion and same enzyme was connected, Hind III and EcoRI site still kept, and the disappearance of the BamHI site between the two.From above-mentioned 2 strain gene engineering bodies, extract plasmid, respectively with Hind III, EcoRI, BamHI single endonuclease digestion with Hind III and EcoRI double digestion.See Fig. 6.Be not cut open with the BamHI enzyme person of cutting plasmid, when cutting with Hind III and EcoRI enzyme, plasmid is cut open, with Hind III and EcoRI double digestion person, and the little band of a then visible band 720bp size.Show the construction of recombinant plasmid success.4.8 the sequential analysis of recombinant plasmid
From recombinant plasmid, insert 3 ' order-checking of gene.Rich biotech company measures by Shanghai.Result and original designly meet fully, show produce poultry with and fowl successfully construct with the engineering body of 2 strain castration DNA seedlings.See Fig. 6.5 produce and use
After the engineering body bulk fermentation propagation provided by the invention, reclaim recombination bacillus coli, extract plasmid, promptly can be used for preparing the castration gene vaccine.In order to the still rudimentary livestock or poultry of immunity organ, this recombinant plasmid can be in host cell continuous expression HBs/LHRH fusion rotein 2~3 months.Induce to produce LHRH antibody, in and the LHRH activity, suppress the synthetic and secretion of interstitialcellstimulating hormone (ICSH) (LH) and follicle stimulating hormone (FSH), thereby make sexual organ (testis and ovary) growth stop degenerative atrophy.A shot can reach immune castration purpose.The castration of can avoiding performing the operation might cause unsafe factors such as wound infection.Be simple and easy quick, and safety, reliable.
Claims (2)
1. the engineering body of farm animal castration gene vaccine of the present invention (dna vaccination), it is characterized in that: will raise, luteinising hormone-releasing hormo (LHRH) gene of 2 types of fowl inserts respectively after the 223rd codon of people's hbsag gene (HBs), be built into 2 strain HBs/LHRH fusion genes, and with its insert respectively can be in eukaryotic cell the pcDNA3.1 plasmid of continuous expression, the transformed competence colibacillus intestinal bacteria are built into poultry, fowl 2 strain gene engineering body-E.coli-pcDNA3.1-HBs/LHRH (M) and E.coli-pcDNA3.1-HBs/LHRH (A) poultry are used the engineering body of castration gene vaccine
Bacterium classification: bacillus coli
Name: E.coli-pcDNA3.1-HBs/LHRH (M)
Depositary institution: China Committee for Culture Collection of Microorganisms common micro-organisms center
Preservation address: China. Beijing. Zhong Guan-cun .2714 mailbox postcode: 100080
Preserving number: 0711 fowl is used the engineering body of castration gene vaccine
Bacterium classification: bacillus coli
Name: E.coli-pcDNA3.1-HBs/LHRH (A)
Depositary institution: China Committee for Culture Collection of Microorganisms common micro-organisms center
Preservation address: China. Beijing. Zhong Guan-cun .2714 mailbox postcode: 100080
Preserving number: 0710
2. engineering body according to claim 1; it is characterized in that being formed by following method structure: the structure of 2.1 pBS-CHRH plasmids is synthetic poultry type and 2 CHRH genes of fowl type at first, and the general formula of design is: 5 '-assurance property base-restriction endonuclease-protection framework base-LHRH gene-terminator-restriction endonuclease-protectiveness base-3 ' specific design is as follows:
LHRH (M) gene 5 '-AA
GGATCCTCAGCACTGGTCCTATGGACTGCGCCCTGGA
TAATGAAAGCTTAT-3 '
BamHI3′-TTCCTAGGAGTCGTGACCAGGATACCTGACGCGGGACCT
ATTAC
TTCGAATA-5′
Terminator HindIII
LHRH (A) gene 5 '-AA
GGATCCTCAGCACTGGTCCTATGGACTGCAGCCTGGA
TAATGAAAGCTTAT-3 '
BamHI3′-TTCCTAGGAGTCGTGACCAGGATACCTGACGTCGGACCTATTAC
TTTCGAATA-5′
Terminator HindIII
The LHRH gene of above-mentioned 2 types is inserted the pBS expression plasmid respectively, be built into poultry type and fowl type pBS-LHRH plasmid respectively, the transformed competence colibacillus intestinal bacteria cut evaluation and sequential analysis through enzyme, confirm to successfully construct; 2.2 recombination bacillus coli-E.coli-pWR13-HBs that the pBS-HBS/LHRH plasmid construction is preserved from this problem, extract the pWR13-HBs plasmid, enzyme is cut, reclaim the HBs fragment, insert above-mentioned structure pBS-LHRH (M) and 2 kinds of plasmids of pBS-LHRH (A), be built into pBS-HBs/LHRH (M) and 2 recombinant plasmids of pBS-HBs/LHRH (A), difference transformed into escherichia coli DH5a, obtain 2 strain recombination bacillus coli-Ecoli-HBs/LHRH (M) and Ecoli-HBs/LHRH (A), cut evaluation and sequential analysis through enzyme, the result adheres to specification fully, shows the construction of recombinant plasmid success; 2.3 the structure of pcDNA3.1-HBs/LHRH plasmid and engineering body according to claim 1 gene design general formula, synthesizes L
0, L
1And L
2Article 3, primer: upstream primer
Downstream primer
L
0And L
1Can amplify poultry type HBs/LHRH fusion gene; L
0And L
2Can amplify fowl type HBs/LHRH fusion gene;
With the pBS-HBs/LHRH plasmid is template, uses L respectively
0And L
1And L
0And L
2Do primer, go out the HBs/LHRH fusion gene of poultry, 2 types of fowl with pcr amplification, insert the pcDNA3.1 plasmid, obtain pBS-HBs/LHRH (M) and pBS-HBs/LHRH (A) 2 strain recombinant plasmids, the transformed competence colibacillus intestinal bacteria, cut evaluation and sequential analysis through enzyme, confirm that engineering body-E.coli-pcDNA3.1-HBs/SS of the present invention successfully constructs.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 02103725 CN1384200A (en) | 2002-03-13 | 2002-03-13 | Genetically engineered body of farm animal castration gene vaccine (DNA vaccine) |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 02103725 CN1384200A (en) | 2002-03-13 | 2002-03-13 | Genetically engineered body of farm animal castration gene vaccine (DNA vaccine) |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1384200A true CN1384200A (en) | 2002-12-11 |
Family
ID=4739875
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 02103725 Pending CN1384200A (en) | 2002-03-13 | 2002-03-13 | Genetically engineered body of farm animal castration gene vaccine (DNA vaccine) |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1384200A (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7951913B2 (en) | 2006-06-02 | 2011-05-31 | Biotika A.S. | Method of polymyxin B recovery from fermentation broth |
US8119371B2 (en) | 2006-06-15 | 2012-02-21 | Biotika A.S. | Process for the preparation of polymyxin B employing (PAENI) Bacillus polymyxa |
-
2002
- 2002-03-13 CN CN 02103725 patent/CN1384200A/en active Pending
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7951913B2 (en) | 2006-06-02 | 2011-05-31 | Biotika A.S. | Method of polymyxin B recovery from fermentation broth |
US8119371B2 (en) | 2006-06-15 | 2012-02-21 | Biotika A.S. | Process for the preparation of polymyxin B employing (PAENI) Bacillus polymyxa |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109321535A (en) | A kind of heat-staple newcastle disease virus attenuated vaccine Candidate Strain | |
CN103555762B (en) | AFP and GM-CSF dual-gene co-expression recombinant vector as well as preparation method and application of recombinant vector | |
CN101063142A (en) | Human papilloma virus 16 type DNA vaccine and gene adjuvant and its application | |
CN106399266A (en) | Recombinant baculovirus for expressing dog serum albumin fused interferon gamma and application of recombinant baculovirus | |
CN1384200A (en) | Genetically engineered body of farm animal castration gene vaccine (DNA vaccine) | |
CN109705223B (en) | Recombinant subunit vaccine of orf virus and production method thereof | |
CN1381583A (en) | Human papillomavirus E6/E7 fusion gene and its efficient expression carrier and fusion protein vaccine | |
CN107033245A (en) | The preparation method and purposes of the polyclonal antibodies of one breeder caspase 1 | |
CN102676534B (en) | Method for preparing thymosin polypeptide by using interin | |
CN1255542C (en) | Constructing genetic engineering Vaccine of adhesin of confluent Helicobacter pylor and preparation method | |
CN102321180B (en) | Polypeptide fragment composition and application in preparation of porcine reproductive and respiratory syndrome vaccine thereof | |
CN111925449A (en) | Recombinant CHO cell strain expressing chicken VP2 and chicken GAL-1 fusion protein and construction method and application thereof | |
CN111471657A (en) | Construction method of PRV gE/gI double-gene deletion strain for expressing ASFV P30 protein | |
CN1207389C (en) | Genetically engineered body of somatostatin gene vaccine (DNA vaccine) | |
CN104761631A (en) | P-nitrophenylalanine multi-locus introduction human tumor necrosis factor-alpha | |
CN102071238B (en) | Process for fermenting maltose binding protein-gonadotropin releasing hormone hexamer | |
CN1310677C (en) | Method of preparing rabies live carrier vaccine using gland virus carrier expression rabies virus bigene | |
CN104611341A (en) | Penaeus monodon heat shock protein 10 gene and encoded protein thereof | |
CN100523172C (en) | Gene engineering bacteria of high efficiency expression of human alpha 1-thymulin and its construction method and use | |
CN1373221A (en) | Recombinant Chinese interleukin-12 with bio-activity and its preparing process | |
CN1229437A (en) | Polypeptides useful as immunotherapeutic agent and method of polypeptides preparation | |
CN1232643C (en) | Nucleic acid vaccine | |
CN1372000A (en) | Gene engineering body for somatostatin gene engineering subunit seedling | |
CN1313489C (en) | GP thymosin alpha 1 and preparation method | |
CN107522776B (en) | Antigen polypeptide and coding gene and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C12 | Rejection of a patent application after its publication | ||
RJ01 | Rejection of invention patent application after publication |