CN1229437A - Polypeptides useful as immunotherapeutic agent and method of polypeptides preparation - Google Patents

Abstract

Fusion polypeptides and aggregates of polypeptides comprising papillomavirus-derived antigens, and compositions thereof and their use e. g. with adjuvants for immunogenic and vaccine purposes in eliciting e. g. HPV-specific immune responses. the polypeptides can be purified to result in aggregates which when in solution or dispersion can pass through a sterilisation filter, and in amorphous aggregates. An example of such a polypeptide is a fusion protein of human papillomavirus proteins L2 and E7.

Description

Be used as the polypeptide and the method for preparing polypeptide of immunotherapeutic agent

Technical field that the present invention belongs to

The present invention relates to HPV polypeptide formulations and they in prevention that chronic HPV infects or the application in the treatment.Prepare these method for compositions, comprise purified technology of protein, with in order to improve and to reach the genetically engineered that the high level expression of specified protein in allos cell (especially intestinal bacteria bacterial cell) utilizes the nucleotide sequence of recombinant DNA technology, generally all can be applicable to the protein production field, and form another aspect of the present invention.

Background of invention and prior art

Human papillomavirus (HPV) is the reason that causes several optimum and malignant lesion, and they are bred in people's skin and mucous membrane.They are a kind of hereditary diversified dna virus groups that infect epithelium and can cause a series of different human diseasess.Based on the cross hybridization degree between their genome, identified above 60 kinds of dissimilar HPV, in the middle of them, the main and dissimilar disease-related of different subgroups.For example, HPV such as 1 type, 2 types is relevant with the cutaneous wart of hand and foot.HPV5 is relevant with the epidermodysplasia verruciformis of rare disorder with 8.

About 20 kinds of HPV types infect the sexual organ mucous membrane, and can be divided into two hypotypes according to the seriousness with their diseases associated.First group comprises virus, as HPV-6 and the HPV-11 relevant with the optimum condyloma of majority (wart) (comprising Genital warts).Second group comprise relevant with the uterine cervix verruca plana and in causing the vicious transformation of cervical cancer related HPV16,18,31,33 and 45 (zur Hausen, cancer research, 49 (1989) pp 4677-4681).

With HPV diseases associated feature generally be the optimum propagation (wart) of the epithelium that directly causes by virus infection.This virus can infect the basilar cell of the non-keratinocyteization of epithelium, but can not finish its replicative cycle in these cells.These viral genetic expressions only limit to a series of early proteins, and these albumen mass-energy are impelled infected cell proliferation, produce the wart of characteristic feature.But on the upper strata of wart, infected cell begins to carry out the end differentiation to their sail angle materialization state, and this differentiation is enough to make virus finish its replicative cycle by the generation of virus protein and final neovirion.

These damages though be fertile, are in low dangerous pernicious transition state, and in most of the cases, it is optimum that wart keeps.Yet in some cases, after the several years, the cell that carries the HPV sequence may become tumorigenicity.In this case, seem that virus genomic major part may lose, and genomic remainder (comprising viral E6 and E7 gene usually) is incorporated in the genome.Yet, main relevant to this development of pernicious cancer with narrow HPV type (being HPV16,18,31,33,35,45), and relevant with specific tissue (as uterine cervix and penis).

Know that immunity system can work in control HPV infects.As everyone knows, the cutaneous wart that HPV causes and with the generation of HPV diseases associated, in accepting the patient of immunosuppressant therapy, increase, this shows that virus infection can be controlled by immunologic mechanism in many cases.About other evidence of the ability of immunity system control infection, the research of disappearing from spontaneous wart.Common observation is, has in the individuality of Genital warts at some, and boss so disappears.Once had the people to study the wart that disappears like this on histology, research discloses a large amount of inflows of T lymphocyte in damage.It is generally acknowledged and disappear by immune-mediated.

It is generally acknowledged that the effective immune response that HPV is infected mainly is cell-mediated, because disease can continue in the individuality of the serum antibody with anti-HPV.In addition, the spontaneous regression of known wart usually with lymphocytic infiltration, itch, affected part reddens and represent cell-mediated immunoreactive other symptom.HPV infects in the patient of the cellular immunity with weakening also ubiquity, this moment virus disease continue to have shown bad immunosurveillance.

To in the animal model of inoculation with the research of disappearing of papilloma virus diseases associated, also be supported in the notion of the immune effector of resist the disease aspect.For example, vaccination has been in case the ox that bovine papilloma virus (BPV) infects has produced is not the antibody of neutrality according to reports, utilizes the inoculation of the fused protein that comprises BPV L2 sequence and non-HPV sequence (beta galactosidase enzyme) also to demonstrate and produced prevention and result of treatment in these animals.(referring to the WO 93/00436 of Cancer Research CampaignTechnilogy Limited:Jarrett etc. and Jarrett etc., virusology, 184 (1991) pp 33-42).

For example, the application of HPV protein (as L1 and L2) in vaccine production can be from WO93/02184 (University of Queensland and CLS company limited: I Frazer etc.: learn papillomavirus vaccine).Other HPV protein has been described and has been applied in the immunodiagnostics, as WO 91/18294 (Medscand AB:J Dillner etc.: the synthetic peptide that is used for the various human papillomaviruss of diagnostic immunoassay) and EP 0 375 555 (Medgenix:G De Martynoff etc.: peptide, anti-they antibody and the dosage of detection method and papilloma virus) in describe.

EP 0 456 197 (1991) (Behringwerke:C Bleul etc.) discloses the peptide with one or more serum reactivity epi-positions, and this peptide has the sequencing row really from HPV18 protein El, E6 and E7.EP 0 451 550 (1991) (Behringwerke:M Mueller etc.) discloses the peptide with one or more serum reactivity epi-positions, and this peptide has the sequencing row really from HPV16 protein E4, E6, E7 or L1.These open parts are for the shaker test purpose, the vaccine application of also having touched upon.

WO 93/00436 (cancer research Motion Technology, WFH Jarrett etc.) discloses hpv protein and the fragment relevant with L2 protein, and L2 protein wherein is used for the prevention and the treatment of papilloma virus tumour, the proteinic preparation of the E7 that also touched upon.

(immunology company limited: MEG Boursnell etc.) disclose as HPV16 that inserts the fusion gene in the recombinant vaccinia virus vector and the gene order of HPV18 E6 and E7, this gene order produces antigenic expression in vivo to WO 92/16636 after using live vector.

WO 92/05248 (Bristol-Myers Squibb:EK Thomas etc.) has proposed to suppress and treat the material of human papilloma virus infection and cell transformation, the reconstitution cell (comprising virus vector) of having touched upon, this cell comprises the gene of encoded peptide (corresponding essentially to the zone or the proteinic one or more zones of HPV of E6 and/or E7 gene product or chimeric peptide compound).

CP Crum etc. (virusology, 178 (1990) pp 238-246) have described the expression of sequence fragment of fusion of HPV-16 L1 and E4 and protein and Freund's complete adjuvant immune rabbit and have made and be used for diagnosis or the sero-fast application of other test objective.

Brief summary of the invention and description

The invention provides the aggregate of fusion polypeptide and polypeptide (having the following papilloma virus deutero-antigen of more specifically describing), and composition and they are in the application that (causes the papilloma virus specific immune response) aspect immunogenicity and the vaccine.

As described below, production, processing and the purifying method of polypeptide and composition also are provided.

According to the present invention, polypeptide is provided and has comprised the peptide composition of the antigenic determinant of hpv protein, this peptide composition is state of aggregation (when in solution or dispersion can by the sterilization filter) or unbodied state of aggregation.

The present invention also provides in conjunction with the antigenic fusion polypeptide of papilloma virus deutero-, for example this antigen derives from every kind of at least two kinds of different hpv proteins, for example this protein comprises the proteinic antigenic determinant of (a) at least a papilloma virus L2, with (b) at least a antigenic determinant that is selected from the L2 hpv protein of E1, E2, E4, E5, E6 and E7 hpv protein and the papillomavirus type different with (a).Thereby, comprise with this other fusion polypeptide that provides and to derive from least two kinds the antigenic determinant that is selected from E1, E2, E4, E5, E6 and E7 hpv protein, for example, wherein said protein source is in different papillomavirus types.

Particularly preferred polypeptide and composition thereof comprise the antigenic determinant of human papilloma virus poisonous protein (as 6,11,16,18 types of HPV).The proteinic antigenic determinant that derives from other HPV type and non-human animal's papilloma virus also can obtain making and using.

In more detail, for example, the invention provides the polypeptide that comprises every kind the antigenic determinant that derives from least two kinds of different HPV protein.About the present invention for example, complete sequence that can be by relevant hpv protein or describe and provide the antigenic determinant of hpv protein by required subsequence, subsequence wherein for example comprises the sequence fragment of at least 25% (for example at least 50% or 75%) of relevant proteinic complete sequence, for example N-end or C-end sequence fragment.Sequence can derive from clinical papilloma virus isolate or disclosed sequence or its mutein.

The HPV protein that its antigenic determinant can form the part of this fusion polypeptide can be selected from for example L1, L2, E1, E2, E4, E5, E6 and E7 protein.For example (people) papillomavirus type HPV6,11,16 and 18, and the protein that derives from other human or animal's papillomavirus type can be utilized.Thereby the antigenic determinant of at least two kinds of hpv proteins can be for example L2 and another, and/or E7 and another.

In concrete example, polypeptide can comprise at least one antigenic determinant, and this antigenic determinant derives from every kind of at least two kinds of different hpv proteins, and derives from identical or different papillomavirus types.For example, at least a protein can be selected from L1 or L2, and/or at least a protein can be selected from E1, E2, E4, E5, E6 and E7.

In concrete example, the invention provides a peptide species, this polypeptide comprises a proteinic antigenic determinant of HPV L2 and the proteinic antigenic determinant of HPV E7, suitably comprise for example L2 and/or the E7 protein of the complete length basically of HPV, or antigen fragment or its mutein.

The L2 and the proteinic fused protein of E7 that comprise HPV can comprise at least 50% sequence fragment of every kind complete sequence of L2 protein and E7 protein, as the complete basically sequence of L2 and E7: also selectively comprise the proteinic sequence of L1.

Polypeptide can also comprise the proteinic antigenic determinant of other HPV, perhaps with other HPV protein or protein fragments (as L1 or another member or the proteinic L of coding papilloma virus or other member of E series) mixture or aggregation.

Polypeptide can comprise by L2 and E7 fusion and form, and perhaps merges the single protein of forming by L2, E7 and L1.In addition, polypeptide can comprise and L1 protein (being used for prevention or therepic use) bonded L2-E7 syzygy.

Polypeptide can comprise fusion molecule, the single polypeptide that perhaps can derive from coupling or flock together.The solubility of polypeptide or solubilized form belong within the scope of the present invention.

In some embodiments, can (for example pass through standard technique) in a manner known in the art and come the coupling polypeptide by chemically crosslinked, said standard technique for example comprise with the tyrosine residues that exposes or with the carboxyl covalent attachment of epsilon-amino or the aspartic acid and the glutaminic acid residue of lysine residue.Yet, embodiment preferred be every kind of fused protein all result from polynucleotide sequence (aminoacid sequence of first kind of hpv protein of its a part of coding partly or entirely, and the aminoacid sequence of second kind of hpv protein of another part coding partly or entirely) expression in recombinant host cell.

Especially, for example, the invention provides a kind of polypeptide that comprises every kind the antigenic determinant that derives from least two kinds of different hpv proteins, its form can be by as the aperture being the state of aggregation of the sterilization filter of 0.16-0.22 micron (for example 0.2 micron) in solution or dispersion the time.

Can see, for example, the invention provides a peptide species, this polypeptide has comprised an antigenic determinant of every kind that derives from least two kinds of different hpv proteins (for example at least a other protein among L2 or L1 and L1, L2, E1, E2, E4, E6 and the E7), and its form is can be by as the heavy state of aggregation of aperture at the sterilization filter of 0.16-0.22 micron (for example 0.2 micron) in solution or dispersion the time.

For example can or reduce denaturation and produce the preparation of suitable form by sex change, for example along with then can be the reunion collection of the polypeptide of fused protein or other hpv protein (its in recombinant host cell with the inclusion body formal representation, as single hpv protein).This form can provide a kind of advantage, i.e. its relatively easy purifying is as vaccine.

The selective aggregation attitude preparation of polypeptide needs not to be filtrable and sterilizes them, and can prepare and purifying with Aseptic technique.

For example, state of aggregation described herein or heavy state of aggregation polypeptide can have about 100,000 daltonian quality, and for example 160,000-10,000,000 dalton.The dimeric molecular weight of L2E7 can be about 130,000.For example, this aggregate can have the diameter that is about 4-50nm (for example 10-15nm) under electron microscope.

An example of the polypeptide that the present invention's (will describe in detail in the following example) is provided comprises a kind of L2E7 fusion polypeptide of heavy state of aggregation, this fusion polypeptide contains has an appointment 500,000 daltonian aggregate, the diameter of this aggregate under electron microscope is about 10-15 or 15-20nm, and each aggregate has about 7-10 (for example about 8) bar L2E7 fusion polypeptide chain.In general, this product can be that each aggregate particle has about 2 to 200 (for example 5-50) bar chain.And the preparation of aggregate can be included in the particulate of the certain granules size that has in the composition.

For example, as (for example from urea, the sex change of the fusion polypeptide about 8M urea) and reduction preparation and according to appointment the 10mM dithiothreitol (DTT) (be preferably and be low to moderate about 0.1mM or still less, for example in the collection product of meeting again for about 0.04mM or still less) the sulfydryl reductive agent in slowly or little by little remove urea and sulfydryl reductive agent (general dithiothreitol (DTT) for example, or other acceptable sulfydryl reductive agent, as gsh) the result, can obtain suitable heavy aggregation.For example, this progressive removal can be realized by column chromatography method as described below.For example, can obtain the sex change and the reduction preparation of fusion polypeptide by dissolving originally insoluble inclusion body (in intestinal bacteria T7 system, producing) by polypeptide expression with urea and sulfydryl reductive agent.

The solubility of this state of aggregation or dispersibility product usually are unbodied, can lack L1 protein, also be different from addition based on the papilloma virus L1 protein viroid particulate of (comprising other hpv protein sometimes), it is reported that wherein papilloma virus L1 protein results from the expression of HPV gene (comprising L1) in system's (as recombinant baculovirus in insect cell or yeast cell).For example, also do not disclose these viroid particles and live through dissolving sex change and sulfydryl reduction and reunion collection subsequently.

The polypeptide of more than touching upon is suitable to be prepared with recombinant DNA technology.Therefore, the present invention also provides the nucleic acid of coding aforementioned polypeptides, integrates the clone and the expression vector of they and they part, and also can be with the host cell of their transfection of protein expression and transduction in conjunction with this nucleic acid.In a preferred example, nucleic acid comprises a kind of fusion gene, and this gene for example comprises L2 and the E7 gene of separating from the chorista of the HPV-6 that derives from clinical Genital warts sample.

Preferably, polypeptide described above prepares by expression of nucleic acids with recombinant DNA technology in protokaryon or eucaryon host.

Specifically, with being suitable for any auxiliary sequencel of in selected system, expressing, the nucleic acid of the required polypeptide of coding mixed in the suitable carriers system and as suitable open reading frame.Use the carrier transformed host cell.Then, cultivate transformed host cells, and separate required polypeptide, as example given below from culture or from supernatant liquor or from cell.Above-mentioned carrier and transformed host cells form another aspect of the present invention.

Measure by polypeptide expression provided by the invention in yeast and baculovirus expression system, the someone reported that this system can carry out HPV deutero-expression of gene in the past.Find that also the developed by molecule that obtains complete length in both cases all is possible, but its expression level is low sometimes.In order to make the expression level optimization, preferably utilize prokaryotic hosts expression system (especially intestinal bacteria T7 system) at present, rather than utilize two kinds of eukaryotic systems of checking (yeast or baculovirus).

Immunogenic polypeptide that this paper provided and vaccine composition are useful in producing the HPV specific immune response, for example are used as the vaccine of prevention or the treatment symptom relevant with papilloma virus.This immunogen immunity-treatment or the vaccine of treatment and papilloma virus diseases associated (for example be applied to prevent or) can be used to produce immune response, for example with can in infected patient, mediate the relevant reaction of the cellular immunization that disappears that chronic HPV infects, said chronic HPV infects and comprises Genital warts when infecting based on 6 and/or 11 type HPV (especially when product and) or endocervical epithelium knurl (especially when product with infection during based on 16 and/or 18 type HPV).For example by utilizing suitable adjuvant, such immune response can be directed to the T-cell, for example the CD4+ cell.

Thereby the present invention also provides and has been used to prevent or treats that HPV infects or the method for relevant with it damage, and this method comprises the polypeptide described herein of using significant quantity to the patient.

The vaccine preparation that comprises the polypeptide of discussing based on this paper by embodiment provided by the invention, according to specificity, this vaccine preparation have a mind to be used for to produce anti-papilloma virus (especially for example HPV6 and 11 and the papilloma virus of HPV16 and 18 types) immune response, and be used for prevention and treatment people's Genital warts and endocervical epithelium knurl.

Observe the cross reaction between the dissimilar HPV, and according to such cross reaction that can observe, polypeptide that this paper produced and vaccine can be used for causing the useful immune response of anti-papillomavirus type (rather than they derive from type wherein).

The invention provides the immunogenic composition of aforementioned polypeptides, they are suitable for injection uses, and comprises the carrier such as immunological adjuvant.In some preferred example (more specifically describing as following), adjuvant comprises aluminium hydroxide and/or single phosphoric acid lipid A.

Such immunogenic composition (for example being used for people or non-human animal as treatment or vaccine) can comprise a kind of adsorption complex, it (is aluminium hydroxide that this mixture comprises " alum ", be Alhydrogel (TM) or the Rehydrogel (TM) that is used as vaccine adjuvant traditionally usually), should " alum " adsorb available aforementioned polypeptides face thereon.The binary complex that adsorption complex can be made up of alum and polypeptide perhaps can have other composition, for example following MPL (forming for example ternary complex of MPL, alum and polypeptide).

Solubility or gathering polypeptide can directly be used as vaccine, perhaps also can be used as the pharmaceutical composition that also comprises pharmaceutically acceptable carrier, damping fluid, adjuvant or other acceptable material and use.Therefore, the present invention also provides vaccine or pharmaceutical composition, and it comprises and suitable carrier or vehicle bonded aforementioned polypeptides.

This polypeptide can be the poly-and body of an a kind of soluble and monomeric (for example monomer of L2E7) or a peptide species.Preferably, can make polypeptide (as the L2E7 fused protein) by combining with adjuvant or other auxiliary substance (as molecules of immunization stimulus), so that improve its effect as therapeutic antigen, and in the immune response of acceptor patient moderate stimulation preferred type.Useful adjuvant including but not limited to: as the aluminium hydroxide (" alum ") of Alhydrogel (TM) or Rehydrogel (TM) form; As at US 4; 912; 094 (Ribi Immunochem Research:KR Myers and AT Truchot: describe adjuvant based on the lipopolysaccharides of modifying; take off-3-O-acyl group list phosphoric acid lipid A) the middle adjuvant 3D-MPL (3-deacylated tRNA list phosphoric acid lipid A) that describes; it can be as US 4; 912,094 or at specification sheets WO 94/21292 (Smithkline Beecham:P Hauser etc.: equally being applied the vaccine composition that contains 3-O-deacylated tRNA list phosphoric acid lipid A).When alum and MPL obtain using, on the alum and MPL that protein adds after preferably at first being adsorbed to.Also can use trehalose diester (for example trehalose dimycolate); As in specification sheets WO 88/09336 (Cambridge bio-science, CA Kensil etc., saponin adjuvant) and the derivative (as Quil A or QS-21) of the saponin(e described in the WO 93/05789 (Cambridge biotechnology, CA Kensil etc., saponin(e antigen conjugate) and they; As at specification sheets WO 90/03184 (B Morein etc., immunostimulating complex matrix with immunoregulatory activity, comprise lipid and selectable adjuvant) and WO 92/21331 (Kabi PharmaciaAB:B Morein etc. comprise the pharmaceutical carrier of sterol and saponin(e) described in ISCOMS or ISCOM matrix; Perhaps Muramyl dipeptide or cholera toxin B.At this on the one hand, other useful accessory molecule or molecules of immunization stimulus comprise cytokine (as interleukin), and this cytokine includes but not limited to GM-CSF, IL-3, IL-2, IL-12 and IL-7.Can use or be used in combination such adjuvant and/or other auxiliary substance as required separately.

Pharmaceutical composition (as the vaccine that this paper provided) is passable, for example emulsification in acceptable mineral or hydrocarbon ils, said oil includes but not limited to squalene or biodegradable mineral oil, as the oil described at specification sheets WO 91/00106 and WO 91/00107 (SEPPIC:B Brancq etc.: describe injectable heterogeneous emulsion and contain the emulsion carrier of oil-continuous phase); Perhaps can for example be used biodegradable particulate or liposome or nonionogenic tenside vesicle encapsulated by encapsulated.For these technology, can be respectively referring to relevant specification sheets, for example WO 94/27718 (DTO ' Hagan etc., comprise and hold back antigenic particulate and their application in immunization) and WO93/19781 (PCT/GB93/00716) (Bacillus proteus molecular designing: J Alexander etc.: comprise have the vaccine of holding back antigenic nonionogenic tenside vesicle).

Polypeptide can be used for the treatment of or prevent purpose.Approach of using and process include but not limited to the approach and the process of the intramuscular of standard, subcutaneous, intradermal, intravenously, oral or rectum.

Can select the polypeptide amount of application according to prescription and the symptom that will be treated.Usually can expect: dosage is the protein of 1-2000 μ g, is preferably 10-300 μ g (as 10-250 μ g).Be easy to determine the optimal dose in the patient.Can use at certain intervals one or more vaccine doses (referring to, for example embodiment 13).This treatment plan is easy to optimize in the patient.

In addition, the nucleic acid of the said polypeptide of encoding can mix suitable recombinant viral vector, and can introduce in the host organisms (as the people), so that expression of nucleic acids can original position produce polypeptide.Be suitable for by this way example as the virus of the major ingredient of recombinant viral vector and be for example virus of description in WO92/05263 (immunology company limited, SC Inglis etc.) and WO 92/16636 (immunology company limited, MEG Boursnell etc.).

The vaccine that comprises HPV dependency polypeptide as described herein can activate the wide HPV specific immune response of scope.Such immune response can comprise: specific antibody (comprising HPV6 and HPV11 neutralizing antibody), cell-mediated immunity (comprising the specific lymphocytic hyperplasia reaction of HPV6 and HPV11), delayed hypersensitivity, cytotoxic T cell and cytokine produce.

In the process for preparing the suitable carrier of expressing polypeptide of the present invention, the applicant has designed the technology that can improve and realize the high level expression of specific polypeptide in allos cell (especially intestinal bacteria bacterial cell).

Therefore, on the other hand, the invention provides a kind of method that is used to prepare recombinant polypeptide, this method comprises, express nucleic acid sequence in bacterial cell, the polypeptide that this sequence encoding is required, but sudden change has taken place, so that the codon or the codon group that cause transcribing or translate premature termination are replaced by degenerate codon.

Especially, the applicant finds: in colibacillary T7 expression system, the generation of the premature termination of transcribing or translating can (as n wherein be 2 or greater than 2 [TTT] by removing at least a many T sequence _n) and stoped effectively or reduce, for example by with acceptable replacement body, as encode amino acid whose equally [TTC] _nSequence) replaces such sequence, thereby realize the higher output yield of required polypeptide.

In the expression system (as the T7 system) of bacterium, find recombinant polypeptide in cell be insoluble state of aggregation or ' inclusion body ' (Ibs).The applicant has designed a kind of improvement technology that is used to reclaim said recombinant polypeptide.

Therefore, another aspect of the present invention is, the method that reclaims recombinant polypeptide a kind of inclusion body in prokaryotic host cell is provided, said method comprises, cross-flow filtration comprises the suspension with the above-mentioned inclusion body that does not need material (as the fragment of smudge cells), and reclaims recombinant polypeptide from the isolating inclusion body of institute.This technology has net effect: separate other cell debris and the inclusion body that is present in the cell homogenates, wash them simultaneously, thereby provide the purifying with degree.

In the preferred embodiment of this method, the isolating inclusion body of original position dissolving subsequently, and from solution, reclaim polypeptide.The example of solvent comprises the mixture of urea and urea and dithiothreitol (DTT) or other sulfydryl reductive agent, is about 8M-10M as concentration.

Especially, can carry out the cross-flow filtration of the thick suspension of host-derived cell rupture easily, this suspension comprises the required polypeptide expressed that exists with the inclusion body form, this process is divided into two stages in same filtration unit, first stage is to keep in the filter retentate under the non-dissolution conditions and washing required inclusion body, second stage is above-mentioned inclusion body to be contacted and at this lysate (8-10M urea for example with lysate, it selectively has the sulfydryl reductive agent, as dithiothreitol (DTT)) filtrate in collect this inclusion body.That carries out normally removes the collection that desolvates and meet again thereupon.

The specific examples of protein formulation of the present invention comprises fused protein, and this fused protein comprises the L2E7 protein based on HPV-6.This protein is suitable for expressing in Bacillus coli cells, is purified to homogeneity, uses adjuvant (as alum) to prepare then.This preparation is useful in treatment in the Genital warts, and can prepare and become the form of medication that is suitable for carrying out to the acceptor patient parenteral injection.

By embodiment and with reference to accompanying drawing, the present invention will be further described below, accompanying drawing promptly:

Fig. 1 shows the nucleotide sequence of expressing the carrier of HPV L2E7 fused protein according to embodiment of the present invention;

Fig. 1 a and 1b show prior to initiator codon in Fig. 1 sequence and the sequence of following the carrier after terminator codon;

Fig. 2 shows corresponding amino acid sequence: and,

Fig. 3 explanation is used for the protein purification process of the L2E7 fused protein of purifying Fig. 1 and 2 according to embodiment of the present invention.

The applicant has separated some HPV genes, especially derive from HPV-6 virus L1, L2 and E7 gene. As described herein, gene order is used for making up genetic fusant, this gene Fusion is used at protokaryon and eukaryotic system high level expression HPV-6 protein.

For realizing this purpose, made up the expression aforementioned polypeptides (as in Escherichia coli, melting as single The HPV-6 of hop protein matter, L2 and E7) plasmid vector.

From the viral DNA by single clinical isolates (deriving from the wart that infected by HPV-6 organizes) preparation In the sample, by the gene of polymerase chain reaction (PCR) amplification HPV-6 virus. In the allos system, The gene that separates is used for the Gene Fusion box of the protein that construction expression HPV-6 derives.

For improving production process, gene construct is carried out certain modification. Useful especially modification as Lower:

1. introduced targeting sequencing (" pelB targeting sequencing ") at the N of the protein sequence of encoding end, (rather than guide this expression to pericentral siphon so that improve the expression of protein in Bacillus coli cells In).

2. introduced a sequence (" His-Tag ") at the C of the protein sequence of encoding end, so that Can pass through the metal chelate chromatography protein purification.

3. the sequence of thymidine residue is undergone mutation, so that eradicate to participate in transcribing of fusion The sequence of premature termination. This sudden change only affects separately the dna sequence dna of gene construct, and does not affect The sequence of coded protein is because it involves the 3rd position prominent of the sex change in the codon Become.

Construct is measured in in-vitro transcription and translation by the protein ORF. At HPV-6 In the situation of L2E7 fused protein, when the HPV-6 L2E7 Gene Fusion structure that is used in vivoexpression When building body, the protein of complete length (80kD) and all considerable by the protein of brachymemma (70kD) Measure, and this pattern can repeat in vivo. The appearance of the clipped form of target protein is with long one Existence in the HPV-6 L2 sequence of string thymidine (T) residue is relevant. Also identify and comprise 6 thymidines Second rich T district of residue. Utilize change HPV-6 L2 protein DNA sequence still not change Become the oligonucleotides of amino acid sequence, mutagenesis in vitro is carried out in these zones. HPV-6 with sudden change L2E7 genetic fusant subclone enters plasmid expression vector, and this carrier drives phage t7 and starts The expression of sub-cloned sequence (the pET expression system, Novagen). The plasmid construction body that obtains (is specified Be pGW53, select it to be used for expressing HPV-6 L2E7) coding upstream targeting sequencing, pelB, HPV-6 L2E7 ORF ' s and downstream sequence, 6 " in-frame " groups of this downstream sequence coding ammonia Acid residue (His Tag), this residue have the C end of HPV-6 fused protein. Fig. 1-2

Nucleotides and L2E7 that sequence data in Fig. 1 and 2 has disclosed unrestricted condition merge egg Coded amino acid sequence (the bag of the preferred embodiment of white matter (being produced by technology described herein) Draw together the leading and downstream flag sequence in upstream). If need, can omit targeting sequencing and flag sequence (aa 591-601). Fig. 1 a and 1b are presented at the non-coding sequence in the preferred T7 expression vector, This sequence is prior to the initiation codon among Fig. 1 and follow after terminator codon.

Fig. 2 shows the sequence of preferred L2 and E7 fused protein. At 1827 pairs of base-pairs In the dna sequence dna, position 7 to 1812 (comprising terminator codon) coding L2E7 fused protein and Mark. In Fig. 1-2, compare by the amino acid separation sequence with published L2 and E7, The discovery sequence area corresponding with L2 and E7 combines some differences. Difference is following (at first With reference to the amino acid residue in the sequence numbering of this paper Fig. 1-2, then with reference to the correspondence in open sequence Locational (different) amino acid): 105 Gly are Gln in open sequence; 215 Ile are Val; 230 Ile are Val; 373 Glu Asp; 381 Lys are Glu; 386 Asp are Gly; 422 Ile are Leu; 544 Tyr Phe.

In addition, in polynucleotide sequence, find " silence " difference, the amino of namely translating The difference that does not cause any difference in the acid sequence. For the present invention, it is generally acknowledged that these are not Significantly. Because former thereby two kinds of silent mutations producing discussed in this article (from TTTTTT to TTCTTC) be positioned at amino acid position 83-4 and 483-4.

With with open sequence accurately corresponding sequence expression and mix such as combination disclosed herein Fused protein in the thing, have with Fig. 1 and 2 in shown preferred L2E7 fused protein Between the height cross reactivity, and can produce ground of equal value similarly or the exempting from of height cross reactivity The epidemic disease reaction.

The L2E7 fused protein also is functional similar, and this fused protein derives from other The sequence of the clinical isolates of HPV: compare with the sequence that this paper is given, this derive from clinical Other separator of environment, the difference that may list in order, but expected that these differences are for this Bright performance is inapparent. If need, be easy to eliminate and in special clinical isolates, find Any difference, for example by the direct mutagenesis of corresponding cloning vector of preparation thus.

This expression will be inserted according to the gene construct that method described herein obtains in the expression system System is obtaining optimization aspect the high level expression of heterologous protein in Bacillus coli cells . This expression system is based on the Bacillus coli cells growth that reaches remarkable density, and subsequently thin The T7 polymerization Enzyme induced formation of born of the same parents inside, this induces the high level that causes gene construct to transcribe.

In the occlusion body in Bacillus coli cells, protein obtains expressing and accumulation then. Carefully After the born of the same parents results, protein purification is with except the protein that degerms, and is prepared as the protein of dissolving Extract. This protein extract comprises the protein molecule aggregation of HMW, and it is water-soluble It is solubility in the liquid.

Thus obtained protein purification can be used for forming the treatment that is used in particular for treating genital wart The basis of property antigenic product.

The following example that this paper is given and sequence data can illustrate the present invention, but do not have a mind to limit present scope of disclosure.The amplification and the clone of embodiment 1:HPV-6 gene

DNA for the virus of the HPV type in infected tissue is inferred by PRC with the standard primer of HPV-6 at first, and the method for use is based on Snijders etc., and 1990, general virology magazine, the improving one's methods of the method for 71:pp 173-191.

By polymerase chain reaction (PCR) increase from a kind of DNA sample of virus HPV-6L1, L2 and E7 gene, this sample is being easy on the basis of isolated genes, prepares from select the single clinical isolates (H26) as the development foundation of treatment body.The identity of clinical isolates is unimportant, because any common HPV-6 clinical isolates is actually equivalence, even it is not same.Utilize the Taq archaeal dna polymerase to realize initial PCR.The Oligonucleolide primers coding that is used for PCR reaction really with 24 Nucleotide of interested gene order homologous and additional Nucleotide, wherein these oligonucleotide coding restriction enzyme sites or be added into to keep the frame between the final genetic fusant or in last expression construct, to introduce terminator codon.The example of used oligonucleotide is as follows:

JPC08?CAGTGTCGACGGTCTTCGGTGCGCAGATGGGACASEQ?ID?NO1

Be used to increase HPV-7 E7 gene the noncoding strand Oligonucleolide primers and be used for the Sall site of directed cloning.

Derive from the single PCR product of the amplified reaction of L1, L2 and E7 gene, in sequencing reaction, be used as template DNA to produce the consensus sequence of per three genes.Suppose the accurate reflection of the actual dna sequence dna of gene in the DNA extraction thing that total dna sequence dna is a virus, because it is the sequence that results from many individual template molecules.

From HPV-6 viral DNA amplification HPV-6 L2 gene, and form the single product of about 1400bp by PCR.By this product of agarose purifying, and used as the template that is dna sequence analysis, and utilize the consensus sequence of the L2 gene of antisense oligonucleotide primer deposits yields amplification.

With the direct subclone of L2 product of purifying in carrier pGEM-T, to make plasmid pGWl2.Utilization has the Oligonucleolide primers of identical consensus sequence, produces the global DNA sequence of the L2 gene of subclone from the pGW12 template DNA.The dna sequence dna of L2 gene that demonstrates the clone is identical with the dna sequence dna of consensus.By the DNA cloning HPV-6E7 gene of PCR, and become the single product of about 300bp from HPV-6 virus.By this gene product of agarose purifying, and used as the template that is dna sequence analysis, and utilize the consensus sequence of the gene of antisense oligonucleotide primer deposits yields amplification.

The direct subclone of E7 PCR product of purifying is entered carrier pGEM-T, to make plasmid pGW04.Utilization has the Oligonucleolide primers of identical consensus sequence, produces the global DNA sequence of the E7 gene of subclone from the pGW04 template.The sequence of E7 gene that demonstrates the clone is identical with the dna sequence dna of consensus.

By the DNA cloning HPV-6 L1 gene of PCR, and become the single product of about 1500bp from HPV-6 virus.By this gene product of agarose purifying, and used as the template that is dna sequence analysis, and utilize the consensus sequence of the gene of antisense oligonucleotide primer deposits yields amplification.

The direct subclone of L1 PCR product of purifying is entered carrier pGEM-T, to make plasmid pGW-A.Utilization has the Oligonucleolide primers of identical consensus sequence, produces the global DNA sequence of the L1 gene of subclone from the pGW-A template.The sequence of E7 gene that demonstrates the clone is identical with the dna sequence dna of consensus.

The PCR product is by combining by the sepharose purifying and being connected on the pGEM-I carrier DNA with silica substrate.These ligation products are used for the DH5a cell of transformed into escherichia coli.Separate the clone of reorganization, and utilize the method HPV-6 gene that further screening is correct of PCR-based to insert fragment.

Obtain clone's the HPV-6 L2 and the dna sequence dna of E7 gene, and itself and the consensus sequence that directly results from initial PCR product are compared.The clone that its sequence is consistent with consensus sequence is used to make up the recombinant protein expression box.The comparison of embodiment 2:HPV-6 sequence and EMBL database

The sequence of consensus sequence and closely-related HPV type (comprising HPV-11, HPV-16 and HPV-18) and the disclosed HPV-6b sequence that derives from the DNA of European Molecular Bioglogy Laboratory (EMBL) database compare, and derive from the HPV-6 C-type virus C with the gene of guaranteeing to increase.

This relatively is by means of Lasergene Navigator software (DNAStarInc.), uses EditSeq, SeqMan, and Megalign and Protean program are carried out.On dna level and by the aminoacid sequence of the expectation of three genes, compare.

This analysis revealed, the L2 that is increased, L1 and E7 gene derive from the HPV-6 C-type virus C.The result shows, though gene order is a high conservative, but still observes some variations from the sequence of being expected.

Therefore, we think that the construct that is suitable for using in the present invention can make on the DNA basis that derives from the clinical HPV isolate of wild-type.Embodiment 3: the structure of expression cassette

The genes of individuals of assembling L2 and E7 in the following manner is to produce fusion molecule: clone L2 and E7 gene by pcr amplification, hold restriction enzyme sites to introduce new N end and C, and keep the integrity of protein sequence.Then, use the recombinant DNA technology of standard, these gene orders are coupled together enter cloning vector to make the L2E7 fusion gene, so that the open reading frame of two kinds of sequences is kept.Make up the L2E7 fusion gene as follows.

At first HPV-6 L2 gene is produced as the 1.1kbPCR fragment that is connected by BamHI and Nco I site side.This PCR fragment subclone is gone into the pGEM-T cloning vector.Have the segmental clone of required insertion with two kinds of enzymic digestions so that discharge the L2 gene, then by the separation on the sepharose with and subsequent extracting on glass milk (glass milk) come purifying it.Similarly, the Nco ISal I fragment of HPV-6 E7 gene as 300bp produced, and its subclone is gone into PGEM-T.These two gene fragments are linked together, to produce 1.4kb BamHI-Sal I dna fragmentation, this fragment coding L2E7 fused protein.

Then, the BamH I-Sal I dna fragmentation that is produced is connected to the derivative of pET16b, it is a kind of non-cloning by expression carrier with kalamycin resistance.The construct called after pGW48 that is produced.Subsequently, the L2E7 genetic fusant is transferred on the expression pET carrier, so that the expression of analysing protein in intestinal bacteria.

After the expression analysis of fusion gene in intestinal bacteria, carry out the sudden change of gene as described, so that eliminate T residue segment (it is generally acknowledged that it will cause the premature termination of transcribing).

Then, modify the L2E7 fusion gene producing BamH I and Not I end by PCR, this end can make box gene be inserted into to contain at 5 ' end and meet frame pelB leader sequence and contain the expression vector that meets frame His Tag at 3 ' end.By pGEM-T carrier cloning PCR fragment, and it is transferred on the pET carrier that derives from pET22b the most at last.This final construct called after pGW53.

After assembling, fusion constructs is transferred on a series of prokaryotic expression carriers (being called the pET carrier).These carriers known in the art contain strong phage t7 transcribes and translation signals.Under the control of derivable lacUV5 promotor,, T7 RNA polymerase source comes abduction delivering in host cell then by being provided.Then, the adding of inductor IPTG causes the conversion of the resource of cell to expression of target gene.Then, required product may account for more than 50% of total cell protein matter.In addition, because system is derivable, induce the target-gene sequence that is in the Transcriptional Silencing state before so it can maintain, thereby the expression of the gene order of making (host cell is had toxicity) is carried out.

Therefore, IPTG is to the expression of following with cloned gene of inducing that causes polysaccharase with the adding in the quick grown culture of pET carrier (comprising target gene) cell transformed.Protein or obtain the secretion, perhaps under the situation of these HPV gene products, be directed into inclusion body.

By introducing Bgl II restriction enzyme sites at the two ends of gene fragment, utilize PCR mutagenesis to finish clone's step, used oligonucleotide is as follows: NRW170 GTCGACAGATCTGGCACATAGTAGGGCCCGA SEQ IDNO 2

Be used for the oligonucleotide that PCR clone HPV 6 L2E7 enter the pET carrier.The BgIII site is introduced the N end of HPV 6 L2.Enter pET leader sequence (pelB) for fusion, without any need for the methionine(Met) codon.

Carry out dna sequencing subsequently.Then, the L2E7 fusion gene is attached in the following carrier: pET11b, pET12b, pET16b and pET22b, their N end has different character with the C terminal sequence.Then, the plasmid of reorganization is used for transforming appropriate host cell HMS174, and it contains the gene of T7 polysaccharase.Also can obtain other different host cell aspect the severity that suppresses basal expression, and the application of in this method, succeeding.The expression of embodiment 4:L2E7 construct in intestinal bacteria

From transforming the individual bacterial colony of dull and stereotyped picking, and it is used for inoculating the 2mL aliquots containig of 2YT substratum.Cultivated these aliquots containigs 2 hours, and then it was used for inoculating the 12 mL cultures of substratum of heating, the amount of adjusting inoculum is to provide the bacterium of consistent quantity (by being determined at the spectrodensitometry at 600nm place).Cultivate these cultures, reach 0.6, this moment culture is divided into the aliquots containig of two parts of 5.0mL up to optical density(OD).Concentration with the 1.0mM that recommends adds to IPTG in a kind of culture, and cultivates two kinds of cultures 3 hours under identical conditions.

This period is when finishing, and shifts bacterium so that freezing, and measuring light density.By in the 15mLFalcon pipe with 4,000rpm gathered in the crops bacterial cultures in centrifugal 10 minutes.Remove supernatant liquor, and in last 0.5mL TE the resuspending bacterium.

Carrying out SDS-PAGE as follows analyzes:

Then, sample is added in the reductibility electrophoresis sample buffer of equivalent, and heated 10 minutes down at 100 ℃.Then, the sample of 50 μ l is added in the polyacrylamide gel of 5-15%, and under the 10mA condition electrophoresis 12 hours.By with Xylene Brilliant Cyanine G (in 10% acetate, 10% methyl alcohol) dyeing 30 minutes and decolouring subsequently, can see protein band.Except other band (corresponding to the product of premature termination of transcribing or translating or protein degradation) of at least one 80kD, can to molecular weight the main protein band (corresponding to total length L2E7 protein) of 90kD by the coomassie gel detection that dyes.

After utilizing site-directed mutagenesis (described in embodiment 6) that gene order is modified, can not detect the band of 80kD by Coomassie blue stain, this shows that the hypothesis of transcribing or translate premature termination is correct.

Compare with known standard, the protein mass that is present on the gel is carried out the assessment of expression level in the bacterium.As if its level consistent within the scope of 10-30mg/L.

In order more at large to describe expressed protein, gel is carried out Western shift, use the anti--L2 antiserum(antisera) that produces by sheep immunity (utilizing intestinal bacteria deutero-L2 fused protein) to detect subsequently.The Western trace makes the band of the molecular weight that is lower than the total length kind in a large number become visible, and probably all in them all can produce once more by protein degradation or the premature termination of transcribing or translating.

Preliminary SDS-PAGE analysis revealed: exist with the painted protein band of big or small corresponding coomassie of desired total length L2E7 gene product.In addition, some other visible bands are arranged, they or corresponding to the proteinic fragment of L2E7 or meet the illusion of premature termination.

This can-L2 anti-by the utilization of Western trace or anti--E7 antiserum(antisera) investigate.The result confirms that primary product is L2E7, and shows that minor band is to lack the C end regions.

Finish further evaluation by protein sequencing, the result confirms: two main bands comprise complete N terminal sequence (comprising uncut pelB leader sequence).Embodiment 5: in-vitro transcription and translation

For further identifying product, transcribe and the translation experiment analyzing gene with a series of external link coupled.The T7 polysaccharase that this system's utilization is introduced is to produce the mRNA transcript from cloned genes in expression vector, external then this transcript of translation is to produce the synthetic protein.By radio-labeling is mixed protein, utilize SDS-PAGE to analyze and to monitor the synthetic of it.

In-vitro transcription discloses with translation: have and the similar protein synthesis pattern of finding in intestinal bacteria allos system.The L2E7 fused protein is made up of two main bands of 80kD and 70kD, and except the full length product of 60kD of supposition, and the L1 product comprises 30 and two main bands of 32kD.

Dna sequence analysis discloses, and in the sequence of L1 and L2, has many T segment of being made up of 7 and 9 T residues, and this seems and is consistent with the segmental position of the premature termination of L1 and L2E7 molecule.This shows that the premature termination of transcribing or translating has been caused in these zones, and that most possible is the former.By the observation to the many T district in the terminator sequence of T7 polysaccharase, this viewpoint is supported.The mutagenesis of embodiment 6:DNA sequence

Stop illusion in order to eliminate potential, decision is undergone mutation the segment in two rich T districts.Codon TTT coded amino acid phenylalanine (Phe) (its selectable codon (TTC) exists).Therefore, decision substitutes the TTT codon to produce sequence TTC by sudden change, can keep frame and natural protein sequence thus.In the present embodiment, selecting TTT does not make the character of product unaffected so that do not change by the protein sequence that makes immunotherapy reagent.Yet the level of the illusion by making the premature termination of transcribing or translating drops to minimum, and sudden change will increase the output of expressed protein.

The round pcr that oligonucleotide JCT61, the JPC81 that utilization defines below extended by gene overlap is realized sudden change, and wherein natural dna sequence dna is replaced by the mutant nucleotide sequence in the domain of dependence.

In mutagenesis, utilize following oligonucleotide:

JCT61?CCAACCCTCCGAAGAACACCCCCAAAC

SEQ ID NO 3 (being used for noncoding strand Oligonucleolide primers) JPC81 GATCA in the mutagenesis of the HPV at dna sequence dna position 159 and 162 places (TTTTTT to TTCTTC) 6 L2 AATATTAAAATGGGGAAGTTTGGGGGTGTTCTTCGGAGGG

SEQ ID NO 4:(is used to be incorporated in the coding strand Oligonucleolide primers of HPV 6 L2 of mutagenesis of the sequence TTTTTT to TTCTTC at position 159 and 162 places).Oligonucleotide coding Sspl site AATATT.

Utilize following oligonucleotide by site-directed mutagenesis, second site also obtains sudden change:

JPC90?CGTATTCCCTTATTCTTCTCAGATGTGGCGGC

SEQ ID NO 5 (being used to be incorporated in the coding strand Oligonucleolide primers of HPV 6 L2 of vitro mutagenesis of the sequence at position 1359 and 1362 places)

Then, last gene product is inserted so that designing for manufacturing is the final expression vector of pGW53, and analyzed it by external and expression in vivo.Embodiment 7: the expression of the sequence of sudden change

After the mutagenesis of L2E7 construct,, monitor its effect with SDS-PAGE analysis and suitable Western engram analysis subsequently by external and expression in vivo.

Initial experiment is used for analyzing the L2E7 and the L1 gene in vitro of two kinds of sudden changes and transcribes and translation product.

As the L2E7 of preceding detection sudden change and the expression in vivo of L1 gene.Select individual bacterium colony, and it is cultured to optical density(OD) is 0.6, induce half culture with IPTG this moment, induced back three hours, and harvested cell is analyzed prepared aliquots containig with SDS-PAGE.Find that expression cassette obtains satisfied translation.

External and intravital experiment confirm, the mutagenesis in many T district causes the reduction of the segmental output of premature termination of L2E7 and L1, and the output of full length product is improved.Net result is: the output that derives from the 70kD product of L2E7 expression reduces and derives from the segmental forfeiture of 30-32kD of L1 expression.

Therefore, be clear that the raising that the sudden change in many-T district causes the total length kind to be expressed in this expression system.For expression system, do not described this result in the past, and this possibility of result has been widely used in other field of the work of expression based on the T7 polysaccharase.Embodiment 8: protein produces and purge process

The main working cardial cell storehouse that (Dedicated) that contributes is comprised pGW53 plasmid and deutero-intestinal bacteria HMS174 cell as described herein is placed and is stored under-80 ℃.For producing, thawing derives from the 1 ampoule cell in working cardial cell storehouse, and is cultured to suitable volume to carry out the fermentor tank inoculation in the 2YT substratum.The scale of fermentation is from 1.3L to 50L, and is expected to carry out more massive fermentation.Culturing cell reaches a predefined point (being typically every L 0.3g) up to cell density.In this point, come the inducing culture thing with IPTG, after this harvested cell after about 2 hours.With the fermentation condition of standard, can obtain the output of every g dry weight cell 24-50mgL2E7 sometimes.Carry out then purifying as cytoclasis specified in following and the accompanying drawing 3 and protein.

Carry out cytoclasis so that discharge the insoluble L2E7 of storage as inclusion body in the born of the same parents (IB).This can utilize hydraulic pressure to make cell cause lysis to finish by a narrow aperture under 5000psi pressure.Can obtain the cracking of about 95% efficient with standard method, 3 times by after can reach really cracking completely.

The centrifugal Bacillus coli cells lysate that comprises the insoluble L2E7 of inclusion body form.Resuspending comprises the precipitation bead of inclusion body and cell debris in the damping fluid that contains the triton x-100 stain remover.In such tangent line cross-flow filtration, this area standard technique that it carries out in commercially available " Filtron " (TM) installs,, make and treat that ultrafiltration or filtered liquid or suspension flow are by a ultra-filtration membrane or filtering membrane by under the transmembrane pressure of film enough driving filtrate.In current embodiment, the cross-flow filtration of tangent line is used for concentrating inclusion body suspension at 0.16 μ m filter.In retentate, concentrate inclusion body, remove the impurity in the filtrate.Then, dilute enriched material with reduction triton x-100 concentration, and then concentrate once.Then, add urea and DTT (dithiothreitol (DTT)) respectively respectively to final 8M and 10M concentration, thus dissolving L2E7.Then, make passing the filter of 0.16 μ with reductive L2E7 protein and entering in the filtrate of further collection of sex change.

Then, with the ion exchange chromatography purifying with L2E7 sex change, that reductive, filtering form exist.At first come the purifying 8.0M urea dissolved L2E7 of institute protein with the condition of Fig. 3 explanation by anion exchange chromatography.Typically, purifying 1-2g product on a 250-350mL post.The dissolved L2E7 of urea institute is loaded on the anionite-exchange resin, and with urea DTT Tris damping fluid (pH8.0) wash-out that contains 50mM NaCl of 4 column volumes to remove weak bonded impurity.At last, with the urea DTT Tris damping fluid (pH8.0) that contains 350mM NaCl wash-out L2E7 protein from post of maximum 5 column volumes.The flow velocity of whole steps is about 5mL cm ^-2/ minute.

Anion-exchange chromatography peak product is loaded on the cationite.Typically, purifying 1-2g product on the material of about 250mL post.With product with 2.5mL minute cm ^-1Be loaded on the resin, with 8.0M urea DTT phosphoric acid salt (pH6.2) washing that contains 210mM sodium-chlor of 4 column volumes, use the lavation buffer solution wash-out L2E7 peak that contains 500mM sodium-chlor subsequently then to about 1.5 column volumes.

Operation damping fluid with the 25mM Tris pH8.0 that contains 75mM sodium-chlor is loaded in cationite peak product on the size exclusion matrix (as indicated among Fig. 3).Typically, will contain the 100mL of 200-400mg L2E7 (with 0.2mL cm ^-2/ minute) be loaded on the matrix of (post) height of bed 100cm of 6.5L.Wiping out segmental peak corresponding to primary product and less important N-terminal is peak with the elution volume cutting of about 0.46 column volume.

In this stage of this process, with about 0.25-0.5mg mL ^-1Concentration dilution size exclusion chromatography peak.By with 0.5mL cm ^-2/ minute flow velocity is loaded in anionresin matrix in a small amount (approximately 75mL) enriched product that comes up (1-2L).Come eluted product with the urea DTT phosphate buffered saline buffer pH8.0 that contains 1.0M sodium-chlor.The peak volume is the 1-2 column volume.

When comprising the 48.9mM Tris pH8.0 of 5mM DTT, spissated Q negatively charged ion cylinder peak is cushioned exchange enter last prescription damping fluid.Base for post matter is the sepharose matrix with about 2.5 liters of volumes.One Ballet Shop damping fluid (containing the 8M urea that equals the product volume) is contained on the post in advance.Then, load product with about 100-150mL load.Typically, utilize 0.06mL cm ^-2/ minute flow velocity is with the product peak of 0.5 column volume wash-out with the prescription buffer-exchanged.Then, last product body is stored in-80 ℃.

Form exists to assemble (collection of meeting again) for proteinic solution of product L2E7 that can obtain in this way or dispersion liquid, yet this product can pass the sterilization filter, and for example specification is the filter of 0.16-0.22 micrometer range (as 0.2 micron).Clone and the expression of embodiment 9:HPV-6 gene in yeast-yeast saccharomyces cerevisiae

In order to check the ability of the high level expression HPV-6 of other allos system gene, the gene clone of L2E7 and L1 fusion constructs is entered the expression vector of the self-replicating of general obtainable yeast saccharomyces cerevisiae.The carrier of this element based on 2 μ plasmids makes the allos that is driven for the GAL7 promotor meet the frame gene and is expressed.This carrier also comprises LEU-2d mark (being used for selecting the copy number of the increase of yeast cell) and kalamycin resistance gene (selection can be carried out) in intestinal bacteria.The Saccharomyces cerevisiae host bacterial strain that is used to express be S150-2B (genotype: a, leu2-3,112, Δ his3, trpl-289, ura3-52).

With HPV-6L2-E7 construct transformed yeast, and in comprising the substratum of 2% glucose, cultivate it, so that suppress transcribing of GAL7 promotor as sole carbon source.In substratum when having 2% semi-lactosi (as sole carbon source) inducible gene expression.

When existing, granulated glass sphere produces cell extract by breaking of cytolemma.Extract damping fluid based on Tris, and contain the proteinase inhibitor of broad range: PMSF, pepstatin, leupeptin, protease inhibitor and chymostatin.Handle cell extract by SDS PAGE, and the protein that utilizes the polyclonal antiserum that in sheep, produces at HPV-6 L2 and HPV-6 E7 to come the Western trace to be resolved.

Estimation in certain embodiments derives from the output of the HPV-6 L2-E7 fused protein of yeast saccharomyces cerevisiae in this way, and its value is every liter of culture 10 μ g.Clone and the expression of embodiment 10:HPV-6 gene in yeast-pichia pastoris phaff

Can make L2E7 fusion molecule (referring to top embodiment 3) as BamH I-Not I dna fragmentation, and its clone can be entered in the suitable expression vector, as Pichia expression vector pPIC3K (can under Phillips Petroleum permission, obtain).For obtaining the high level expression of fused protein, gene can be placed alcohol oxidase promotor AOXI control down.After the linearizing of expression construct, can the DNA transfection be entered yeast cell by the spheroplast fusion.

Can select transformant by they energy for growth in lacking the minimum medium of Histidine, this is not still keeping demand to Histidine as non-transfected cells in growth medium.Take turns screening slowly carrying out second on the basis of growth on the methyl alcohol substrate, to select those to contain to be incorporated into the clone of the L2E7 gene on the correct gene seat.Clone and the expression of embodiment 11:HPV-6 gene in baculovirus

In order to study the expression of L2E7 fusion gene in baculovirus, produce two constructs, each is all encoded or is not had the HPV-6 L2E7 fused protein of HisTag tail.The none construct comprises leader sequence, because wish to check expression levels in the born of the same parents this moment.

Clone this two constructs by pcr amplification (introduce terminal Bgl II site and enter the pGEM-T carrier).Then, separate the L2E7 gene, and its subclone is entered the BamHI cloning site of transfer vector pBacPAK1 (Clontech) as Bgl II-Bgl II fragment.Then, measure the segmental orientation of insertion, and prepare DNA by the clone who comprises correct orientation by pcr analysis.

Utilize the method for the lipofection mediation of standard, with the DNA (comprising any L2E7 construct) of the pBacPAK1 transfer vector pBacPAK1 viral DNA (Clontech) together with the Bsu361 cutting, transfection enters fall army worm (type Sf9) cell.Carry out homologous recombination in the body between plasmid and the viral DNA then,, and in this process, target gene is transferred to viral genome with the rescue viral DNA.

Then, by infect the progeny virus that new fresh cell increases and produces in the supernatant liquor of cotransfection.

Gather in the crops a part of cells infected, and the preparation genomic dna.Utilize the pcr amplification of above-mentioned primer to show: in cell, to have recombinant virus.

Then, a viral original seed that goes down to posterity is used for the further cells infected of high infection multiplicity, to come identified gene to express: infect the Sf9 cell that is paved with in 6 well plates with high infection multiplicity, infect difference harvested cell and supernatant liquor after 24 hours, 48 hours and 72 hours by the time course of measuring protein production.Analyze and Western trace observation experiment result by SDS-PAGE, proteinic synthetic to detect.

On the painted SDS/PAGE gel of coomassie, do not observe recombinant protein, but when low-level, can obtain detecting by the Western trace.Just as expected, protein does not obtain secretion owing to the shortage of leader sequence.The gene of ordering amplification fully, and its subclone entered plasmid vector.Gene order is used for making up genetic fusant, and this genetic fusant is used at protokaryon and eukaryotic system high level expression HPV-6 protein.Embodiment 12: the L2E7 immunogenicity in mouse

In mouse, detect the immunogenicity of the aggregate of L2E7.Found that: when the aggregate of the L2E7 on will being adsorbed on aluminium hydroxide (" alum ") is injected into the B6CBA mouse, can cause the specific immunity of L2E7.This L2E7 specific immunity comprises the serum antibody of immunoglobulin G (IgG) class and immunoglobulin G 1 subclass (IgG1).Also find reaction of external specificity delayed-type hypersensitivity and the lymphocytic hyperplasia reaction of L2E7.

In the B6CBA mouse, detect the immunogenicity that is adsorbed on the L2E7 on the alum.After 14 days, give the subcutaneous injection of twice 180 μ g of mouse L2E7/ alum respectively.

Serum is collected in after the L2E7/ alum injection second time the 7th, 14 and 56 day respectively.Measure the anti-L2E7 antibody horizontal of serum with L2E7 specific enzymes linked immunosorbent assay method.After the L2E7 injection for the second time the 14th day, the anti-L2E7 reaction of serum reaches peak value (the intermediate point titre is 4.572log10), and lasts till the 56th day (the intermediate point titre is 4.127log10).

Obtaining above-mentioned mice immunized with second group measures delayed-type hypersensitivity reaction (DTH) in the body of L2E7.After the L2E7/ alum injection for the second time the 7th day, the auris dextra of mouse with 1.8 μ gL2E7 and they left ear with the damping fluid attack of equivalent they.After ear is attacked the 24th, 48 and 72 hour, the specificity of measuring the L2E7 of ear thickness with the engineering micrometer increases.Has DTH reaction in the body with L2E7/ alum mice immunized.

The lymph-node cell (nodi lymphatici axillares cell) of the 3rd group of mouse is taken from by derivation in after their the L2E7/ alum product injection second time (as mentioned above) the 7th day, measures external lymphocytic hyperplasia reaction.Make the suspension of single lymph-node cell, and with 2 * 10 ⁶Can survive lymphocyte/mL plating in the substratum (Iscove modified form Dulbecco substratum) with 1% normal mouse serum, L-glutamic acid, beta-mercaptoethanol and microbiotic feed supplement.(91 μ g/mL) in the culture gone in the L2E7 titration, and estimate the last 24 hours cell proliferation in the cultivation in 72 hours by mixing titrating thymidine.The L2E7/ alum of in-vitro multiplication comes the lymph-node cell (42000cpm, stimulation index 50) of immune mouse with response L2E7.Embodiment 13: the immune response in the human body

Aforesaid vaccine (a kind of aluminum hydroxide gel mixture of the L2E7 of preparation of equal value according to the method described above) demonstrates and induce suitable, relevant with dosage immune response in the healthy male volunteer.The cell that derives from all 36 volunteers that obtain inoculating demonstrates and shows the external lymphocytic hyperplasia reaction of the immunoreactive L2E7 specificity of product (CD4+T cell).Use product by the intramuscular injection mode to the volunteer, its dosage is 3,30 or 300 μ g at the 0th day predose, and gives repeated doses (accelerated procedure) at the 7th and 28 day.(one selectable, slowly, the 0th, 28 and 56 day vaccination program also obtain the test, and find that it is not preferred).Observing lymphocytic hyperplasia at the 7th day under the dosage level that comprises lowest dose level (3 μ g) reacts.In 32 that derive from the volunteer 29 of can assess in the sample, also demonstrate L2E7 specific antibody reaction (in antibody test, using lowest dose level for three nonresponders).Also observe the increase that produces the consistent external generation of IL-5 with antibody.Two higher dosage are induced T-cell proliferation quickly than lowest dose level.Maximum dose level (300 μ g) stimulates more IFN-γ than lowest dose level generation.Observation that quick T-cell proliferation and relevant IFN-γ are produced and the product of being planned are used as the purposes of the treatment vaccine of Genital warts, are suitably consistent.

Also observe disappear (it is generally acknowledged that it is because due to the human papillomavirus) of people's sole wart of long-term formation in the acceptor of the product of using 3 μ g dosage, its cell belongs to those cells that shows the lymphocytic hyperplasia reaction.Observed at the 7th day and to disappear, disappear to the 14th day wart.

The present invention described herein and open part are easy to obtain many modifications and variation, and according to disclosure part, for the technician, these modifications and variation are significantly and easily to realize; Simultaneously the disclosure extends to adaptation, combination and the inferior combination of the feature that this paper touches upon and/or describe.The document that this paper quoted and this paper reference in the lump.

Claims (15)

1. a peptide species or peptide composition, this polypeptide or peptide composition comprise the antigenic determinant of hpv protein, and they can exist by the state of aggregation form or the amorphous state of aggregation form of sterilization filter with in solution or dispersion the time.

2. according to the polypeptide or the peptide composition of claim 1, this polypeptide or peptide composition contain the antigenic determinant of at least two kinds of hpv proteins, as L2 and another, or E7 and another.

3. according to the polypeptide or the peptide composition of claim 1 or 2, this polypeptide or peptide composition contain the proteinic antigenic determinant of at least one papilloma virus L2 and at least one papilloma virus E1, E2, E4, E6 or the proteinic antigenic determinant of E7.

4. according to claim 1,2 or 3 polypeptide or peptide composition, this polypeptide or peptide composition contain L2 and the proteinic antigenic determinant of E7 of HPV, at least 50% the sequence fragment that for example contains every kind of complete sequence of L2 protein and E7 protein, the complete basically sequence that for example contains L2 and E7 selectively also comprises the proteinic sequence of L1.

5. according to the polypeptide or the peptide composition of aforementioned arbitrary claim, antigenic determinant wherein is the antigenic determinant of papilloma virus hpv protein or the non-human animal of HPV type 6,11,16,18.

6. according to the polypeptide or the peptide composition of aforementioned arbitrary claim, this polypeptide or peptide composition form be sex change, reductive and heavy accumulative preparation.

7. according to the polypeptide or the peptide composition of aforementioned arbitrary claim, this polypeptide or peptide composition can by sex change or reduce denaturation with and subsequent in recombinant host cell the reunion collection with the polypeptide of inclusion body formal representation obtain.

8. according to the polypeptide or the peptide composition of claim 7, the molecular weight ranges of each aggregate of this polypeptide or peptide composition is about 100,000 to about 10,000,000 dalton.

9. according to the polypeptide or the peptide composition of claim 7, the aggregate particle diameter that this polypeptide or peptide composition contain, the scope on electron microscope is about 4 to 50nm, for example is about 10-15nm.

10. according to the polypeptide or the peptide composition of claim 7, it is 2-200 that the aggregate particle that this polypeptide or peptide composition contain has every aggregate, for example the polypeptide chain of 5-50.

11. polypeptide or peptide composition according to claim 1, this polypeptide or peptide composition comprise a kind of fusion polypeptide, this fusion polypeptide comprises the proteinic antigenic determinant of (a) at least one papilloma virus L2, and at least one is selected from the antigenic determinant of the L2 hpv protein of E1, E2, E4, E5, E6 and E7 hpv protein and the papillomavirus type different with (a) with (b); Perhaps contain at least two kinds of antigenic determinants that are selected from E1, E2, E4, E5, E6 and E7 hpv protein, for example wherein said protein derives from different papillomavirus types.

12. polypeptide or peptide composition according to claim 11, this polypeptide or peptide composition contain a kind of fusion polypeptide, and this fusion polypeptide comprises a proteinic antigenic determinant of L2 and derives from least a antigenic determinant of E1, E2, E4, E6 and E7 protein.

13. an immunogenic composition that is suitable for by the injection use, it contains according to the polypeptide of aforementioned arbitrary claim and immunological adjuvant.

14. according to the immunogenic composition of claim 13, adjuvant wherein contains aluminium hydroxide and/or single phosphoric acid lipid A.

15. as immunogenic purposes, for example be used as and be used to prevent or the vaccine of the illness that treatment is relevant with papilloma virus according to the polypeptide of aforementioned arbitrary claim or immunogenic composition.

Images