CN1382206A

CN1382206A - Color safe laundry methods employing zwitterionic formulation components

Info

Publication number: CN1382206A
Application number: CN00814753A
Authority: CN
Inventors: R·R·戴克斯特拉; P·J·凯莱特
Original assignee: Procter and Gamble Ltd
Current assignee: Procter and Gamble Ltd; Procter and Gamble Co
Priority date: 1999-08-27
Filing date: 2000-08-25
Publication date: 2002-11-27
Also published as: CA2381924A1; JP2003508589A; MXPA02002126A; EP1206518A1; TR200200457T2; CZ2002687A3; AR028165A1; WO2001016278A1; AU6935700A; BR0013643A; MA25544A1

Abstract

The present invention relates to zwitterionic organic catalyst compound bleach systems and methods for using such bleach systems to increase color safety during laundering of fabrics, especially colored fabrics. More particularly, this invention relates to bleach systems comprising zwitterionic, quaternary imine bleach boosting compounds, zwitterionic, quaternary oxaziridinium bleaching species and mixtures thereof, and methods employing such bleach systems in the laundering of fabrics, especially colored fabrics.

Description

That uses the zwitter-ion formulation component protects the look washing methods

Invention field

The method that the present invention relates to zwitter-ion organic catalysis immunomodulator compounds bleach system and in the washing process of fabric especially colored fabric, use this bleach system increase to protect look.More particularly, the present invention relates to comprise the bleach system of zwitter-ion season imines bleach boosters compound, zwitter-ion Ji Evil ethylene imine (oxaziridinium) SYNTHETIC OPTICAL WHITNER and its mixture, also relate to the method for in the washing process of fabric especially colored fabric, using this bleach system.

Background of invention

Oxygen bleaching agent more and more receives an acclaim in family expenses that promote scale removal and personal care product in recent years.SYNTHETIC OPTICAL WHITNER because of its scrubbing, clean gloomy fabric, brighten with sanitation performance and conform with demand especially.Have been found that oxygen bleaching agent is welcome especially in cleaning product such as washing composition, automatic bowl product and hard surface cleaner.Yet the effectiveness of oxygen bleaching agent is limited.Some shortcomings of often running into comprise the color of damaging fabric and to the washing device rubber pipe fracture to comprising in these facilities particularly.In addition, oxygen bleaching agent temperature dependent gradient extremely often.Therefore, use the solution temperature of oxygen bleaching agent low more, bleaching efficiency is low more.For the effectiveness of oxygen bleaching agent in the solution, general requirement surpasses 60 ℃ temperature.

In order to solve the dependency problem of said temperature gradient, developed a compounds that is called " bleach-activating agent ".Generally be have leavings group can fully hydrolyzed acyl compounds such as the bleach-activating agent and active oxy group (being generally hydrogen peroxide or its negatively charged ion) reaction of hydroxy benzene sulfonate generate more effective peroxy acid oxygenant.This just peracetic acid compound is followed the substrate material that oxidation besmirches or makes dirty.Yet bleach-activating agent also has certain temperature dependency.Bleach-activating agent about 40 ℃ more effective to about 60 ℃ water temperature.Be lower than under 40 ℃ the water temperature, peracetic acid compound will lose partial bleaching and render a service.

People's such as Miracle United States Patent (USP) 5,576,282 and 5,817,614 all disclose trial develops the bleach system that comprises zwitter-ion organic catalysis immunomodulator compounds, and this system is effectively also protected look relatively under the lower situation of water temperature.Although disclosed bleach system makes that protecting look is better than traditional organic catalyst bleach system such as cationic organic catalyst agent bleach system in this patent, the example of traditional organic catalyst bleach system is disclosed in people's such as Madison United States Patent (USP) 5,360,568,5,360,569,5,370,826 and 5,482, in 515, still, consumer wants better protects the look bleach product.

The critical defect relevant with the method for using traditional organic catalyst is that the working concentration of these organic catalysts is too high, the example of these methods is described in people's such as Madison United States Patent (USP) 5,360,568,5,360,569,5,370,826 and people's such as Miracle United States Patent (USP) 5,576, in 282 and 5,817,614.For example, at United States Patent (USP) 5,482, the method for using in 515 has been described a kind of method, and wherein the concentration of the oxygen-transfer agent of Cun Zaiing (organic catalysis immunomodulator compounds) is every liter of about 0.01ppm-300ppm of medium, and preferred concentration range for is extremely about 100ppm of 5ppm.This concentration can cause the color of unacceptable dye for fabrics to be damaged.In addition, this high density will consume too many available oxygen (" AvO "), make its performance curve change (promptly having changed the balance of crossing between acid blanching and the organic catalyst bleaching).It is possible that increase organic catalysis agent concentration improves dirt bleaching property, but necessary cost is to damage dyestuff, and at some position, this dye damage is unacceptable.Therefore, must make the dirt bleaching property of organic catalyst bleach system and the ratio maximum of dye damage.

As mentioned above, obviously also need the bleach system of zwitter-ion organic catalysis immunomodulator compounds and the washing methods of the bleach system that uses this zwitter-ion organic catalysis immunomodulator compounds, this system can effectively be bleached under low water temperature situation, and compare with the washing methods that uses aforesaid disclosed in the prior art organic catalyst bleach system, this system has the more superior look that protects; Also need to make the dirt bleaching property of organic catalyst bleach system and the ratio maximum of dye damage.

Summary of the invention

The present invention can satisfy above-mentioned needs.The invention provides the bleach system of zwitter-ion organic catalysis immunomodulator compounds and use the especially method of colored fabric of this bleach system laundering of textile fabrics.

Zwitter-ion organic catalysis immunomodulator compounds of the present invention and the bleach system that comprises this zwitter-ion organic catalysis immunomodulator compounds have the bleaching that has improved and render a service under low wash temperature, improved simultaneously and protected look, therefore, compare with cationic organic catalyst agent bleach system with traditional zwitter-ion, can improve bleaching and render a service and protect look.Zwitter-ion organic catalysis immunomodulator compounds bleach system of the present invention can with or not with, render a service and more superior fabric protects look but preferably be used in combination with the bleaching that produces above-mentioned raising with traditional peroxide bleaching source.

More particularly, the present invention relates to zwitter-ion organic catalysis immunomodulator compounds such as zwitter-ion season imines bleach boosters compound, zwitter-ion season Evil ethylene imine SYNTHETIC OPTICAL WHITNER, comprise the bleach system of these zwitter-ion organic catalysis immunomodulator compounds and use the washing methods of this bleach system.

By zwitter-ion organic catalysis immunomodulator compounds and use the indefiniteness example of the advantage that its bleach system provides to comprise in addition the bleaching preferably under low water temperature render a service and improve protect look.

On the one hand, the invention provides zwitter-ion organic catalyst bleach system, this system is compared with traditional organic catalyst bleach system, has effective bleaching and better protects look under low water temperature.

On the other hand, the invention provides the zwitter-ion organic catalyst bleach system that comprises one or more zwitter-ion organic catalysis immunomodulator compounds as hereinafter described, this system can with or be not used in combination with peroxygen source.

On the other hand, the invention provides the zwitter-ion organic catalyst bleach system that comprises one or more zwitter-ion organic catalysis immunomodulator compounds as hereinafter described, this system is used in combination with peracid.

On the other hand, the invention provides the especially method of colored fabric of fabric that washing need wash, this method comprises: fabric is contacted with the washing soln of the bleach system that comprises described one or more zwitter-ion organic catalysis immunomodulator compounds of the application.

On the other hand, the invention provides the bleach system of the present invention for preparing according to following step:

A) provide washing soln; With

B) bleaching composition that comprises a certain amount of zwitter-ion organic catalysis immunomodulator compounds of the present invention is added in the described washing soln, making the zwitter-ion organic catalyst compound concentrations in the described washing soln that obtains is that about 0.001ppm is to about 5ppm.

Therefore, the purpose of this invention is to provide: even when aqueous temperature is low, also have the bleach system that improves performance and improve the zwitter-ion organic catalysis immunomodulator compounds that protects look; With the bleach system laundering of textile fabrics that uses described one or more zwitter-ion organic catalysis immunomodulator compounds of the application especially method of colored fabric.

To those skilled in the art, can recognize these purposes of the present invention and other purpose, feature and advantage by following description and additional claims.

All percentage ratio, ratio and umber among the application unless otherwise mentioned, all is by weight calculation.All documents of quoting among the application are hereby incorporated by.

Detailed Description Of The Invention

The invention discloses very useful zwitter-ion organic catalysis immunomodulator compounds, comprise the bleach system of these zwitter-ion organic catalysis immunomodulator compounds and use the especially method of colored fabric of this bleach system laundering of textile fabrics.

Zwitter-ion organic catalysis immunomodulator compounds of the present invention and the bleach system that comprises these zwitter-ion organic catalysis immunomodulator compounds have the bleaching that has improved and render a service under lower temperature washing situation, improved simultaneously and protected look, therefore, compare with zwitter-ion organic catalyst bleach system with traditional positively charged ion, it has improved bleaching and has renderd a service and protected look.The bleach system of zwitter-ion organic catalysis immunomodulator compounds of the present invention can with or not with, but preferably with traditional peroxide bleaching source be used in combination with the bleaching that produces above-mentioned raising render a service and better fabric protect look.Definition

" peroxygen source " used in this application refers to produce the material of peralcohol, comprises peralcohol self.Its example comprises but is not defined as bleach-activating agent, peracid, percarbonate, perborate, hydrogen peroxide, bleach boosters compound and/or albic material (such as Evil ethylene imine).

" peralcohol " used in this application comprises peracid and superoxide (for example hydrogen peroxide, alkyl hydroperoxide etc.).

" peracid " used in this application refers to peroxy acid, as peroxycarboxylic acid and/or permonosulphuric acid (trade(brand)name OXONE) and its salt.Zwitter-ion organic catalysis immunomodulator compounds

The preferred bleach system that uses zwitter-ion organic catalysis immunomodulator compounds of the present invention and comprise these zwitter-ion organic catalysis immunomodulator compounds in the method for fabric that washing needs washing especially colored fabric.These methods generally comprise to be had peroxygen source and is having the substrate that bleaching besmirches in the water-bearing media of the defined zwitter-ion organic catalysis of its structure such as back immunomodulator compounds, preferably have yarn dyed fabric, the concentration from the active oxygen of peralcohol that wherein comprises in the water-bearing media is that every liter of about 0.05ppm of medium is to about 250ppm, the zwitter-ion organic catalyst compound concentrations that comprises in the water-bearing media is that 0.001ppm is to about 2ppm, preferred about 0.01ppm is to about 2ppm, more preferably from about 0.1ppm is to about 1.5ppm, and most preferably from about 0.2ppm is to about 1ppm.

In bleach system of the present invention, when having peralcohol, the mol ratio of described peralcohol and zwitter-ion organic catalysis immunomodulator compounds is preferably greater than 1: 1, more preferably from about 30,000: 1 to about 10: 1, even more preferably from about 10,000: 1 to about 50: 1, further preferred about 5,000: 1 to about 100: 1, further more preferably from about 3,500: 1 to about 150: 1.

What the mol ratio of peralcohol and zwitter-ion organic catalysis immunomodulator compounds influenced bleach system protects the look performance.Yet the ppm concentration of the zwitter-ion organic catalysis immunomodulator compounds in the bleach system is to determine the principal element of protecting the look performance of this bleach system.

For example, to discharge the molecular weight of 1ppm concentration be 300 zwitter-ion organic catalysis immunomodulator compounds to product in water-bearing media, and the NOBS of 66ppm concentration (supposing the n-nonanoic acid of crossing of 100% fully hydrolyzed 35ppm) and the percarbonic acid (hydrogen peroxide of 21ppm) of 66ppm concentration make that the mol ratio of peralcohol and zwitter-ion organic catalysis immunomodulator compounds is 246: 1.The product of the percarbonic acid (generating the hydrogen peroxide of 281ppm) of the TAED of release 240ppm (generating the peracetic acid of 160ppm) and 865ppm makes that the mol ratio of peralcohol and zwitter-ion organic catalyst is 3142: 1.When zwitter-ion organic catalysis immunomodulator compounds was 0.25ppm, this mol ratio was 12568: 1.

Except the mol ratio of peralcohol and zwitter-ion organic catalysis immunomodulator compounds, the feature of bleach system of the present invention also is the mol ratio of peracid and zwitter-ion organic catalysis immunomodulator compounds.The mol ratio of peracid and zwitter-ion organic catalysis immunomodulator compounds is preferably greater than 1: 1, and more preferably from about 5,000: 1 to about 5: 1, even more preferably from about 2,000: 1 to about 10: 1, further preferred about 1,000: 1 to about 15: 1.

Preferred peracid is different and different because of wash conditions with the mol ratio of zwitter-ion organic catalysis immunomodulator compounds.For example, under the wash conditions in Europe (detergent component that generally comprises about 4500ppm-5000ppm in washing water), the mol ratio of preferred peracid and zwitter-ion organic catalysis immunomodulator compounds is about 2,000: 1 to about 150: 1.Yet, under the wash conditions of North America, (generally in washing water, comprising the detergent component of about 850ppm) to about 1000ppm, the mol ratio of preferred peracid and zwitter-ion organic catalysis immunomodulator compounds is about 150: 1 to about 5: 1.

Except the mol ratio of peracid and zwitter-ion organic catalysis immunomodulator compounds, the feature of bleach system of the present invention also is hydrophobic peracids and zwitter-ion organic catalysis immunomodulator compounds, preferably with the mol ratio of hydrophobic zwitter-ion organic catalysis immunomodulator compounds.The mol ratio of hydrophobic peracids and zwitter-ion organic catalysis immunomodulator compounds preferably about 500: 1 to about 15: 1, more preferably from about 350: 1 to about 20: 1, further preferred about 200: 1 to about 25: 1, even more preferably from about 100: 1 to about 35: 1.

Preferably, zwitter-ion organic catalysis immunomodulator compounds of the present invention, more preferably, imido grpup zwitter-ion organic catalysis immunomodulator compounds of the present invention comprises but is not defined as the bleach boosters compound.

I. bleach boosters compound-bleach boosters compound of the present invention, preferred imido grpup bleach boosters compound comprise but are not defined as to have net charge approximately+3 to-3 aryl imine zwitter-ions approximately.

Aryl imine zwitter-ion-have net charge approximately+3 to-3 aryl imine zwitter-ion approximately with formula [II] expression: R wherein ⁵-R ⁷Be independently selected from replacement or unsubstituted group, these groups are selected from H, alkyl, cycloalkyl, aryl, alkaryl, aralkyl, heterocycle, silyl, nitro, halogen, cyano group, sulfo group, alkoxyl group, ketone group, carboxyl and carbalkoxy; The group that in this formula, also exists following formula to represent:

Z wherein _p ^-With T _oForm covalent linkage, Z _p ^-Be selected from-CO ₂ ^-,-SO ₃ ^-,-OSO ₃ ^-,-SO ₂ ^-With-OSO ₂ ^-, p is 1,2 or 3; T _oBe selected from and replace or unsubstituted, saturated or undersaturated alkyl, cycloalkyl, aryl, alkaryl, aralkyl and heterocycle.

Preferably, have static charge+3 to about-3 aryl imine zwitter-ion formula [XII] expression approximately:

Wherein, m is 1-3 when G exists, and m is 1-4 when G does not exist; N is the integer of 0-4; Each R ²⁶All be independently selected from replacement or unsubstituted group, these groups are selected from H, alkyl, cycloalkyl, aryl, fused-aryl, heterocycle, annelated heterocycles, nitro, halogen, cyano group, sulfo group, alkoxyl group, ketone group, carboxyl and carbalkoxy, and any two adjacent R ²⁶Substituting group can be in conjunction with forming fused-aryl, fused iso or annelated heterocycles; R ²⁵Can be replacement or unsubstituted group, these groups are selected from H, alkyl, cycloalkyl, alkaryl, aryl, aralkyl, heterocycle, silyl, nitro, halogen, cyano group, sulfo group, alkoxyl group, ketone group, carboxyl and carbalkoxy; The group that also exists following formula to represent in the formula:

Z wherein _p ^-With T _oForm covalent linkage, Z _p ^-Be selected from-CO ₂ ^-,-SO ₃ ^-,-OSO ₃ ^-,-SO ₂ ^-With-OSO ₂ ^-, p is 1,2 or 3; T _oBe selected from following radicals: Wherein q is the integer of 1-8; R ²⁹Be independently selected from replacement or unsubstituted group, these groups are selected from straight or branched H, alkyl, cycloalkyl, alkaryl, aryl, aralkyl, alkylidene group, heterocycle, alkoxyl group, aromatic carbonyl, carboxyalkyl and amide group; G is selected from: (1)-O-; (2)-N (R ³⁰)-; (3)-N (R ³⁰R ³¹)-; R ²⁷, R ²⁸, R ³⁰And R ³¹For replacing or unsubstituted group, these groups are independently selected from H, oxygen, alkyl, cycloalkyl, alkaryl, aryl, aralkyl, alkylidene group, heterocycle, alkoxyl group, aromatic carbonyl, carboxyalkyl and amide group; R ²⁵, R ²⁶, R ²⁷, R ²⁸, R ³⁰And R ³¹In any one can and R ²⁵, R ²⁶, R ²⁷, R ²⁸, R ³⁰And R ³¹In any other combine a part that forms common ring; The R of any geminal ²⁷-R ²⁸Can be in conjunction with forming carbonyl; Any adjacent R ²⁷-R ³¹Can be in conjunction with forming unsaturated part; And any one substituent R wherein ²⁷-R ³¹Can be in conjunction with form to replace or unsubstitutedly condense unsaturated part.

The preferred aryl imine zwitter-ion with net charge about+3 to about-3 suc as formula [XII] expression comprises those ions that formula [XII] is represented, wherein R ²⁵The group of representing for H or methyl and following formula: Z _p ^-For-CO ₂ ^-,-SO ₃ ^-Or-OSO ₃ ^-, p is 1 or 2.

Most preferably, the aryl imine zwitter-ion is the ion with following formula [XIIa] expression:

Wherein, R ⁴¹-R ⁴⁴Can be independently selected from replacement or unsubstituted group, these groups are selected from H, straight or branched, replacement or unsubstituted alkyl, and cycloalkyl, alkaryl, aryl, aralkyl, alkylidene group, alkoxyl group, condition is any one R ⁴¹-R ⁴⁴Can be with any one other R ⁴¹-R ⁴⁴In conjunction with a part that forms common ring; More preferably, R ⁴¹-R ⁴⁴In at least one, even more preferably at least two be H.Most preferably, R ⁴¹And/or R ⁴⁴Be straight or branched C ₁-C ₁₆Alkyl or cycloalkyl, even more preferably, R ⁴¹And R ⁴⁴In the carbonatoms sum be 5-15, most preferably be 6-13.

II. albic material-albic material (Evil ethylene imine) also can be directly used among the present invention.Albic material of the present invention comprises but is not defined as to have net charge about+3 to about-3 De Evil ethylene imine zwitter-ions.

When having peroxygen source, aryl imine zwitter-ion of the present invention is used in combination to improve bleaching with peroxygen source and renders a service.Be not subjected to theoretic restriction, can think that the reaction of aryl imine zwitter-ion and peroxygen source generates active higher albic material-zwitter-ion season Evil ethylene imine compound, this can represent with following illustrative reaction:

Liang Li Evil ethylene imine compound is compared with peralcohol, has increase or better activity at a lower temperature.

Evil ethylene imine zwitter-ion-have net charge with formula [IV] expression to make an appointment with+3 to making an appointment with-3 De Evil ethylene imine zwitter-ions:

R wherein ^{5 '}-R ^{7 '}Be independently selected from replacement or unsubstituted group, these groups are selected from H, alkyl, cycloalkyl, aryl, alkaryl, aralkyl, heterocycle, silyl, nitro, halogen, cyano group, sulfo group, alkoxyl group, ketone group, carboxyl and carbalkoxy; The group that also exists following formula to represent in the formula:

Z ' wherein _p ^-With T ' _oForm covalent linkage, Z ' _p ^-Be selected from-CO ₂ ^-,-SO ₃ ^-,-OSO ₃ ^-,-SO ₂ ^-With-OSO ₂ ^-, p is 1,2 or 3; T ' o is selected from and replaces or unsubstituted, saturated or unsaturated alkyl, cycloalkyl, aryl, alkaryl, aralkyl and heterocycle.

Preferably, having net charge about+3 to about-3 De Evil ethylene imine zwitter-ions represents with formula [XIV]: Wherein, m is 1-3 when G exists, and m is 1-4 when G does not exist; N is the integer of 0-4; Each R ^{26 '}All be independently selected from replacement or unsubstituted group, these groups are selected from H, alkyl, cycloalkyl, aryl, fused-aryl, heterocycle, annelated heterocycles, nitro, halogen, cyano group, sulfo group, alkoxyl group, ketone group, carboxyl and carbalkoxy, and any two adjacent R ^{26 '}Substituting group can be in conjunction with forming fused-aryl, fused iso or annelated heterocycles; R ^{25 '}Can be replacement or unsubstituted group, these groups are selected from H, alkyl, cycloalkyl, alkaryl, aryl, aralkyl, heterocycle, silyl, nitro, halogen, cyano group, sulfo group, alkoxyl group, ketone group, carboxyl and carbalkoxy; The group that also exists following formula to represent in the formula: Z ' wherein _p ^-With T ' _oForm covalent linkage, Z ' _p ^-Be selected from-CO ₂ ^-,-SO ₃ ^-,-OSO ₃ ^-,-SO ₂ ^-With-OSO ₂ ^-, p is 1 or 2; T ' _oBe selected from following radicals: Wherein q is the integer of 1-8; R ^{29 '}Be independently selected from and replace or unsubstituted group, these groups are selected from the H of straight or branched, alkyl, cycloalkyl, alkaryl, aryl, aralkyl, alkylidene group, heterocycle, alkoxyl group, aromatic carbonyl, carboxyalkyl and amide group, the R that condition is whether all ^{29 '}All independently be selected from H; G is selected from: (1)-O-; (2)-N (R ^{30 '})-; (3)-N (R ^{30 '}R ^{31 '})-; R ^{27 '}, R ^{28 '}, R ^{30 '}And R ^{31 '}For replacing or unsubstituted group, these groups are independently selected from H, oxygen, alkyl, cycloalkyl, alkaryl, aryl, aralkyl, alkylidene group, heterocycle, alkoxyl group, aromatic carbonyl, carboxyalkyl and amide group; R ^{25 '}, R ^{26 '}, R ^{27 '}, R ^{28 '}, R ^{30 '}And R ^{31 '}In any one can and R ^{25 '}, R ^{26 '}, R ^{27 '}, R ^{28 '}, R ^{30 '}And R ^{31 '}In any other combine a part that forms common ring; The R of any geminal ^{27 '}-R ^{28 '}Can be in conjunction with forming carbonyl; Any adjacent R ^{27 '}-R ^{31 '}Can be in conjunction with forming unsaturated part; And substituent R wherein ^{27 '}-R ^{31 '}In any one group can be in conjunction with form to replace or unsubstitutedly condense unsaturated part.

Preferred net charge about+3 to about-3 De Evil ethylene imine zwitter-ions that have suc as formula [XIV] expression comprise those ions that formula [XIV] is represented, wherein R ^{25 '}The group of representing for H or methyl and following formula:

Z ' _p ^-For-CO ₂ ^-,-SO ₃ ^-Or-OSO ₃ ^-, p is 1 or 2.

Most preferably Gai Evil ethylene imine zwitter-ion of ， is the ion with following formula [XIVa] expression: R wherein ⁴¹-R ⁴⁴Can be independently selected from replacement or unsubstituted group, these groups are selected from H, straight or branched, replacement or unsubstituted alkyl, and cycloalkyl, alkaryl, aryl, aralkyl, alkylidene group, alkoxyl group, condition is any one R ⁴¹-R ⁴⁴Can be with any one other R ⁴¹-R ⁴⁴In conjunction with a part that forms common ring; More preferably, R ⁴¹-R ⁴⁴In at least one, even more preferably at least two be H.Most preferably, R ⁴¹And/or R ⁴⁴Be straight or branched C ₁-C ₁₆Alkyl or cycloalkyl, even more preferably, R ⁴¹And R ⁴⁴In the carbonatoms sum be 5-15, most preferably be 6-13.

The organic catalyst compound concentrations-zwitter-ion organic catalysis immunomodulator compounds of the present invention (bleach boosters compound and albic material) can and preferably add in the washing soln that is generally aqueous cleaning solution, its consumption is that about 0.00001% (0.0001ppm) of said composition weight is to about 10% (100ppm), about 0.0001% (0.001ppm) that is preferably said composition weight is to about 1% (10ppm), more preferably about 0.001% (0.01ppm) is to about 0.5% (5ppm), even more preferably about 0.004% (0.04ppm) is to about 0.25% (2.5ppm).Most preferably from about 0.01% (0.1ppm) is to about 0.1% (1ppm).

For illustrative purposes, the use product that with concentration is 1000ppm is the basis, and concentration conversion value (is unit with ppm) is provided.The product that contains 0.2wt% organic catalysis immunomodulator compounds is made into the washing soln of 1000ppm, and the organic catalyst compound concentrations that obtains is 2ppm.Similarly, the product that contains 0.2wt% organic catalysis immunomodulator compounds is made into the washing soln of 3500ppm, and the organic catalyst compound concentrations that obtains is 6.5ppm.The decomposition of organic catalyst

Organic catalyst of the present invention particularly bleach boosters compound is easy to decompose by various decomposition approach, and the decomposition approach comprises but is not defined as the aromizing approach.The aromatization of six-ring synergistic agent (decomposition) is being known in the art, and is not subjected to theoretic restriction, appears at people's such as Hanquet Tetrahedron 1993,49 as its typical example, the 423-438 page or leaf.Other is olation comprises but is not defined as with nucleophilic reagent attacks bleach boosters compound and/or albic material, it comprises but is not defined as uses hydroxide radical anion, cross hydroxide radical anion, carboxylate anion, the attack of percarboxylic acids root negatively charged ion and other nucleophilic reagent that under wash conditions, exists.The delay of organic catalysis immunomodulator compounds (control) addition means

Work-ing life is during limited organic catalysis immunomodulator compounds, be surprisingly found out that adding washing soln at fabric adds the organic catalysis immunomodulator compounds in the washing soln to by e Foerderanlage after especially containing the washing soln of peroxygen source, with add washing soln at fabric before add this organic catalysis immunomodulator compounds to washing soln and compare, have the bleaching of raising.Be not subjected to theoretic restriction, can think that this organic catalysis immunomodulator compounds decomposed before introducing fabric in washing soln.A kind of method of improving the performance of organic catalysis immunomodulator compounds is that organic catalysis immunomodulator compounds of the present invention is postponed to add in the washing soln.The another kind of method of improving the organic catalyst compounds property is the organic catalysis immunomodulator compounds that stability in use increases under wash conditions.The method that postpones the organic catalyst compound of (control) interpolation is described in greater detail in the common unsettled and total U.S. Provisional Patent Application (P﹠amp that the name of applying on August 27th, 1999 is called " Controlled Availability of FormulationComponents, Compositions and Laundry Methods Employing Same "; The G proxy number is 7749P) in.The bleach system that comprises zwitter-ion organic catalysis immunomodulator compounds

Except the purposes of above-mentioned zwitter-ion organic catalysis immunomodulator compounds, zwitter-ion organic catalysis immunomodulator compounds of the present invention can with or not with, but preferred peroxygen source in other bleach system is used in combination, and no matter their form how.For example, zwitter-ion organic catalysis immunomodulator compounds can be used in the detergent additive product.In bleach system of the present invention, the amount that peroxygen source exists be said composition weight about 0.1% to about 60%, preferably about 1% of said composition weight to about 40%.In composition, the amount of organic catalysis immunomodulator compounds is about 0.00001% to about 10% of this system weight, preferably about 0.0001% of this system weight to about 1%, and more preferably from about 0.001% to about 0.5%, even more preferably from about 0.004% to about 0.25%.Most preferably from about 0.01% to about 0.1%.

Bleach system of the present invention is in laundry applications, and stiff dough cleans, and the automatic bowl dish is used and cosmetic application such as artificial tooth, tooth, and the use of hair and skin aspect all is favourable.Yet, the distinct advantages that has the washing effect of protecting look and increase of increase in the aqueous solution that may be warm owing to the stability that may increase in cold-peace, organic catalysis immunomodulator compounds of the present invention is ideally suited in laundry applications very much, for example contains the sanitising agent or the laundry bleaching additive bleached woven fabric of SYNTHETIC OPTICAL WHITNER by use.And bleach boosters compound of the present invention can be used in particle and the liquid composition.

Zwitter-ion organic catalysis immunomodulator compounds can be used as antiseptic-germicide and sterilizing agent with the bleach system that comprises this organic catalysis immunomodulator compounds.

Therefore, bleach system of the present invention can comprise the supplementary component that needs in the various washings application.These compositions comprise detergent surfactant, bleaching catalyst, and washing assistant, sequestrant, enzyme, the trowel used for plastering agent is gone in polymerization, whitening agent and various other composition.The pH value of composition in 1% bleach system solution that comprises any these various supplementary components is preferably about 6 to about 12, preferred about 8 to about 10.5.

Bleach system preferably comprises at least a detergent surfactant, at least a sequestrant, and at least a detersive enzyme and the pH value in 1% bleach system solution preferably about 6 are to about 12, preferred 8 to about 10.5.

In another embodiment of the present invention, provide the especially method of colored fabric of fabric that washing needs washing.Preferable methods comprises fabric is contacted with washing soln.Fabric can comprise any fabric that great majority can wash under the ordinary consumer working conditions.Washing soln comprises the bleach system that contains one or more zwitter-ion organic catalysis immunomodulator compounds of the present invention that describes in detail as the application.Preferably about 0 ℃ extremely about 50 ℃ or higher of water temperatures.The ratio of water and fabric preferably about 1: 1 to about 15: 1.

Washing soln can also comprise at least a supplementary component, and this supplementary component is selected from detergent surfactant, sequestrant, detersive enzyme and its mixture.Preferably, the pH value of washing soln in 1% bleach system solution is about 6 to about 12, preferred about 8 to about 10.5.

The general peroxygen source that also preferably comprises of bleach system of the present invention.Peroxygen source is being known in the art and peroxygen source used in this invention can comprise the known peroxygen source of any of these, and these peroxygen sources comprise peralcohol and produce the compound of significant quantity peroxide then and there under human consumer's working conditions.This peroxygen source can comprise hydrogen peroxide cource, crosses acid anion by what the reaction of hydrogen peroxide cource and bleach-activating agent formed then and there, the mixture of prefabricated peracid compound or suitable peroxygen source.Certainly, those of ordinary skill in the art will recognize that and under the situation that does not depart from the scope of the invention, also can use other peroxygen source.Preferably, peroxygen source is selected from:

(i) prefabricated peracid compound, it is selected from percarboxylic acids and salt, percarbonic acid and salt are crossed imido acid and salt, permonosulphuric acid and salt, with and composition thereof and

(ii) hydrogen peroxide cource, it is selected from the perborate compound, the percarbonate compound, the superphosphate compound with and composition thereof and bleach-activating agent.

When having peroxygen source (peracid and/or hydrogen peroxide cource), its amount generally is about 1% from said composition weight, preferably from about 5% to about 30%, preferably to about 20%.If there is bleach-activating agent, its amount generally is from comprising bleach system weight about 0.1% that SYNTHETIC OPTICAL WHITNER adds bleach-activating agent, preferably from about 0.5% to about 60%, preferably to about 40%.

A. the prefabricated peracid compound of using among prefabricated peracid-the application is for stable and can provide the significant quantity peracid anionic any compound easily under human consumer's working conditions.Organic catalyst of the present invention certainly uses with prefabricated peracid compound, and this peracid compound is selected from percarboxylic acids and salt, percarbonic acid and salt, cross imido acid and salt, permonosulphuric acid and salt and its mixture, its example are described in people's such as Miracle United States Patent (USP) 5, in 576,282.

The organic peroxy carboxylic acid that one class is suitable has following general formula:

Wherein R contains 1 alkylidene group or substituted alkylene to about 22 carbon atoms, or phenylene or substituted phenylene, and Y is a hydrogen, halogen, alkyl, aryl ,-C (O) OH or-C (O) OOH.

Be applicable to that organic peroxide acid of the present invention can contain one or two peroxy-radical, and can be aliphatics or aromatic.When this organic peroxy carboxylic acid was aliphatics, unsubstituted peracid had following general formula: Wherein Y for example can be H, CH ₃, CH ₂Cl, C (O) OH, or C (O) OOH; N is 0 to 20 integer.When this organic peroxy carboxylic acid was aromatic series, unsubstituted peracid had following general formula:

Wherein Y for example can be a hydrogen, alkyl, alkylogen, halogen, C (O) OH or C (O) OOH.

Be applicable to that general single peroxy acid of the present invention comprises alkyl and aryl peroxy acids, as:

(i) benzoyl hydroperoxide and cyclosubstituted benzoyl hydroperoxide, peroxide-α-Nai Jiasuan for example, single peroxide phthalic acid (magnesium salts hexahydrate) and phthalamidic acid base are crossed oxy hexanoic acid (sodium salt);

(ii) aliphatics, replace aliphatics and aralkyl list peroxy acid, peroxide lauric acid for example, peroxide stearic acid, the amino oxy hexanoic acid (NAPCA) of crossing of N-nonanoyl, N, amino oxy hexanoic acid (SAPA) and the N of crossing of N-(3-octyl group succinyl), the amino oxy hexanoic acid (PAP) of crossing of N-phenyl-diformyl;

(iii) amido peroxy acid is as single nonyl acid amides (NAPSA) of crossing oxydisuccinic acid or single nonyl acid amides (NAPAA) of peroxide hexanodioic acid.

Be applicable to that typical diperoxy acid of the present invention comprises acid of alkyl diperoxy and the acid of aryl diperoxy, for example:

(iv) 1,12-diperoxy dodecanedioic acid;

(v) 1, the 9-diperoxyazelaic acid;

(vi) diperoxy undecane dicarboxylic acid; Diperoxy sebacic acid and diperoxy m-phthalic acid;

(vii) 2-decyl diperoxy butane-1,4-diacid;

(viii) 4,4 '-alkylsulfonyl diperoxy phenylformic acid.

These SYNTHETIC OPTICAL WHITNER are disclosed in the United States Patent (USP) 4 that 1984.11.20 is issued to Hartman, 483,781, people's such as Burns United States Patent (USP) 4,634,551, people's such as the disclosed Banks of 1985.2.20 european patent application 0,133,354, and 1983.11.1 is issued in people's such as Chung the United States Patent (USP) 4,412,934.The peroxide acid source comprises that also the 6-nonyl amino-6-oxo that is described in detail in the United States Patent (USP) 4,634,551 that 1987.1.6 is issued to people such as Burns crosses oxy hexanoic acid.For example by Wilmington, the persulfate compound of the OXONE of the E.I.DuPont de Nemours merchant system of DE also can be used as suitable permonosulphuric acid source.

B. hydrogen peroxide cource-hydrogen peroxide cource can be any suitable hydrogen peroxide cource, and the amount of its existence is as at United States Patent (USP) 5,576, describes in detail in 282.For example, hydrogen peroxide cource can be selected from the perborate compound, percarbonate compound, superphosphate compound and its mixture.

Hydrogen peroxide cource is specified in the Encyclopedia of Chemical Technology of the Kirk Othmer that is incorporated herein by reference in this application, the 4th edition (1992, John Wiley﹠amp; Sons), the 4th volume, in the 271-300 page or leaf " Bleaching Agents (Survey) ", it comprises various forms of Sodium peroxoborate and SPC-D, comprises the form of various coatings and modification.

Be applicable to that preferred hydrogen peroxide cource of the present invention can be any source easily that comprises hydrogen peroxide self.For example, perborate, as Sodium peroxoborate (any hydrate but preferred single-or four-hydrate), yellow soda ash peroxyhydrate or percarbonate of equal value, the trisodium phosphate peroxyhydrate, the urea peroxyhydrate, or sodium peroxide can be with in the present invention.Also can use for example persulfuric acid SYNTHETIC OPTICAL WHITNER (as the OXONE of DuPont manufacturing) of effective oxygen source.Sodium peroxoborate monohydrate and SPC-D are preferred especially.Also can use the mixture of any hydrogen peroxide cource easily.

Preferred percarbonate bleach comprise mean particle size range about 500 microns to about 1000 microns dried particles, in these particles, the described particle that is no more than about 10wt% is less than about 200 microns, and the described particle that is no more than about 10wt% is greater than about 1,250 micron.Randomly be, this percarbonate can be used silicate, and borate or water soluble surfactant active apply.Percarbonate can be from various commercial source such as FMC, and Solvay and Tokai Denka are purchased.

Composition of the present invention also can comprise chlorine type albic material as SYNTHETIC OPTICAL WHITNER.These reagent are being known in the art, and for example comprise dichloroisocyanuric acid sodium (" NaDCC ").Yet for the composition that comprises enzyme, chlorine type SYNTHETIC OPTICAL WHITNER is not preferred.

C. bleach-activating agent-preferably, the peroxygen source in the composition is prepared with activator (peracid precursors).The amount of this activator is about 0.01% from said composition weight, preferably from about 0.5%, more preferably from about 1% to about 15%, preferably to about 10%, more preferably to about 8%.The bleach-activating agent that uses among the application is the on-the-spot any compound that generates corresponding to the peracid of bleach-activating agent when using with hydrogen peroxide cource.The various indefiniteness example full disclosure of activator is at United States Patent (USP) 5,576,282, United States Patent (USP) 4,915,854 and United States Patent (USP) 4,412,934 in.Also can be for other the general SYNTHETIC OPTICAL WHITNER used among the application and activator referring to United States Patent (USP) 4,634,551.

Preferred activator is selected from tetraacetyl ethylene diamine (TAED), benzoyl caprolactam (BzCL), 4-oil of mirbane formyl hexanolactam, 3-chlorobenzoyl hexanolactam, benzoyloxy benzene sulfonate (BOBS), nonanoly acyloxy benzene sulfonate (NOBS), phenol benzoate (PhBz), the last of the ten Heavenly stems acyloxy benzene sulfonate (C ₁₀-OBS), benzoyl Valerolactim (BZVL), hot acyloxy benzene sulfonate (C ₈-OBS), it can fully hydrolyzed ester and mixture, most preferably benzoyl caprolactam and benzoyl Valerolactim.PH is the bleach-activating agent with OBS or VL leavings group that about 8 to about 9.5 o'clock particularly preferred bleach-activating agents are those selections.

Preferred hydrophobic bleach activator comprises but is not defined as nonanoly acyloxy benzene sulfonate (NOBS); the amino hexylyloxy of 4-[N-(nonanoyl)]-(one of them example is described in United States Patent (USP) 5 to Phenylsulfonic acid sodium salt (NACA-OBS); in 523,434), bay acyloxy benzene sulfonate (LOBS or C ₁₂-OBS), 10-undecanoyl oxygen base benzene sulfonate (UDOBS or 10 undersaturated C ₁₁-OBS) and caprinoyl aminobenzoic acid (DOBA).

Preferred bleach-activating agent is that those are described in the United States Patent (USP) 5,698,504 that the bleach-activating agent in the following patent: 1997.12.16 is issued to people such as Christie; 1997.12.9 be issued to people's such as Christie United States Patent (USP) 5,695,679; 1997.11.11 be issued to people's such as Willey United States Patent (USP) 5,686,401; 1997.11.11 be issued to people's such as Hartshorn United States Patent (USP) 5,686,014; 1995.4.11 be issued to people's such as Willey United States Patent (USP) 5,405,412; 1995.4.11 be issued to people's such as Willey United States Patent (USP) 5,405,413; 1992.7.14 be issued to people's such as Mitchel United States Patent (USP) 5,130,045; Be issued to people's such as Chung United States Patent (USP) 4,412,934 with 1983.11.1, and common unsettled U.S. Patent application 08/709,072,08/064,564, be incorporated herein these documents as a reference.

The mol ratio of peroxy bleaching compound among the present invention (as AvO) and bleach-activating agent is generally from least 1: 1, and preferably from about 20: 1, more preferably from about 10: 1 to about 1: 1, preferably to about 3: 1.

The bleach-activating agent that also can comprise tetrasubstituted.Bleach system of the present invention preferably comprises the bleach-activating agent (QSBA) of tetrasubstituted or the peracid (QSP) of tetrasubstituted; More preferably the former.Preferred QSBA structure further describes in following patent: 1997.11.11 is issued to people's such as Willey United States Patent (USP) 5,686,015; 1997.8.5 be issued to people's such as Taylor United States Patent (USP) 5,654,421; 1995.10.24 be issued to people's such as Gosselink United States Patent (USP) 5,460,747; 1996.12.17 be issued to people's such as Miracle United States Patent (USP) 5,584,888; Be issued to people's such as Taylor United States Patent (USP) 5,578,136 with 1996.11.26; Be incorporated herein these documents as a reference.

Be applicable to that highly preferred bleach-activating agent of the present invention is the acid amides substituent, this is described in United States Patent (USP) 5,698,504, United States Patent (USP) 5,695,679 and United States Patent (USP) 5,686,014 in, each patent was all quoted in the above.The preferred example of these bleach-activating agents comprises: (the amino caproyl of 6-decoyl) oxygen benzene sulfonate, (the amino caproyl of 6-nonanoyl) oxygen benzene sulfonate, (the amino caproyl of 6-caprinoyl) oxygen benzene sulfonate and its mixture.

Draw exhausted United States Patent (USP) 5 in the above, 698,504, United States Patent (USP) 5,695,679, United States Patent (USP) 5,686,014 and 1990.10.30 be issued to people's such as Hodge United States Patent (USP) 4,966, disclosed other useful activator in 723, comprise benzoxazine type activator, for example on 1,2, condensed-C (O) OC (R ¹)=N-partial C ₆H ₄Ring.

Rely on this activator and use accurately, the pH when it uses is about 6 bleaching effects that can obtain to about bleach system of 13, preferably about 9.0 to about 10.5.Usually, for example in nearly neutrality or inferior neutral pH scope, use activator with electrophilic part.Can guarantee such pH value with alkali and buffer reagent.

Draw exhausted United States Patent (USP) 5 in the above; 698; 504, United States Patent (USP) 5,695, and 679 and United States Patent (USP) 5; 686; the acyl lactam activator of describing in 014 is very useful in the present invention, and useful especially is that acyl caprolactam (for example seeing WO 94-28102A) and acyl group Valerolactim (see that 1996.4.2 is issued to people's such as Willey United States Patent (USP) 5,503; 639, it is for reference that the application introduces this patent).

D. organo-peroxide, particularly diacyl peroxide-except above-mentioned SYNTHETIC OPTICAL WHITNER, bleach system of the present invention can randomly comprise organo-peroxide.Organo-peroxide is described in Kirk Othmer widely, Encyclopedia of Chemical Technology, and the 17th volume, John Wiley and Sons, 1982, the 27-90 pages or leaves, particularly 63-72 page or leaf all are incorporated herein by reference at this.If the use diacyl peroxide, it will be preferably to going spot/cuticula to have the diacyl peroxide of minimal negative effect.

E. metallic bleaching catalyst-this bleach system also can randomly comprise metallic bleaching catalyst, preferably contains the bleaching catalyst of magnesium and cobalt.

A kind of metallic bleaching catalyst is to comprise to have the active transition-metal cation of defined bleach catalyst such as copper, iron, titanium, ruthenium, tungsten, molybdenum or manganese positively charged ion, have little or do not have the active assistant metal positively charged ion of bleach catalyst for example zinc or aluminium cations, and have the sequestrant of catalysis and the defined stability constant of assistant metal positively charged ion ethylenediamine tetraacetic acid (EDTA) particularly, the catalyst system of ethylenediamine tetraacetic (methylene phosphonic acid) and its water-soluble salt.These catalyzer are disclosed in the United States Patent (USP) 4,430,243 that 1982.2.2 is issued to Bragg.

I. the manganese metal complexes-if desired, composition of the present invention can be used manganic compound catalysis.This compound and consumption thereof are being known in the art, and comprise as being disclosed in the United States Patent (USP) 5,576,282 that the manganese-based catalyst in the following patent: 1996.11.19 is issued to people such as Miracle; 1993.9.21 be issued to people's such as Favre United States Patent (USP) 5,246,621; 1993.9.14 be issued to people's such as Favre United States Patent (USP) 5,244,594; 1993.3.16 be issued to people's such as Jureller United States Patent (USP) 5,194,416; 1992.5.19 be issued to people's such as vanVliet United States Patent (USP) 5,114,606; With european patent application 549,271A1,549,272A1,544,440A2 and 544,490A1; The preferred example of these catalyzer comprises Mn ^IV ₂(u-O) ₃(1,4,7-trimethylammonium-1,4,7-7-triazacyclononane) ₂-(PF ₆) ₂, Mn ^III ₂(u-O) ₁(u-OAc) ₂(1,4,7-trimethylammonium-1,4,7-7-triazacyclononane) ₂(ClO ₄) ₂, Mn ^IV ₄(u-O) ₆(1,4, the 7-7-triazacyclononane) ₄(ClO ₄) ₄, Mn ^IIIMn ^IV ₄(u-O) ₁(u-OAc) ₂-(1,4,7-trimethylammonium-1,4,7-7-triazacyclononane) ₂(ClO ₄) ₃, Mn ^IV(1,4,7-trimethylammonium-1,4,7-7-triazacyclononane)-(OCH ₃) ₃(PF6) and its mixture.Other metal matrix bleaching catalyst comprises those catalyzer in the United States Patent (USP) 5,114,611 that United States Patent (USP) 4,430,243 that those are disclosed in the reference of top the application institute and 1992.5.19 be issued to van Kralingen.Use to strengthen the bleaching property and also be reported in the following patent: 1988.3.1 as the manganese with various dentates of purpose and be issued to the United States Patent (USP) 4,728,455 of Rerek; 1994.2.8 be issued to the United States Patent (USP) 5,284,944 of Madison; 1993.9.21 be issued to people's such as van Dijk United States Patent (USP) 5,246,612; 1993.10.26 be issued to people's such as Kerschner United States Patent (USP) 5,256,779; 1994.1.18 be issued to people's such as Kerschner United States Patent (USP) 5,280,117; 1993.12.28 be issued to people's such as Kerschner United States Patent (USP) 5,274,147; 1992.10.6 be issued to people's such as Kerschner United States Patent (USP) 5,153,161 and the United States Patent (USP) 5,227,084 that 1993.7.13 is issued to people such as Martens.

Ii. cobalt metal compounding-be applicable to that cobalt bleaching catalyst of the present invention is known, it is described in as in the following document: 1997.1.28 is issued to people's such as Perkins United States Patent (USP) 5,597,936; 1997.1.21 be issued to people's such as Miracle United States Patent (USP) 5,595,967; 1997.12.30 be issued to people's such as Perkins United States Patent (USP) 5,703,030; And M.L.Tobe, " basic hydrolysis of transition metal complex ", Adv.Inorg.Bioinorg.Mech., (1983), 2,1-94 page or leaf.Be applicable to that most preferred cobalt catalyst of the present invention is that molecular formula is [Co (NH ₃) ₅OAc] T _yFive amine acetate cobalt salts, " OAc " expression acetate moiety part wherein, " T _y" be negatively charged ion, particularly chlorination five amine acetate close cobalt [Co (NH ₃) ₅OAc] Cl ₂And [Co (NH ₃) ₅OAc] (OAc) ₂[Co (NH ₃) ₅OAc] (PF ₆) ₂[Co (NH ₃) ₅OAc] (SO ₄); [Co (NH ₃) ₅OAc] (BF ₄) ₂[Co (NH ₃) ₅OAc] (NO ₃) ₂(being write as " PAC " herein).

These cobalt catalyst are easy to by the already known processes preparation, for example according to the method preparation of instructing in the following document: draw exhausted United States Patent (USP) 5,597 in the above, 936, United States Patent (USP) 5,595,967, United States Patent (USP) 5,703,030 and the article of Tobe cited herein and reference and 1989.3.7 be issued to people's such as Diakun United States Patent (USP) 4,810,410, J.Chem.Ed. (1989), 66 (12), the 1043-45 page or leaf; Synthetic and the sign of mineral compound, W.L.Jolly (Prentice-Hall; 1970), 461-3 page or leaf; Inorg.Chem., 18,1497-1502 (1979); Inorg.Chem., 21,2881-2885 (1982); Inorg.Chem., 18,2023-2025 (1979); Inorg.Synthesis, 173-176 (1960); With Journal of Physical Chemistry, 56,22-25 (1952).

Iii. transition metal complex-the composition of the present invention that has most ring rigidity ligand also can suitably comprise the transition metal complex as the most ring rigidity of having of bleaching catalyst ligand.Phrase " encircles the rigidity ligand mostly " and is abbreviated as " MRL " when being discussed below sometimes.Its consumption is an effective catalytic amount, be suitably about 1ppb or higher,, be more typically about 0.001ppm or higher for example up to about 99.9%, preferably from about 0.05ppm to about 500ppm (wherein " ppb " refers to part per billion weight part, and " ppm " refers to 1,000,000/weight part).

To describe suitable transition metal such as Mn below." mostly ring " meaning be MRL be big ring be again polycyclic." polycyclic " refers to dicyclo at least.The term that uses among the application " rigidity " comprises " having superstructure " and " cross-bridge is arranged "." rigidity " definition is just in time opposite with elasticity: referring to D.H.Busch., and Chemical Reviews., (1993), and 93,847-860 is hereby incorporated by.More particularly, " rigidity " used in this application refers to that the rigidity of this MRL must can survey big qualitatively than the rigidity of big ring (" the big ring of parent "), the structure of the two identical (having the ring identical size and type and atom number) wherein with main ring, but big ring (" the big ring of parent ") does not have the superstructure (particularly connection portion or preferably cross-bridge part) among the MRL.When mensuration had and do not have the relative rigidity of big ring of superstructure, the operator can use the big ring of free form (nonmetal key form).It is known that rigidity is used in the bigger ring; Suitable mensuration, measurement or comparison inflexible instrument comprise method of calculation (referring to as Zimmer, Chemical Reviews, (1995), 95 (38), people such as 2629-2648 or Hancock, Inorganica Chimica Acta, (1989), 164,73-84).

Preferred L RL of the present invention is the super rigidity ligand that a class has cross-bridge especially.Below 1.11 in " cross-bridge " carried out the indefiniteness explanation.In 1.11, cross-bridge is-the CH2CH2-part.It is bridge joint N in illustrative structure ¹And N ⁸By comparison, " same side " bridge joint is if for example introduce the crosslinked N of this bridge joint in 1.11 ¹And N ¹², be not enough to constitute " cross-bridge ", not preferred therefore.

In the title complex of rigidity ligand, suitable metal comprises Mn (II), Mn (III), Mn (IV), Mn (V), Fe (II), Fe (III), Fe (IV), Co (I), Co (II), Co (III), Ni (I), Ni (II), Ni (III), Cu (I), Cu (II), Cu (III), Cr (II), Cr (III), Cr (IV), Cr (V), Cr (VI), V (III), V (IV), V (V), Mo (IV), Mo (V), Mo (VI), W (IV), W (V), W (VI), Pd (II), Ru (II), Ru (III), and Ru (IV).Preferred transition metal comprises manganese, iron and chromium in transition metal bleach catalyzer of the present invention.

More generally be to be applicable to that MRL of the present invention (with corresponding transition-metal catalyst) comprises:

(a) at least one big ring main ring, it comprises four or a plurality of heteroatoms; With

What (b) covalency connected can increase the nonmetal superstructure of above-mentioned big ring inflexible, and it is preferably selected from

(i) bridge joint superstructure, for example coupling part;

(ii) cross-bridge superstructure, for example cross-bridge coupling part; With

(iii) its mixture.

Term used in this application " superstructure " is for example seen the article of Busch in " Chemical Reviews " as people's such as Busch document definition.

The preferred superstructure of the application has not only improved the rigidity of the big ring of parent, and helps the folding of big ring, make its in the slit with metal-complexing.Suitable superstructure can be very simple, coupling part for example, and any one part as shown in following Fig. 1 and Fig. 2 can be used.

Fig. 1 wherein n is an integer, and for example 2-8 preferably less than 6, generally is 2-4, or

Fig. 2 wherein, m and n are the integer of about 1-8, more preferably 1-3; Z is N or CH; T is compatible substituting group, as H, and alkyl, trialkyl ammonium, halogen, nitro, sulfonate radical etc.Aromatic nucleus in 1.10 can replace with saturated rings, and the atom that wherein connects into this ring among the Z can comprise N, O, S or C.

Suitable MRL further carries out the explanation of indefiniteness ground with following compound:

This is the highly preferred MRL of the present invention for Fig. 3, and it is crosslinked, the cyclam derivative of methyl substituted (all nitrogen-atoms all are tertiary N atoms).This ligand is 5 with the Von Baeyer system definite designation of expansion, 12-dimethyl-1,5,8,12-four azabicyclos [6.6.2] n-Hexadecane.See " AGuide to IUPAC Nomenclature of Organic Compounds:Recommendations 1993 ", R.Panico, W.H.Powell and J-C Richer (Eds.), Blackwell Scientific Publications, Boston, 1993; See the R-2.4.2.1. part especially.

The transition metal bleach catalyzer that is applicable to the big ring rigidity of having of present composition ligand generally comprises the known compound that meets the application's definition and is more preferably any of a large amount of special new compounds for existing washing or cleaning use design, with following any compound it is carried out indefiniteness for example: two chloro-5,12-dimethyl-1,5,8,12-four azabicyclos [6.6.2] hexadecane manganeses (II) two hydrations-5,12-dimethyl-1,5,8,12-four azabicyclos [6.6.2] n-Hexadecane phosphofluoric acid manganese (II) hydration-hydroxyl-5,12-dimethyl-1,5,8,12-four azabicyclos [6.6.2] n-Hexadecane phosphofluoric acid manganese (III) two hydrations-5,12-dimethyl-1,5,8,12-four azabicyclos [6.6.2] n-Hexadecane Tetrafluoroboric acid manganese (II) two chloro-5,12-dimethyl-1,5,8,12-four azabicyclos [6.6.2] n-Hexadecane phosphofluoric acid manganese (III) two chloro-5,12-di-n-butyl-1,5,8,12-four azabicyclos [6.6.2] hexadecane manganeses (II) two chloro-5,1 2-dibenzyl-1,5,8,12-four azabicyclos [6.6.2] hexadecane manganeses (II) two chloro-5-normal-butyl-12-methyl isophthalic acids, 5,8,12-four azabicyclos [6.6.2] hexadecane manganeses (II) two chloro-5-n-octylcyclam 2-methyl isophthalic acids, 5,8,12-four azabicyclos [6.6.2] hexadecane manganeses (II) two chloro-5-normal-butyl-12-methyl isophthalic acids, 5,8,12-four azabicyclos [6.6.2] hexadecane manganeses (II)

F. other bleaching catalyst-composition of the present invention can comprise one or more other bleaching catalysts.Preferred bleaching catalyst is the zwitter-ion bleaching catalyst, and it is described in United States Patent (USP) 5,576, in 282 (particularly 3-(3, the 4-dihydro-isoquinoline) propane sulfonate).Other bleaching catalyst comprises the cationic bleach catalyzer, is described in United States Patent (USP) 5,360,569,5,442,066,5,478,357,5,370,826,5,482,515,5,550,256 and WO95/13351, and among WO 95/13352 and the WO 95/13353.

As a concrete instance, be not to be in order to limit, can regulate the application's composition and cleaning method so that the active bleach catalyst material of 1/100,000,000 order of magnitude is provided in the aqueous cleaning medium, in washings, preferably provide about 0.01ppm to about 25ppm, more preferably from about 0.05ppm is to about 10ppm, and most preferably from about 0.1ppm is to the bleach catalyst material of about 5ppm.In order in the washings of automatic washing process, to obtain this concentration, comprise in the exemplary composition of the present invention this cleaning compositions weight about 0.0005% to about 0.2%, particularly manganese or cobalt catalyst of 0.004% to about 0.08% bleaching catalyst more preferably from about.

Preferably, peroxygen source is selected from hydrogen peroxide cource and bleach-activating agent, and hydrogen peroxide cource is selected from the perborate compound, percarbonate compound, superphosphate compound and its mixture.

Preferably, bleach-activating agent is selected from the disclosed hydrophobic bleach activator as the application.

The purpose of this bleach system is to weaken the unwanted decomposition of organic catalyst, and the fabric that peracid was cleaned needs in washing soln before organic catalyst works produces bleaching action as the fabric that besmirches.

In washing soln, activate and the time period of organic catalysis immunomodulator compounds between activating is about 1 second to about 24 hours at peracid.In addition, because the organic catalysis immunomodulator compounds is relatively stable in washing soln, peracid can activate in washing soln after the organic catalysis immunomodulator compounds activates or be effective.

The purpose of postpone adding bleach system (can with or be not used in combination with the present invention) is that the fabric that peracid was cleaned needs in washing soln before introducing the organic catalysis immunomodulator compounds produces maximum bleaching action as the fabric that besmirches.In other words, the organic catalysis immunomodulator compounds that comprises in the bleach system activates in washing soln after the fabric that needs clean adds washing soln.Another kind of scheme is, because the organic catalysis immunomodulator compounds has the stability of increase, therefore the organic catalysis immunomodulator compounds in the operable bleach system activated in washing soln before the fabric that needs clean adds washing soln.

The preferred bleach system of the present invention is the bleach system that comprises following substances:

(a) peroxygen source; With

(b) zwitter-ion organic catalysis immunomodulator compounds;

Wherein, zwitter-ion organic catalysis immunomodulator compounds is containing after described peroxygen source activates for some time in the washing soln of described bleach system and is activating.As mentioned above, peroxygen source is preferably selected from:

(i) prefabricated peracid compound, it is selected from percarboxylic acids and salt, percarbonic acid and salt are crossed imido acid and salt, permonosulphuric acid and salt and its mixture and

(ii) hydrogen peroxide cource, it is selected from the perborate compound, the percarbonate compound, the superphosphate compound with and composition thereof, and bleach-activating agent.

Except previously described one or more organic catalysts of the application, bleach system of the present invention also preferably comprises one or more cleaning additive materials, this auxiliary agent preferably with bleach system in the organic catalyst and/or all enzymes that exist compatible.The meaning of term used in this application " compatible " is: the material of this bleach system can not be attenuated to this organic catalyst and/or the so effectively degree of enzyme not as needing under the regular service condition made from the bleaching activity of the organic catalyst that exists in the bleach system and/or any enzymic activity of any enzyme.The meaning of term used in this application " cleaning additive material " is: for the bleach system of the special type that obtains needing and product form (as liquid; Particle; Powder; Bar; Stick with paste; The mist agent; Tablet; Colloid; Foam composition) any liquid of Xuan Zeing, solid or gaseous matter, these materials also preferred with the proteolytic enzyme and the bleach-compatible that are used for said composition.Particulate composition also can be " closely knit " form, and liquid composition also can be " concentrating " form.

By considering surface to be cleaned, item or fabric and the wash conditions desired combined thing form of (as the use by the washing sanitising agent) in using being carried out the concrete selection of cleaning additive material easily.Suitable cleaning additive examples of material comprises but is not defined as and is described in United States Patent (USP) 5,705,464,5,710,115,5,698,504,5,695,679,5,686,014 and 5, tensio-active agent in 646,101, washing assistant, SYNTHETIC OPTICAL WHITNER, bleach-activating agent, bleaching catalyst, other enzyme, enzyme stabilising system, sequestrant, brightening agent, soil release polymer, dye-transfer, dispersion agent, suds suppressor, dyestuff, spices, tinting material, filling salt, hydrotropic agent, light activating agent, fluorescent agent, fabric conditioner, hydrolyzable tensio-active agent, sanitas, antioxidant, antishrinking agent, anti wrinkling agent, sterilant, mycocide, colored spot jewelry protects silver-colored agent (silvercare), rust-preventive agent and/or corrosion inhibitor, alkaline source, solubilizing agent, carrier, processing aid, pigment and PH control agent.The detailed description of will giving an example in the application back of concrete bleach system material.

If the cleaning additive material not with bleach system in various ease variants compatible, can use so suitable method with cleaning additive material and various ease variants separately (not contacting each other) mix up to these two kinds of components.Suitable method can be any methods known in the art, example gel capsule (gelcaps), capsule, tablet, physical sepn etc.

This bleach system comprises the detergent composition that cleans stiff dough, and its form is not limit (liquid for example, particle are stuck with paste foam, spray etc.); The detergent composition of cleaning fabric, its form are not limit (for example particle, liquid, strip preparation etc.); Composition (form does not limit, and comprises particle and the agent of liquid automatic bowl) washes the dishes; Oral cavity bleach system, its form are not limit (for example tooth powder, toothpaste and mouth wash shua); With the artificial tooth bleach system, its form is not limit (for example liquid, tablet).

Fabric bleaching system of the present invention mainly wants to be used for the cycles of washing of washing machine; Yet, can consider other purposes, for example the prefinished products or the infusion product of counterweight dirt fabric; Its purposes not necessarily is restricted in the washing machine application, and composition of the present invention can use separately or be used in combination with compatible hand washing composition.

Bleach system can comprise about 1% to about 99.9% the cleaning additive material that accounts for composition weight.

" non-woven bleach system " used in this application comprises the stiff dough bleach system, the composition that washes the dishes, oral cavity bleach system, artificial tooth bleach system and personal cleaning compositions.

When bleach system of the present invention is mixed with the composition that is applicable to washing machine washing method, composition of the present invention preferably comprises tensio-active agent and washing-aid compound and additional one or more cleaning additive materials, this cleaning additive material is preferably selected from organic polymer, SYNTHETIC OPTICAL WHITNER, additional enzymes, suds suppressor, dispersion agent, lime soap dispersing agent, dirt suspension and anti redeposition agent and inhibiter.Laundry composition also can comprise the softening agent as additional cleaning additive material.

Composition of the present invention also can be used as the detergent additives product with solid or liquid form.This additive product is used for replenishing or improving the performance of conventional washing agent composition, and can add in any stage of cleaning process.

When being mixed with the composition that is used for manual bowl washing method, composition of the present invention preferably comprises tensio-active agent and preferred other cleaning additive material, and the cleaning additive material is selected from organic polymer, suds booster, II family metal ion, solvent, hydrotropic agent and additional enzymes.

If desired, the density of these laundry detergent compositions of measuring under 20 ℃ is the composition of 400-1200g/l, the composition of preferred 500-950g/l.

With regard to composition, the most handy density of " closely knit " form of bleach system of the present invention and the reflection of the amount of mineral filler salt; Mineral filler salt is the traditional composition in the detergent composition of powder type; In traditional detergent composition, filling salt exists in a large number, is generally the 17-35% of composition total weight.In closely knit composition, the amount of filling salt is no more than 15% of composition total weight, preferably is no more than 10% of composition weight, is most preferably not exceeding 5% of composition weight.Mineral filler salt for example in this composition the mineral filler salt of indication be selected from the vitriol and the muriate of basic metal and alkaline-earth metal.Preferred filling salt is a sodium sulfate.

Liquid bleaching system of the present invention is " conc forms " also, and in this case, liquid bleaching system of the present invention is compared with traditional liquid washing agent, contains the water of low amount.The water-content of concentrated liquid bleach system is general preferred less than 40% of bleach system weight, is more preferably less than 30%, most preferably less than 20%.The cleaning additive material

Although it is optional for the purposes of this invention, but several conventional adjuvants that exemplify later are applicable to bleach system of the present invention, and can add as required in the preferred embodiments of the invention, for example assist or the raising clean-up performance, processing to the substrate that will clean, or the aesthstic performance of improvement bleach system, use spices, tinting material, dyestuff etc. to come to this.The definite performance of these annexing ingredients and its add-on depend on the physical form of said composition and carry out the character of clean operation.Unless otherwise indicated, bleach system of the present invention for example can be mixed with full effect or " heavy dirt " sanitising agent, particularly detergent for washing clothes of particle or powder type; Liquid, the full effect washing composition of gelinite or pasty state, particularly so-called heavy-filth liquid type; Liquid high-count fabric washing composition; Manual dishwasher detergent or light dirty dishwasher detergent, particularly those rich alveolitoids; The machine washing dishwasher detergent comprises the various tablets that are used for family and communal facility, particle, liquid and help the rinsing type; Liquid cleaner and sterilizing agent comprise that antibiotic hand washing type, laundry soap bar, mouth wash shua, denture cleanser, automobile or carpet clean shampoo, bathroom detergent; Shampoo and shampoo; Shower gels body and foam bath and metal detergent; And clean auxiliary and for example bleach additive and " dirty sticking " or pre-treatment type.

Tensio-active agent-composition of the present invention preferably comprises detergent surfactant.Detergent surfactant generally is selected from negatively charged ion, nonionic, positively charged ion, both sexes, zwitterionics and its mixture.By selecting type and the consumption and the disclosed ancillary component of other the application of detergent surfactant, detergent composition of the present invention can be mixed with and be used for laundry washing or other various washing and use and especially comprise and washing the dishes.Therefore, the concrete tensio-active agent that uses can be very different with the concrete end-use difference of imagination.Suitable tensio-active agent is described below.The example of suitable nonionic, negatively charged ion, positively charged ion, both sexes and zwitterionics is presented in " Surface Active Agents and Detergents " (volume I and II, Schwartz, Perry and Berch).Various types of this tensio-active agents also briefly are disclosed in the 23rd hurdle 58 that 1975.12.30 is issued to people's such as Laughlin United States Patent (USP) 3,929,678 and walk in the 29th hurdle 23 row.

The amount of tensio-active agent generally is about 0.1% from bleach system weight, preferably from about 1%, more preferably from about 5% about 99.9% to bleach system weight, preferably to about 80%, more preferably to about 35%, most preferably to about 30%.

Anion surfactant-anion surfactant used in this invention is preferably selected from linear alkylbenzene sulfonate; alpha-olefin sulfonate; paraffin sulfonate, alkyl ester sulfonate, alkyl-sulphate; alkyl alkoxy sulfate; alkylsulfonate, alkyl alkoxy carboxylate salt, alkyl alkoxylated suifate; sarcosinate, taurate with and composition thereof.Can use the anionic detergent tensio-active agent of significant quantity in the present invention, this significant quantity is generally about 0.5wt% to about 90wt%, and preferably about 5wt% is to about 60wt%, and more preferably from about 10wt% is to about 30wt%.

Alkyl sulfate surfactant is the important anion surfactant that is used for another type of the present invention.When with polyhydroxy fatty acid amide (face as follows) when being used in combination, except can producing excellent whole cleaning, these whole cleanings are included in good fat/oily cleaning in very wide temperature, wash concentration and the washing time scope, can also make the alkyl-sulphate dissolving, and improve the property prepared in liquid detergent formula.These tensio-active agents are that molecular formula is ROSO ₃The water-soluble salt of M or acid, wherein R C preferably ₁₀-C ₂₄Alkyl preferably has C ₁₀-C ₂₀The alkyl of moieties or hydroxyalkyl, more preferably C ₁₂-C ₁₈Alkyl or hydroxyalkyl, M is H or positively charged ion, basic metal (IA family) positively charged ion (sodium for example for example, potassium, lithium), replace or unsubstituted ammonium cation for example methyl-, dimethyl-and trimethyl ammonium and quaternary ammonium cation, for example tetramethyl-ammonium and lupetidine and derived from alkanolamine thanomin for example, diethanolamine, the positively charged ion of trolamine and its mixture etc.Generally speaking, preferred C under the low wash temperature (for example being lower than about 50 ℃) _12-16Alkyl chain, higher wash temperature (for example being higher than about 50 ℃) is preferred C down _16-18Alkyl chain.

Alkyl alkoxylated sulfate surfactant is another kind of useful anion surfactant.These tensio-active agents generally are that molecular formula is RO (A) _mSO ₃The water-soluble salt of M or acid, wherein R has C ₁₀-C ₂₄The unsubstituted C of moieties ₁₀-C ₂₄Alkyl or hydroxyalkyl, preferred C ₁₂-C ₂₀Alkyl or hydroxyalkyl, more preferably C ₁₂-C ₁₈Alkyl or hydroxyalkyl, A are oxyethyl group or propoxy-unit, and m is greater than 0, generally between about 0.5 and about 6, more preferably between about 0.5 and about 3, M is H or positively charged ion, and this positively charged ion can be as metallic cation (sodium for example, potassium, lithium etc.), the ammonium cation of ammonium or replacement.Can consider to use alkyl ethoxylated sulfate and alkyl propoxylated sulphates in the present invention.The object lesson of the ammonium cation that replaces comprise methyl-, dimethyl-, trimethyl ammonium and quaternary ammonium cation, for example tetramethyl-ammonium, lupetidine and derived from alkanolamine monoethanolamine for example, diethanolamine, the positively charged ion of trolamine and its mixture.The tensio-active agent that exemplifies is C ₁₂-C ₁₈Alkyl polyethoxylated (1.0) vitriol, C ₁₂-C ₁₈Alkyl polyethoxylated (2.25) vitriol, C ₁₂-C ₁₈Alkyl polyethoxylated (3.0) vitriol, C ₁₂-C ₁₈Alkyl polyethoxylated (4.0) vitriol, wherein M is selected from sodium and potassium easily.Be used for tensio-active agent of the present invention by natural or synthetic raw polyol preparation.Chain length represents that average hydrocarbon distributes, and comprises side chain.

Additionally and preferably, tensio-active agent can be a medium-chain branched-chain alkyl vitriol, medium-chain branched-chain alkyl alcoxylates or medium-chain branched-chain alkyl alkoxy sulfate.These tensio-active agents further describe in following patent: the 1997.10.14 proxy number is the patent 60/061 of 6881P, 971, the 1997.10.14 proxy number is the patent 60/061 of 6882P, 975, the 1997.10.14 proxy number is the patent 60/062 of 6883P, 086, the 1997.10.14 proxy number is the patent 60/061 of 6884P, 916, the 1997.10.14 proxy number is the patent 60/061 of 6885P, 970, the 1997.10.14 proxy number is in the patent 60/062,407 of 6886P.Other suitable medium chain branched chain surfactant is found in following document: U.S. Patent application 60/032,035 (proxy number is No.6401P), 60/031,845 (proxy number is No.6402P), 60/031,916 (proxy number is No.6403P), 60/031,917 (proxy number is No.6404P), 60/031,761 (proxy number is No.6405P), 60/031,762 (proxy number is No.6406P) and 60/031,844 (proxy number is No.6409P).These branched chain surfactants and traditional straight chain surfactant mixtures also are applicable to composition of the present invention.

The preferred anionic surfactants tensio-active agent is so-called alkylbenzenesulfonatsurfactants surfactants or MLAS in addition.The MLAS tensio-active agent that some are suitable, its preparation method and the composition that exemplifies are further retouched at common unsettled U.S. Patent application 60/053,319 (proxy number is No.6766P), 60/053,318 (proxy number is No.6767P), 60/053,321 (proxy number is No.6768P), 60/053,209 (proxy number is No.6769P), 60/053,328 (proxy number is No.6770P), 60/053,186 (proxy number is No.6771P), 60/055,437 (proxy number is No.6796P), in 60/105,017 (proxy number is No.7303P) and 60/104,962 (proxy number is No.7304P).

Suitable examples of anionic surfactants provides in " Surface Active Agents andDetergents " (volume I and II, Schwartz, Perry and Berch).

Nonionic detergent tensio-active agent-suitable nonionogenic tenside general description is issued to people's such as Laughlin United States Patent (USP) 3,929,678 at 1975.12.30 the 13rd hurdle the 14th walks in the 16th hurdle the 6th row, is hereby incorporated by.The kind of the useful nonionogenic tenside of the indefiniteness that exemplifies comprises: amine oxide, alkylethoxylate, alkyloyl glucose amide, alkyl betaine, sultaine and its mixture.

Amine oxide is a semi-polar nonionic surfactants, and it comprises water-soluble amine oxides, and it comprises one about 10 to the moieties of about 18 carbon atoms and two and be selected from and contains 1 alkyl and the hydroxyalkyl part to about 3 carbon atoms of having an appointment; The water soluble oxidized phosphine, it comprises one about 10 to the moieties of about 18 carbon atoms and two and is selected from and contains 1 alkyl and the hydroxyalkyl part to about 3 carbon atoms of having an appointment; With water-soluble sulfoxide, it comprises one about 10 to the moieties of about 18 carbon atoms and one and is selected from and contains 1 alkyl and the hydroxyalkyl part to about 3 carbon atoms of having an appointment.

Semi-polarity nonionic detergent tensio-active agent comprises that having molecular formula is Amine oxide surfactant, R wherein ³Be to contain have an appointment 8 alkyl, hydroxyalkyl or alkyl phenyl or its mixture to about 22 carbon atoms; R ⁴Be alkylidene group or hydroxyl alkylidene group or its mixture that contains 2 to 3 carbon atoms of having an appointment; X is 0 to about 3; Each R ⁵All be to contain 1 alkyl or the hydroxyalkyl of having an appointment, or contain 1 the polyethylene oxide group of having an appointment to about 3 ethylene oxide groups to about 3 carbon atoms.This R ⁵Group can be interconnection, for example is connected to form ring structure by oxygen or nitrogen-atoms.

These amine oxide surfactants are particularly including C ₁₀-C ₁₈Alkyl dimethyl amine oxide and C ₈-C ₁₂Alkoxyethyl dihydroxy ethyl amine oxide.Amine oxide preferably is present in the composition with significant quantity, more preferably its content for about 0.1wt% to about 20wt%, even 0.1wt% about 15wt% extremely more preferably from about, even further 0.5wt% about 10wt% extremely more preferably from about.

The polyethylene oxide of alkylphenol, poly(propylene oxide) and polybutylene oxide condenses.General preferred polyethylene oxide condensation compound.These compounds comprise having has an appointment 6 containing of straight or branched configuration to the alkylphenol of the alkyl of about 12 carbon atoms and the condensation product of oxirane.In preferred embodiments, the amount of oxyethane is that every mole of alkylphenol about 5 is to about 25 moles of ethylene oxide.Commercially available this class nonionogenic tenside comprises Igepal ^CO-630 is sold by GAF company; And Triton ^X-45, X-114, X-100, and X-102 is by the Rohm﹠amp; Haas Company sells.These compounds are commonly referred to as alkyl phenolic alkoxy thing (for example alkylphenol ethoxylate).

Fatty Alcohol(C12-C14 and C12-C18) and about 1 condenses to about 25mol oxyethane.The alkyl chain of Fatty Alcohol(C12-C14 and C12-C18) can be a straight or branched, and uncle's chain or secondary chain generally comprise about 8 to about 22 carbon atoms.Particularly preferably be by every mol of alcohol, have and comprise about 10 alcohol and about 2 condensation products to about 18 moles of ethylene oxide to the alkyl of about 20 carbon atoms.The example of commercially available this class nonionogenic tenside comprises Tergitol ^15-S-9 (C ₁₁-C ₁₅The condensation product of linear secondary and 9 moles of ethylene oxide), Tergitol ^24-L-6 NMW (C ₁₂-C ₁₄The condensation product of primary alconol and 6 moles of ethylene oxide, and have narrow molecular weight distribution), sell by Union CarbideCorporation for two kinds; Neodol ^45-9 (C ₁₄-C ₁₅The condensation product of straight chain alcohol and 9 moles of ethylene oxide), Neodol ^23-6.5 (C ₁₂-C ₁₃The condensation product of straight chain alcohol and 6.5 moles of ethylene oxide), Neodol ^45-7 (C ₁₄-C ₁₅The condensation product of straight chain alcohol and 7 moles of ethylene oxide), Neodol ^45-4 (C ₁₄-C ₁₅The condensation product of straight chain alcohol and 4 moles of ethylene oxide), sell by Shell Chemical Company, and Kyrot ^EOB (C ₁₃-C ₁₅The condensation product of pure and mild 9 moles of ethylene oxide), by The Procter ﹠amp; Gamble Company sells.Other commercially available ionic surfactant pack is drawn together the Dobanol 91-8 that is sold by Shell Chemical Co. ^With the Genapol UD-080 that sells by Hoechst ^This class nonionogenic tenside is commonly referred to as " alkylethoxylate ".

Preferred alkyl polyglycoside has following molecular formula

R ²O (C _nH _2nO) _t(glycosyl) _xR wherein ²Be selected from alkyl, alkyl phenyl, hydroxyalkyl, hydroxyalkyl phenyl and its mixture, wherein alkyl comprises about 10 to about 18, and preferred about 12 to about 14 carbon atoms; N is 2 or 3, preferred 2; T is 0 to about 10, preferred 0; X is about 1.3 to about 10, and preferred about 1.3 to about 3, most preferably from about 1.3 to about 2.7.Glycosyl is preferably derived from glucose.For preparing these compounds, at first make alcohol or alkyl polyethoxye alcohol, form glucosides (being connected 1) with glucose or source of glucose reaction then, another glycosyl units can be connected its 1 2-with previous glycosyl units then, 3-, between 4-and/or the 6-position, preferably mainly connect in the 2-position.

Fatty acid amide surfactant has following molecular formula: R wherein ⁶Be the alkyl that contains 7 to about 21 (preferred about 9 to the about 17) carbon atoms of having an appointment, each R ⁷All be selected from hydrogen, C ₁-C ₄Alkyl, C ₁-C ₄Hydroxyalkyl and-(C ₂H ₄O) _xH, wherein x changes between about 1 to about 3.

Preferred acid amides is C ₈-C ₂₀Glutamine, single ethanol amide, diglycollic amide and isopropanol amide.

In the time of in being present in composition of the present invention, preferred nonionic surfactants exists with significant quantity, more preferably its content for about 0.1wt% to about 20wt%, even 0.1wt% about 15wt% extremely more preferably from about, even further 0.5wt% about 10wt% extremely more preferably from about.

Polyhydroxy fatty acid amide surfactant-detergent composition of the present invention also can comprise the polyhydroxy fatty acid amide surfactant of significant quantity." significant quantity " is meant that ingredients teacher of said composition can select a certain amount of polyhydroxy fatty acid amide plus to go in the composition to improve the clean-up performance of this detergent composition.Generally speaking, for conventional content, the polyhydroxy fatty acid amide that adds about 1wt% can improve clean-up performance.

Detergent composition of the present invention generally comprises the polyhydroxy fatty acid amide surfactant of about 1wt%, and preferably about 3wt% is to the polyhydroxy fatty acid amide of about 30wt%.This polyhydroxy fatty acid amide surfactant component comprises the compound that structural formula is following: Wherein: R ¹Be H, C ₁-C ₄Alkyl, 2-hydroxyethyl, 2-hydroxypropyl or its mixture, preferred C ₁-C ₄Alkyl, more preferably C ₁Or C ₂Alkyl, most preferably C ₁Alkyl (being methyl); R ²Be C ₅-C ₃₁Alkyl, preferred straight chain C ₇-C ₁₉Alkyl or alkenyl, more preferably straight chain C ₉-C ₁₇Alkyl or alkenyl, most preferably straight chain C ₁₁-C ₁₅Alkyl or alkenyl, or its mixture; Z is the polyhydroxy alkyl with the straight-chain alkyl chain that directly is connected with at least 3 hydroxyls, or the derivative of its alkoxylate (preferred ethoxylation or propoxylation).Z is preferably derived from the reducing sugar in the reductive amination process; More preferably Z is a glycosyl.Suitable reducing sugar comprises glucose, fructose, maltose, lactose, semi-lactosi, seminose and wood sugar.As raw material, can use senior glucose maize treacle, senior fructose maize treacle and senior maltose maize treacle, and above-named monose.These maize treacle can obtain being used for the mixture of the sugar component of Z.It should be understood that the present invention never gets rid of other proper raw material.Z is preferably selected from-CH2-(CHOH) _n-CH ₂OH ,-CH (CH ₂OH)-(CHOH) _N-1-CH ₂OH ,-CH ₂-(CHOH) ₂(CHOR ') (CHOH)-CH ₂OH and its oxyalkylated derivative, wherein n is the integer (comprising 3 and 5) of 3-5, R ' is H or ring-type or aliphatics monose.Most preferably wherein n is 4 glycosyl, particularly-and CH ₂-(CHOH) ₄-CH ₂OH.

R ' can be as the N-methyl, N-ethyl, N-propyl group, N-sec.-propyl, N-butyl, N-2-hydroxyethyl or N-2-hydroxypropyl.

R ²-CO-N＜can be as coconut oleoyl amine, stearylamide, oleylamide, laurylamide, myristic amide, decyl amide, palmitic amide, butter acid amides etc.

Z can be a 1-deoxyglucose base, 2-deoxidation fructosyl, 1-deoxidation malt-base, 1-deoxidation lactose base, 1-deoxy-galactose base, 1-deoxymannose base, 1-deoxidation maltotriose glycosyl etc.

The method of producing polyhydroxy fatty acid amide is known in this area.In general, it can generate the corresponding N-alkyl polyhydroxy amine by alkylamine and reducing sugar in reductive amination process, make N-alkyl polyhydroxy amine and lipid acid aliphatic series ester or triglyceride in condensation/acid amides reaction, generate the N-alkyl, N-polyhydroxy fatty acid amide product then.The method for compositions that preparation comprises polyhydroxy fatty acid amide is disclosed in for example following patent: the disclosed Thomas Hedley of 1959.2.18 ﹠amp; Co., the british patent specification 809,060 of Ltd. application, 1960.12.20 be issued to the United States Patent (USP) 2 of E.R.Wilson, 965,576, and 1955.3.8 is issued to the United States Patent (USP) 2 of Anthony M.Schwartz, 703,798, and 1934.12.25 is issued to the United States Patent (USP) 1,985 of Piggott, in 424, be incorporated herein these documents as a reference.

Diamines-the be used for preferred liquid detergent composition of the inventive method, also can comprise one or more diamines as light-duty liquid (LDL) composition, the anion surfactant that the amount of diamines preferably makes existence is from about 40: 1 to about 2: 1 with the ratio of diamines.Said diamines is keeping appropriate foamy can also increase detersive power to greasy dirt or grease food simultaneously.

The diamines that is applicable to composition of the present invention has following structural formula:

Each R wherein ²⁰All independently be selected from H, C ₁-C ₄The straight or branched alkyl has the alkylene oxide group of following structural formula:

-(R ²¹O) _yR ²²R wherein ²¹Be C ₂-C ₄Straight or branched alkylidene group and its mixture; R ²²Be H, C ₁-C ₄Alkyl and its mixture; Y is from 1 to about 10; X is selected from following unit:

I) C ₃-C ₁₀Straight-chain alkyl-sub-, C ₃-C ₁₀Branched alkylidene, C ₃-C ₁₀The ring alkylidene group, C ₃-C ₁₀The ring alkylidene group of side chain has the alkyleneoxyalkylene group of following molecular formula:

-(R ²¹O) _yR ²¹-R wherein ²¹The same with y and above-mentioned definition;

Ii) C ₃-C ₁₀Straight chain, C ₃-C ₁₀Side chain, C ₃-C ₁₀Ring, C ₃-C ₁₀Prop up the chain link alkylidene group, C ₆-C ₁₀Arylidene, wherein said unit comprise one or more power supply or electrophilic part, and this part makes the pKa of described diamines greater than about 8; With

Iii) i) and mixture ii), condition is that the pKa of described diamines is about 8 at least.

The pK of the preferred diamines of the present invention ₁And pK ₂All be about 8 to about 11.5, preferred about 8.4 to about 11, and more preferably from about 8.6 to about 10.75.For purpose of the present invention, term " pKa " is equivalent to term " pK respectively ₁" and " pK ₂" or be equivalent to both.In whole specification sheets of the present invention, term pKa used in this application is identical with those those of ordinary skills' use-pattern.The Pka value is easily from normative document data for example " Critical Stability Constants:Volume 2, Amines ", Smith and Martel, and Plenum Press, N.Y.andLondon obtains in (1975).

With regard to the definition of herein using, it is to measure in about aqueous solution of 0.1 to about 0.5M that the pKa value of diamines is defined as 25 ℃ of following its ionic strengths.PKa used in this application is the equilibrium constant that depends on temperature and ionic strength, and is therefore, not exclusively not consistent with value that the present invention includes and scope according to the value that mode recited above is measured, reference is reported.Be disambiguation, the correlated condition and/or the parameter that are used for pKa value of the present invention are as defined here, or see " Critical Stability Constants:Volume 2, Amines ".A kind of typical measuring method be with sodium hydroxide to the potentiometric titration of acid and according to as " TheChemist ' s Ready Reference Handbook ", Shugar and Dean, McGrawHill, NY, 1990 proper methods described and reference are measured pKa.

Consider performance and supply, preferred diamines is 1, two (methylamino) hexanaphthenes of 3-, 1,3-diaminopropanes (pK ₁=10.5; PK ₂=8.8), 1 (pK ₁=11; PK ₂=10), 1,3-diamino pentane (Dytek EP) (pK ₁=10.5; PK ₂=8.9), 2-methyl isophthalic acid, 5-diamino pentane (Dytek A) (pK ₁=11.2; PK ₂=10.0).Other preferred material is to have C ₄-C ₈Alkylidene group primary/primary diamines at interval.In general, preferred primary diamines, the not preferred second month in a season and tertiary diamine.

Be the indefiniteness example that is applicable to diamines of the present invention below.1-N, N-dimethylamino-3-aminopropane, its molecular formula:

1, its molecular formula is:

1, the 3-diaminopropanes, its molecular formula is:

The 2-methyl isophthalic acid, 5-diamino pentane, its molecular formula is:

1,3-diamino pentane can be purchased by trade(brand)name Dytek EP, and its molecular formula is:

1, the 3-diaminobutane, its molecular formula is:

Jeffamine EDR 148, it is the diamines with alkylene oxide group skeleton, its molecular formula is: 3-methyl-3-aminoethyl-5-dimethyl-1-aminocyclohexane (isophorone diamine), its molecular formula is:

1, two (methylamino) hexanaphthenes of 3-, its molecular formula is: Additional detergent components

Be to be applicable to the particularly indefiniteness example (ancillary component) of the additional detergent components in the laundry detergent composition of bleach system of the present invention below, described ancillary component comprises washing assistant, brightening agent, soil release polymer, dye-transfer, dispersion agent, enzyme, suds suppressor, dyestuff, spices, tinting material, filling salt, hydrotropic agent, light activating agent, fluorescent agent, fabric conditioner, hydrolyzable tensio-active agent, sanitas, antioxidant, sequestrant, stablizer, antishrinking agent, anti wrinkling agent, sterilant, mycocide, anticorrosive agent and its mixture.

Washing assistant-bleach system of the present invention preferably comprises one or more detergent builders or builder system.When having washing assistant, said composition generally comprises the washing assistant at least about 1wt%, preferably from about 5wt%, more preferably from about 10wt% to about 80wt%, preferably to about 50wt%, the more preferably detergent builders of about 30wt% extremely.

The content of washing assistant is along with the different of the physical form of the end-use of composition and its hope and a great difference is arranged.When having detergent builders, composition generally comprises the washing assistant at least about 1%.Preparation generally comprises about 5wt% to about 50wt%, is more generally the detergent builders of about 5wt% to 30wt%.Granular preparation generally comprises about 10wt% to about 80wt%, is more generally the detergent builders of about 15wt% to about 50wt%.Yet this does not also mean that the washing assistant of the lower or higher dosage of eliminating.

Inorganic or phosphorus-containing detergent washing assistant comprises but is not defined as the poly-phosphate (tri-polyphosphate for example of basic metal, ammonium and alkanol ammonium, pyrophosphate salt and glassy polymer metaphosphate), phosphonate, phytic acid, silicate, carbonate (comprising supercarbonate and sesquicarbonate), vitriol and silico-aluminate.Yet, need nonphosphate builders in some occasions.Importantly, though composition of the present invention so-called " weak " washing assistant (comparing) with phosphoric acid salt as Citrate trianion or and take place under the situation of so-called " inferior helping washed " during with zeolite or layered silicate washing assistant, its performance is still good astoundingly.

The example of silicate-like builder is an alkalimetal silicate, particularly those SiO ₂: Na ₂The ratio of O is 1.6: 1-3.2: 1 alkalimetal silicate and layered silicate, as be described in lamina sodium silicate in the United States Patent (USP) 4,664,839 that 1987.5.12 is issued to Rieck.NaSKS-6 is the trade mark (being abbreviated as " SKS-6 " among the application usually) by the crystalline layered silicate of Hoechs t sale.Different with zeolite builders is that the NaSKS-6 silicate-like builder does not contain aluminium.NaSKS-6 has the δ-Na of layered silicate ₂SiO ₅Form.It can with as be described in German patent DE-A-3, those methods preparations in 417,649 and DE-A-3,742,043.SKS-6 is the highly preferred layered silicate of the present invention that is applicable to, still, also can use other this class layered silicate, for example has general formula NaMSi _xO _2x+1YH ₂Those materials of O, wherein M is sodium or H, and x is 1.9-4, and is preferred 2, and y is 0-20, preferred 0.Various other layered silicates available from Hoechst comprise α, the NaSKS-5 of beta, gamma form, NaSKS-7 and NaSKS-11.As mentioned above, δ-Na ₂SiO ₅(Na SKS-6 form) most preferably is used for the application.Also can use other silicate, manganous silicate for example, it can be used as the agent of structure limit in granular preparation, in oxygen bleaching agent with used as stabilizers and can be used as the component of foam control system.

The example of carbonate builders is alkaline-earth metal and alkaline carbonate, and it is disclosed in the disclosed German patent application 2,321,001 of 1973.11.15.

The silico-aluminate washing assistant is applicable to the present invention.The silico-aluminate washing assistant is extremely important in the heavy duty type granular detergent composition that great majority are sold at present, also can be as a kind of very important washing assistant composition in liquid detergent preparation.The silico-aluminate washing assistant comprises those materials with following empirical formula:

[M _z(zAlO ₂) _y] xH ₂O wherein z and y is at least 6 integer, and the mol ratio of z and y is 1.0 to about 0.5, and x is from about 15 to about 264 integer.

Useful silico-aluminate ion exchange material is commercially available.The structure of these silico-aluminates can be a crystal or amorphous, and it can be the silico-aluminate or the synthetic derivative of natural formation.The method for preparing the silico-aluminate ion exchange material is disclosed in the United States Patent (USP) 3,985,669 that 1976.10.12 is issued to people such as Krummel.Synthetic preferred synthetic crystallization silico-aluminate ion exchange material used in this application can called after zeolite A, zeolite P (B), and zeolite MAP and X zeolite obtain.In particularly preferred embodiments, this crystal aluminosilicate ion exchange material has following molecular formula:

Na ₁₂[(AlO ₂) ₁₂(SiO ₂) ₁₂] xH ₂O wherein x is about 20 to about 30, particularly about 27.This material is called zeolite A.The present invention also can use dehydration zeolite (x=0-10).Preferred this silico-aluminate has the granularity of the about 0.1-10 micron of diameter.

The organic detergent washing assistant that is applicable to the object of the invention comprises but is not defined as various multi-carboxylate's compounds." multi-carboxylate " of Shi Yonging refers to have a plurality of carboxyls herein, the compound of preferred at least 3 carboxyls.The multi-carboxy acid salt washing agent generally adds in the composition with sour form, but form that also can neutral salt is added.When using with salt form, preferred as alkali is sodium, potassium and lithium for example, or alkanol ammonium salts.

The multi-carboxy acid salt washing agent comprises all kinds of useful materials.The important multi-carboxy acid salt washing agent of one class comprises the ether multi-carboxylate, it comprises oxygen di-succinate, it is disclosed in the United States Patent (USP) 3,128,287 that 1964.4.7 is issued to Berg, 1972.1.18 be issued to people's such as Lamberti United States Patent (USP) 3,635,830,1976.2.3 is issued to the United States Patent (USP) 3 of Lamberti, in 936,448.Also can be issued to " TMS/TDS " washing assistant in people's such as Bush the United States Patent (USP) 4,663,071 referring to 1987.5.5.Suitable ether multi-carboxylate also comprises ring compound, particularly alicyclic compound, for example is described in the United States Patent (USP) 3,923,679 that those materials in the following patent: 1975.12.2 is issued to Rapko; 1979.6.19 be issued to people's such as Crutchfield United States Patent (USP) 4,158,635; 1978.10.17 be issued to people's such as Crutchfield United States Patent (USP) 4,120,874; Be issued to people's such as Crutchfield United States Patent (USP) 4,120,903 with 1978.7.25.

Other useful detergent builders comprises ether hydroxypolycarboxylic acid salt, the multipolymer of maleic anhydride and ethene or vinyl methyl ether, 1,3,5-trihydroxybenzene-2,4,6-trisulfonic acid and carboxymethyl oxydisuccinic acid, various basic metal, the polyacetic acid salt of ammonium and replacement ammonium is edetate and nitrilotriacetic acid(NTA) salt for example, and multi-carboxylate's toxilic acid for example, succsinic acid, oxygen di-succsinic acid, polymaleic acid, benzene-1,3,5-tricarboxylic acid, carboxymethyl oxydisuccinic acid and its soluble salt.

Citrate trianion washing assistant such as citric acid and its soluble salt (particularly sodium salt) are because it is from renewable resources and have biological degradability, so be the multi-carboxy acid salt washing agent of particularly important for the heavy duty liquid detergent preparation.Citrate trianion also can be used in the particulate composition, particularly is used in combination with zeolite and/or layered silicate washing assistant.Oxygen di-succinate also is useful especially in said composition and mixture.

Be suitable for use in and also have 3 in the bleach system of the present invention, 3-dicarboxyl-4-oxa--1,6-adipate, related compound are disclosed in the United States Patent (USP) 4,566,984 that 1986.1.28 is issued to Bush.Useful succsinic acid washing assistant comprises C ₅-C ₂₀Alkyl and alkenyl succinic and its salt.Particularly preferred this compounds is the dodecylene succsinic acid.The object lesson of succinate washing assistant comprises: lauryl succinate, myristyl succinate, palmityl succinate, 2-dodecenyl succinic succinate (preferably), 2-15 carbene base succinates etc.Wherein preferred lauryl succinate, it is described in the disclosed european patent application 86200690.5/0,200,263 of 1986.11.5.

Other suitable multi-carboxylate is disclosed in the following patent: 1979.3.13 is issued to people's such as Crutchfield United States Patent (USP) 4144226 and the United States Patent (USP) 3308067 that 1967.3.7 is issued to Diehl.Also can be referring to the United States Patent (USP) 3723322 of Diehl.

Lipid acid such as C ₁₂-C ₁₈Monocarboxylic acid also can add separately in the composition, perhaps adds together with above-mentioned washing assistant, especially Citrate trianion and/or succinate washing assistant, to produce extra washing assistant activity.Use lipid acid can cause foam to reduce usually like this, ingredients teacher should consider this point.

Under the situation of using phosphorus base washing assistant, in the strip preparation especially for the hand washing operation, also can use various alkali metal phosphates tripoly phosphate sodium STPP, trisodium phosphate and sodium orthophosphate as is well known.Also can use phosphonate washing assistant such as ethane-1-hydroxyl-1,1-diphosphonate and other known phosphonate are (for example, referring to United States Patent (USP) 3159581; 3213030; 3422021; 3400148 and 3422137).

Sequestrant-bleach system of the present invention also can randomly contain one or more iron and/or manganese sequestrant.This sequestrant can be selected from aromatic chelator that the aminocarboxylate that defines below, amino phosphonates do, polyfunctional group replace and composition thereof.Do not want to be fettered, can think that the advantage of these materials is in part because it has by formation soluble chelating thing the special performance that iron and manganese can be removed from washing soln by theoretical.

United States Patent (USP) 5,576 has been described the example and the consumption thereof of suitable sequestrant in 282 and 5,728,671.

Be applicable to that preferred biodegradable cheating agent of the present invention is that 1987.11.3 is issued to the ethylenediamine disuccinate of describing in the United States Patent (USP) 4,704,233 of Hartman and Perkins (" EDDS "), particularly its [S, S] isomer.

Composition of the present invention also can contain water-soluble methylglycine diacetic acid (MGDA) salt (or sour form) as sequestrant or and for example insoluble washing assistant such as zeolite, layered silicate etc. together as complementary washing assistant.

If the use sequestrant, then these sequestrants generally account for bleach system weight of the present invention about 0.1% to about 15%, more preferably 3.0%.

Dye transfer inhibitor-bleach system of the present invention also can comprise one or more dye transfer inhibitor compounds, the dyestuff that is used to suppress to dissolve and suspends is delivered to another part fabric from a fabric, can run into this dyestuff transport phenomenon in fabric washing that includes yarn dyed fabric and conditioning operation.

Suitable polymeric dye transmission inhibitor comprises but is not defined as polyvinylpyrrolidonepolymers polymers, polyamine N-oxide pllymers, the multipolymer of N-vinyl pyrrolidone and N-vinyl imidazole, Ju Yi Xi oxazolidinone and polyvinyl imidazol or its mixture.United States Patent (USP) 5,707,950 and United States Patent (USP) 5,707,951 in the example of such dye transfer inhibitor has been described.

Other suitable dye transfer inhibitor comprises but is not defined as cross-linked polymer.Cross-linked polymer is the polymkeric substance that its skeleton has certain degree of crosslinking; These are crosslinked can be the connection of chemistry or physical properties, can connect with the active group on skeleton or the side chain.Cross-linked polymer is described in Polymer Science magazine, and the 22nd volume is in the 1035-1039 page or leaf.

In one embodiment, make this cross-linked polymer in the mode that forms three-dimensional rigid structure, cross-linked polymer is trapped in dyestuff in the hole that is formed by this three-dimensional structure.

In another embodiment, cross-linked polymer is held back dyestuff by expansion.

Suitable cross-linked polymer is described in the common unsettled european patent application 94870213.9.

Add this polymkeric substance and can also improve the performance of the enzyme in the bleach system of the present invention.

Before these dye transfer inhibitors can can be incorporated into the washing lotion on other goods at the fugitive dye of wash-out from colored fabric with its complexing or absorption.

When having dye transfer inhibitor in the bleach system of the present invention, the amount of dye transfer inhibitor be from bleach system weight about 0.0001%, more preferably from about 0.01%, most preferably from about 0.05% to about 10%, more preferably to about 2%, most preferably to about 1%.

Dispersion agent-bleach system of the present invention can also contain dispersion agent.Suitable water-soluble organic salt is homopolymerization or co-polymeric acids or its salt, and poly carboxylic acid wherein comprises at least two and is no more than the carboxyl that two carbon atom separates each other.

This polymkeric substance is disclosed in GB-A-1, in 596,756.The example of this salt be molecular weight be 2000-5000 polyacrylic ester and with the multipolymer of maleic anhydride, the molecular weight of such multipolymer is 1,000-100,000.

Particularly the multipolymer of acrylate and methacrylic ester such as molecular weight are that 4000 480N can add in the detergent composition of the present invention with the consumption of the 0.5-20% of composition weight.

Composition of the present invention can contain calcium soap peptizing agent compound, and its following defined lime soap dispersing power value (LSDP) is not more than 8, preferably is not more than 7, most preferably is not more than 6.The amount of calcium soap peptizing agent compound is 0-20wt% preferably.

The validity of calcium soap peptizing agent lime soap dispersing power (LSDP) quantificational expression, LSDP lime soap dispersing agent test determination, this test is described in H.C.Borghetty and C.A.Bergman at J.Am.Oil.Chem.Soc., and the 27th volume is in the article in the 88-90 page or leaf (1950).Those of ordinary skills generally use the calcium soap distributed test, for example, can be referring to following survey article: W.N.Linfield, Surfactant science Series, the 7th volume, page 3; W.N.Linfield, Tenside surf.det., the 27th volume, 159-163 page or leaf (1990); And M.K.Nagarajan, W.F.Masler, Cosmeticsand Toiletries, the 104th volume, 71-73 page or leaf (1989).LSDP is the weight percent that disperses needed dispersion agent of calcium soap settling and sodium oleate, and said calcium soap settling is at the 333ppm of 30ml CaCO by the 0.025g sodium oleate ₃(Ca: Mg=3: 2) form in the equivalent hardness water.

Tensio-active agent with good calcium soap peptizing agent ability comprises some amine oxide, trimethyl-glycine, sultaine, alkyl ethoxy sulfate and ethoxylated alcohol.

Be applicable to that the example that LSDP of the present invention is not more than 8 tensio-active agent comprises C ₁₆-C ₁₈Dimethyl oxidation amine, average degree of ethoxylation are the C of 1-5 ₁₂-C ₁₈Alkyl ethoxy sulfate, particularly ethoxylation degree are the C of 3 (LSDP=4) ₁₂-C ₁₅Alkyl ethoxy sulfate surfactant and BASF GmbH are respectively that the average degree of ethoxylation that Lutensol A012 and Lutensol A030 sell is the C of 12 (LSDP=6) or 30 with the trade mark ₁₄-C ₁₅Ethoxylated alcohol.

Be applicable to that polymerization calcium soap peptizing agent of the present invention is described in M.K.Nagarajan, W.F.Masler is at Cosmetics and Toiletries, and the 104th volume is in the article of 71-73 page or leaf (1989).

The amino caproyl of hydrophobicity SYNTHETIC OPTICAL WHITNER such as 4-[N-capryloyl-6-] benzene sulfonate, the amino caproyl of 4-[N-nonanoyl-6-] benzene sulfonate, the amino caproyl of 4-[N-decanoyl-6-] benzene sulfonate and composition thereof; And the combination of nonanoyl oxygen benzene sulfonate and hydrophilic/hydrophobic SYNTHETIC OPTICAL WHITNER preparation also can be used as calcium soap peptizing agent compound.

Enzyme-except amylase of the present invention, this bleach system can also comprise one or more detergent enzymes with cleanup action and/or fabric maintenance action.Such enzyme can comprise proteolytic enzyme, amylase, cellulase and lipase.It can be added in the on-aqueous liquid bleach system of the present invention with suspension, " ball " or " particle " form.Another kind of suitable enzyme comprises the enzyme of the slurries form in the nonionogenic tenside, and for example the trade mark of Novo Nordisk sale is that the enzyme of " SL " or the trade mark of Novo Nordisk sale are the microcapsule enzyme of " LDP. ".Suitable enzyme and consumption thereof are described in United States Patent (USP) 5,576, in 282.

The enzyme that adds the traditional enzyme granulate form in the present composition is particularly preferred for the present invention.The normally about 100-1 of such particulate size range, 000 micron, 200-800 micron more preferably from about, and be suspended in the non-water water liquid phase of whole composition.Have been found that with regard to keeping enzymic activity for a long time compare with the enzyme of other form, the enzyme granulate in the composition of the present invention has the enzyme stability of special needs.Therefore, use the composition of enzyme granulate not need to contain traditional enzyme stabilizers, for example, the enzyme stabilizers that when adding enzyme in the aqueous liquid detergent, must use usually.

The example of suitable enzyme comprises but is not defined as hemicellulase, peroxidase, proteolytic enzyme, cellulase, zytase, lipase, Phospholipid hydrolase, esterase, at, polygalacturonase, M-Zyme, reductase enzyme, oxydase, phenol oxidase, lipoxygenase, lignoenzyme, Starch debranching enzyme, the tannic acid enzyme, pentosanase, malic enzyme (malanase), beta-glucanase, arabinofuranosidase/xylosidase, Unidasa, chondroitinase, laccase, known amylase, mannase, xyloglucanase enzymes and composition thereof.Preferred combination is the bleach system that contains with the mixed enzyme of the conventional enzyme that uses of amylase bonded of the present invention such as proteolytic enzyme, lipase, at and/or cellulase.

The example of this suitable enzyme is disclosed in United States Patent (USP) 5,576, in 282,5,728,671 and 5,707,950.

Suitable proteolytic enzyme is subtilisin, and it is (subtilisin BPN and the BPN ') that the special bacterial strain by subtilis and Bacillus licheniformis obtains.A kind of suitable proteolytic enzyme is to use by the Denmark Novo Industries A/S exploitation of following being called " Novo " and with ESPERASE ^The proteolytic enzyme that the bacillus strain of selling that maximum activity is arranged in whole pH scope 8-12 obtains.The preparation method of this kind of enzyme and similar enzyme thereof is described in the English Patent 1,243,784 that is issued to Novo.Other suitable proteolytic enzyme comprises the ALCALASE that Novo sells ^, DURAZYM ^And SAVINASE ^And the MAXATASE of Gist-Brocades sale ^, MAXACAL ^, PROPERASE ^And MAXAPEM ^(designing proteinic Maxacal).Proteolytic ferment also comprises the modified bacteria serine protease, as be described in (specifically seeing the 17th, 24 and 98 page) in the European patent application serial 87 303761.8 of 1987.4.28 application those be called the proteolytic enzyme of " proteolytic enzyme B " in this application and be described in and mention in the european patent application 199,404 of the disclosed Venegas application of 1986.10.29 to those of modified bacteria serine protease and be called the proteolytic enzyme of " protease A " in this application.The proteolytic enzyme that more preferably is called " proteolytic enzyme C " in this application, proteolytic enzyme C is the variant of the alkaline serine protease that obtained by genus bacillus, wherein, Methionin replaces 27 arginine, tyrosine replaces 104 Xie Ansuan, Serine replaces 123 l-asparagine, and Beta Alanine replaces 274 Threonine.Proteolytic enzyme C is described among the EP90915958:4 corresponding to the disclosed WO91/06637 of 1991.5.16.The genetic modification variant is in particularly the genetic modification variant of proteolytic enzyme C is also included within.Can also be referring to the high pH proteolytic enzyme of 40338 generations of the bacillus NCIMB among the WO93/18140A that is described in Novo.The enzyme detergent that comprises proteolytic enzyme, one or more other enzymes and reversible protease inhibitors is described among the WO92/03529A of Novo.When needs, adsorptivity descends and the proteolytic enzyme of water-disintegrable increase can be as being issued to Procter ﹠amp; The WO95/07791 of Gamble is described to be obtained like that.The similar proteolytic enzyme of recombinant trypsin that is applicable to washing composition of the present invention is described among the WO94/25583 that is issued to Novo.

In more detail, the proteolytic enzyme that is called " proteolytic enzyme D " is the carbonylic hydrolase variant that has at the undiscovered aminoacid sequence of nature, and it is to derive out with the many amino-acid residues in the different aminoacid replacement precursor carbonylic hydrolases, the position that replaces is described carbonylic hydrolase+76, also the one or more amino-acid residue positions that are selected from corresponding to following position of preferred combination :+99 ,+101, + 103 ,+104 ,+107, + 123 ,+27 ,+105, + 109 ,+126 ,+128, + 135 ,+156 ,+166, + 195 ,+197 ,+204, + 206 ,+210 ,+216, + 217 ,+218 ,+222, + 260 ,+265, and/or+274.Here the position corresponding of figure denote is in the position of bacillus amyloliquefaciens subtilysin, and this is described among the disclosed WO95/10615 of 1995.4.20 of GenencorInternational application.Be applicable to and of the present inventionly be described in the proteolytic enzyme among patent application EP251446 and the WO91/06637 in addition and be described in proteolytic enzyme BLAP among the WO91/02792 ^The amount that adds the proteolytic enzyme in the bleach system of the present invention is the 0.0001%-2% of said composition weight, preferred 0.001%-0.2%, the more preferably pure enzyme of 0.005%-0.1%.

Useful proteolytic enzyme also is described in the following disclosed PCT application: Procter ﹠amp; The disclosed WO95/30010 of 1995.11.9 of GambleCompany application; Procter ﹠amp; The disclosed WO95/30011 of 1995.11.9 of GambleCompany application; Procter ﹠amp; The disclosed WO95/29979 of 1995.11.9 of GambleCompany application.

Other useful especially proteolytic enzyme is polysubstituted ease variants, comprise with the amino-acid residue of another kind of natural generation replacing corresponding to the amino-acid residue that carries out on 103 of bacillus amyloliquefaciens subtilisin, simultaneously with the amino-acid residue of another kind of natural generation in one or more amino-acid residues replacements corresponding to the following position of bacillus amyloliquefaciens subtilisin: 1,3,4,8,9,10,12,13,16,17,18,19,20,21,22,24,27,33,37,38,42,43,48,55,57,58,61,62,68,72,75,76,77,78,79,86,87,89,97,98,99,101,102,104,106,107,109,111,114,116,117,119,121,123,126,128,130,131,133,134,137,140,141,142,146,147,158,159,160,166,167,170,173,174,177,181,182,183,184,185,188,192,194,198,203,204,205,206,209,210,211,212,213,214,215,216,217,218,222,224,227,228,230,232,236,237,238,240,242,243,244,245,246,247,248,249,251,252,253,254,255,256,257,258,259,260,261,262,263,265,268,269,270,271,272,274 and 275; Wherein, when this ease variants is included in when being substituted corresponding to 103 and 76 amino-acid residue, also have non-corresponding to 27 of bacillus amyloliquefaciens subtilisin, 99,101,104,107,109,123,128,166,204,206,210,216,217,218,222,260, the amino-acid residue at one or more amino acid residue positions place of 265 or 274 amino acid residue positions replaces, and/or polysubstituted ease variants comprises with the amino-acid residue of another kind of natural generation corresponding to 62,212 of bacillus amyloliquefaciens subtilisin, 230, the amino-acid residue at the one or more amino acid residue positions place in 232,252 and 257 replaces, and this is described in and belongs to Procter ﹠amp; The PCT of Gamble Company openly applies among WO99/20727, WO99/20726 and the WO99/20723.

Preferred ease variants comprises the replacement combination that is selected from following combination:

12/76/103/104/130/222/245/261；

62/103/104/159/232/236/245/248/252；

62/103/104/159/213/232/236/245/248/252；

62/101/103/104/159/212/213/232/236/245/248/252；

68/103/104/159/232/236/245；

68/103/104/159/230/232/236/245；

68/103/104/159/209/232/236/245；

68/103/104/159/232/236/245/257；

68/76/103/104/159/213/232/236/245/260；

68/103/104/159/213/232/236/245/248/252；

68/103/104/159/183/232/236/245/248/252；

68/103/104/159/185/232/236/245/248/252；

68/103/104/159/185/210/232/236/245/248/252；

68/103/104/159/210/232/236/245/248/252；

68/103/104/159/213/232/236/245；

98/103/104/159/232/236/245/248/252；

98/102/103/104/159/212/232/236/245/248/252；

101/103/104/159/232/236/245/248/252；

102/103/104/159/232/236/245/248/252；

103/104/159/230/236/245；

103/104/159/232/236/245/248/252；

103/104/159/217/232/236/245/248/252；

103/104/130/159/232/236/245/248/252；

103/104/131/159/232/236/245/248/252；

103/104/159/213/232/236/245/248/252; With

103/104/159/232/236/245. even preferred ease variants comprises the replacement combination that is selected from following combination:

12R/76D/103A/104T/130T/222S/245R/261D；

62D/103A/104I/159D/232V/236H/245R/248D/252K；

62D/103A/104I/159D/213R/232V/236H/245R/248D/252K；

68A/103A/104I/159D/209W/232V/236H/245R；

68A/76D/103A/104I/159D/213R/232V/236H/245R/260A；

68A/103A/104I/159D/23E/232V/236H/245R/248D/252K；

68A/103A/104I/159D/183D/232V/236H/245R/248D/252K；

68A/103A/104I/159D/232V/236H/245R；

68A/103A/104I/159D/230V/232V/236H/245R；

68A/103A/104I/159D/232V/236H/245R/257V；

68A/103A/104I/159D/213G/232V/236H/245A/248D/252K；

68A/103A/104I/159D/185D/232V/236H/245R/248D/252K；

68A/103A/104I/159D/185D/210L/232V/236H/245R/248D/252K；

68A/103A/104I/159D/210L/232V/236H/245R/248D/252K；

68A/103A/104I/159D/213G/232V//236H/245R；

98L/103A/104I/159D/232V/236H/245R/248D/252K；

98L/102A/103A/104I/159D/212G/232V/236H/245R/248D/252K；

101G/103A/104I/159D/232V/236H/245R/248D/252K；

102A/103A/104I/159D/232V/236H/245R/248D/252K；

103A/104I/159D/230V/236H/245R；

103A/104I/159D/232V/236H/245R/248D/252K；

103A/104I/159D/217E/232V/236H/245R/248D/252K；

103A/104I/130G/159D/232V/236H/245R/248D/252K；

103A/104I/131V/159D/232V/236H/245R/248D/252K；

103A/104I/159D/213R/232V/236H/245R/248D/252K; With

103A/104I/159D/232V/236H/245R.

Most preferred ease variants comprises and is selected from following replacement combination: 101/103/104/159/232/236/245/248/252, and 101G/103A/104I/159D/232V/236H/245R/248D/252K preferably.

Be applicable to that cellulase of the present invention comprises bacterium or fungal cellulase.The best pH scope of these cellulases is 5-9.5 preferably.Suitable cellulase is disclosed in people's such as Barbesgoard the United States Patent (USP) 4,435,307, and it discloses the mould cellulase that is produced by Humicola insolens.Suitable cellulase also is disclosed in GB-A-2.075.028; Among GB-A-2.095.275 and the DE-OS-2.247.832.

The example of this cellulase is the cellulase that is produced by Humicola insolens (the Humicola grisea var.thermoidea of grey humicola lanuginosa variation) bacterial strain, particularly Humicola strain DSM 1800.

Other suitable cellulase is the cellulase that is produced by Humicola insolens, and its molecular weight is that about 50KDa, iso-electric point are 5.5 and contain 415 amino acid; With by Humicola insolens, DSM 1800 deutero-have cellulase activity ~ endoglucanase of 43kD; Preferred endoglucanase component has disclosed aminoacid sequence in PCT patent application WO91/17243.Suitable cellulase also has the EGIII cellulase that is obtained by Trichoderma longibrachiatum, and it is described among the WO94/21801 of the disclosed Genencor of 1994.9.29.Specially suitable cellulase is the cellulase with color-protecting function.The example of this cellulase is those cellulases of describing in the european patent application 91202879.2 (Novo) of 1991.11.6 application.Carezyme and Celluzyme (Novo Nordisk A/S) are particularly suitables.Also can be referring to WO91/17243.

Peroxidase is being known in the art, and it comprises as horseradish peroxidase, lignoenzyme and halo peroxidase, as chloro and bromoperoxidase.The bleach system that contains peroxidase is disclosed in the patent described as follows: United States Patent (USP) 5,576,282,5,728,671 and 5,707,950, PCT International Application No. WO 89/099813 is among the European patent application EP 91202882.6 of WO89/09813 and 1991.11.6 application and the EP96870013.8 of 1996.2.20 application.Suitable laccase in addition.

The thiodiphenylamine that preferred synergistic agent is replacement is with phenoxazine, lysivane propionic acid (PPT), 10-ethyl thiodiphenylamine-4-carboxylic acid (EPC), 10-phenoxazine propionic acid (POP) and 10-Jia Ji phenoxazine (being described among the WO94/12621) and the cloves ester (the alkyl cloves ester that C3-C5 replaces) and the phenol that replace.SPC-D or Sodium peroxoborate are preferred hydrogen peroxide cources.

The described peroxidase content that adds this bleach system generally is the organized enzyme of the 0.0001%-2% of this bleach system weight.

Other preferred enzyme that bleach system of the present invention can comprise comprises lipase.The lipase that is applicable to washing composition comprises by the microorganism in the Rhodopseudomonas family, as is disclosed in English Patent 1,372, those lipase that Situ Ci Shi (stutzeri) aeruginosa atcc 19.154 in 034 produces.Suitable lipase comprises that the antibody to lipase that is produced by microorganism Pseudomonas fluorescens IAM1057 shows those lipase of positive immunological cross-reaction.This lipase can be that lipase P " Amano " (below be called " Amano P ") is purchased from the Amano Pharmaceutical Co.Ltd. of Japan Nagoya with the trade mark.Other suitable commercially available lipase comprises Amano-CES, the lipase that obtains by thickness look bacillus (Chromobacter viscosum), for example the lipolyticum NRRLB 3673 of the thickness look bacillus variation that obtains by the Toyo Jozo Co. of day Honda Fang Jun; Thickness look bacillus lipase that obtains with Disoynth Co. and the lipase that obtains by Tang Changpu pseudomonas (Pseudomonas gladioli) by the U.S.Biochemical Corp. of the U.S. and Holland.Specially suitable lipase is such as M1LIPASE ^And LIPOMAX ^(Gist-Brocades) and LIPOLASE ^And LIPOLASEULTRA ^(Novo) lipase has been found that when they are used in combination with composition of the present invention very effective.

Suitable enzyme also has at [EC 3.1.1.50], and it is considered to a kind of lipase of particular variety, does not promptly need the lipase of interface activation.Adding in bleach system is described in as among the WO88/09367 (Genencor).

Lipase and/or the at generally add-on in bleach system are the organized enzyme of the 0.0001%-2% of this bleach system weight.

Known amylase can be included (α and/or β), is used to remove the spot of carbohydrate-based.1994.2.3 described the cleaning combination that adds mutant amylase among the WO94/02597 of disclosed Novo Nordisk A/S.Also can be referring to the WO94/18314 of the disclosed Genencor of 1994.8.18 and the WO95/10603 of the disclosed Novo Nordisk of 1995.4.20 A/S.Other the known amylase that is used for bleach system comprises α-and beta-amylase.α-Dian Fenmei is being known in the art, and comprises that those are disclosed in United States Patent (USP) 5,003,257; EP 252,666; WO91/00353; FR2,676,456; EP285,123; EP525,610; EP368,341; With british patent specification 1,296, the amylase among 839 (Novo).Other suitable amylase is stable enhanced amylase, and it comprises the PURAFACT OX AM among the WO96/05295 that is described in disclosed WO94/18314 of 1994.8.18 and the disclosed Genencor of 1996.2.22 ^With the disclosed amylase variant that can be purchased from Novo Nordisk A/S among the April nineteen ninety-five disclosed WO95/10603.

The example that the merchant sells the α-Dian Fenmei product is the TERMAMYL that all can be purchased from Novo Nordisk A/S Denmark ^, BAN ^, FUNGAMYL ^And DURAMYL ^Described other suitable amylase among the WO95/26397: α-Dian Fenmei is characterized in that passing through Phadebas ^The alpha-amylase activity measuring, the specific activity that has under the 8-10 scope in 25-55 ℃ temperature and pH value compares TERMAMYL ^Specific activity height at least 25%.Have improvement about live vol and thermostability and more other amylase of high reactivity amount bonded character be described among the WO95/35382.

Composition of the present invention can also comprise mannase.Mannase is preferably selected from following three kinds of mannosans lytic enzymes: EC 3.2.1.25: beta-Mannosidase, the EC 3.2.1.78 that is called " mannase " below: interior-1,4-beta-Mannosidase and EC3.2.1.100:1, the biological Glycosylase of 4-β-sweet dew and composition thereof (IUPAC classification-enzyme nomenclature, 1992 ISBN 0-12-227165-3 Academic Press).

When having mannase in the treatment compositions of the present invention, it more preferably comprises the β-1 that is called mannase, 4-mannosidase (E.C.3.2.1.78).Term " mannase " or " polygalactomannan enzyme " expression are according to the mannase of official definition in the prior art, it is called as mannosans interior-1, the 4-beta-Mannosidase, also can be called 'beta '-mannase and interior-1, the 4-mannase, and catalysis is in mannosans, polygalactomannan, glucomannan and galactoglucomannan 1, the reaction of the random hydrolysis of 4-β-D-seminose glycosidic bond.

Specifically, mannase (EC 3.2.1.78) is made of one group of polysaccharidase, its mannosans of degrading, and represent to rupture to contain the enzyme of the unitary polysaccharide chain of seminose, promptly can break at the enzyme of the glycosidic link in mannosans, polygalactomannan, glucomannan and the galactoglucomannan.Mannosans is to contain by β-1, the polysaccharide of the skeleton that the seminose that 4-connects is formed; Glucomannan is to contain more or less isotactic β-1, the polysaccharide of the seminose that 4-connects and the skeleton of glucose; Polygalactomannan and galactoglucomannan are mannosans and the polygalactomannan that has the galactose side of α-1,6 connection.These compounds can be acetylation.

Can promote the degraded of polygalactomannan and galactoglucomannan by removing galactose side wholly or in part.In addition, can promote mannosans, glucomannan, polygalactomannan and the galactoglucomannan degraded of ethanoylization by deacetylationization wholly or in part.Can remove ethanoyl with alkali or mannosans acetylase.Can further degrade by mannase or by the oligopolymer that the mixture of mannase and alpha-galactosidase and/or mannosans acetylase discharges, from beta-Mannosidase and/or beta-glucosidase enzyme, to discharge free maltose.

Mannase is identified in some bacillus biologies.People's such as Talbot Appl.Environ.Microbiol. for example, 56 volumes, No.11 has described a kind of 'beta '-mannase of the dimeric forms that is obtained by bacstearothermophilus in the 3505-3510 page or leaf (1990), it has the molecular weight of 162kDa and the best pH of 5.5-7.5.People's such as Mendoza World J.Mi crobiol.Biotech., 10 volumes, No.5, having described the molecular weight that is obtained by subtilis in the 551-555 page or leaf (1994) is 38kDa, is that optimum activity and pI are arranged under 5.0 and 55 ℃ is 4.8 'beta '-mannase at pH.Disclosing the molecular weight that has with gel filteration determining that is obtained by Bacillaceae among the JP-03047076 is 373kDa, and best pH is that 8-10 and pI are the 'beta '-mannase of 5.3-5.4.Alkalescence, the heat-staple 'beta '-mannase of preparation has been described among the JP-63056289, the β of its hydrolysis such as mannosans-1,4-D-mannopyranose glycosidic bond produces manna oligosaccharide.JP-63036774 relates to bacillus micro-organism FERM P-8856, and it produces 'beta '-mannase and beta-Mannosidase under alkaline pH.The alkaline ' beta '-mannase that is obtained by close alkali bacillus AM001 is disclosed among the JP-08051975.A kind of pure mannase that is used for bleached pulp and paper from bacillus amyloliquefaciens and preparation method thereof is disclosed among the WO97/11164.Described among the WO91/18974 a kind of under limit pH and temperature active hemicellulase, as dextranase, zytase or mannase.Disclose among the WO94/25576 by microorganism Aspergillus aculeatus, CBS 101.43 obtains has the active enzyme of mannase, and it can be used for degraded or improved plant or alga cells wall material.The isolating mannase that is used for the bleaching lignin cellulose pulp from Trichoderma reseei is disclosed among the WO93/24622.The hemicellulase of the hemicellulose that having described among the WO91/18974 to degrade contains mannosans has been described the pure mannase that is obtained by bacillus amyloliquefaciens among the WO97/11164.

Mannase is the alkali mannanase as giving a definition preferably, is more preferably the mannase that is obtained by bacterial origin.Laundry detergent composition of the present invention includes the alkali mannanase that is selected from following mannase especially: the mannase that is obtained by bacterial strain Bacillus agaradhaerensNICMB 40482; By bacillus subtilis strain 168, the mannase that gene yght obtains; Mannase that obtains by bacillus I633 and/or the mannase that obtains by bacillus AAI12.Being included in most preferred mannase in the detergent composition of the present invention is the mannase that is produced by bacillus I633, and it is described in application number is in 1,998 01340 the common unsettled Danish Patent Application.

Term " alkali mannanase " is meant and is included in 7-12, has at least 10% of maximum activity in the given pH scope of preferred 7.5-10.5, preferably at least 25%, and the more preferably enzyme of at least 40% enzymic activity.

Series number is to have described the alkali mannanase that is obtained by Bacillus agaradhaerens NICMB 40482 in 09/111,256 the common unsettled U.S. Patent application.More particularly, this mannase is:

I) by Bacillus agaradhaerens, the polypeptide of NCIMB 40482 preparations; Or

Ii) contain just like series number is the polypeptide of the aminoacid sequence as shown in the position 32-343 of SEQID NO:2 shown in 09/111,256 the U.S. Patent application; Or

Iii) at i) or ii) in the analogue of polypeptide of definition, it has 70% similarity at least with described polypeptide, or by replace, disappearance or additional one or more amino acid obtain by described polypeptide, or the polyclonal antibody that the described polypeptide of relative purified form produces are immunoreactivity.

The present invention also comprises having the active isolated polypeptide of mannase accordingly, and it is selected from:

(a) to have the polynucleotide molecule of mannosans peptide activity, described polypeptide to contain just like series number be the nucleotide sequence shown in Nucleotide 97-Nucleotide 1029 among the SEQ ID NO:1 shown in 09/111,256 the U.S. Patent application to coding;

(b) homologue (a);

(c) polynucleotide molecule, its coding have mannosans enzymic activity, the polypeptide identical with the aminoacid sequence at least 70% that as series number is amino-acid residue 32-amino-acid residue 343 among the SEQ ID NO:2 shown in 09/111,256 the U.S. Patent application;

(d) with (a) and (b) or (c) complementary molecule; With

(e) (a) and (b), (c) or degenerate nucleotide sequence (d).

The plasmid pSJ1678 that contains the polynucleotide molecule (dna sequence dna) of this mannase of encoding is converted into coli strain, it by the present inventor according to Budapest microbial preservation international convention, for the purpose of patented procedure on May 18th, 1998 at Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1b, D-38124 Braunschweig, Federal Republic ofGermany has carried out preservation, and preserving number is DSM 12180.

Second kind of preferred enzyme is that series number is the mannase of describing in 09/095,163 the common unsettled U.S. Patent application that is obtained by Bacillus strain 168.More particularly, this mannase is:

I) by series number be the dna sequence dna as shown in SED IDNo.5 that provides in 09/095,163 the U.S. Patent application or as described in the encoding part coding of analogue of sequence; And/or

Ii) containing just like sequence number is the polypeptide of aminoacid sequence as shown in SEQID No.6 that provides in 09/095,163 the U.S. Patent application; Or

Iii) ii) in the analogue of polypeptide of definition, it and described polypeptide have at least 70% similarity, or by replace, disappearance or additional one or more amino acid obtain by described polypeptide, or the polyclonal antibody that the described polypeptide of relative purified form produces are immunoreactivity.

(a) to have the polynucleotide molecule of mannosans peptide activity, described polypeptide to contain just like sequence number be the nucleotide sequence as shown in SEQ ID NO:5 that provides in 09/095,163 the U.S. Patent application to coding;

(b) homologue (a);

(c) polynucleotide molecule, its coding have mannosans enzymic activity, the polypeptide identical with the aminoacid sequence at least 70% that as sequence number is the SEQ ID NO:6 that provides in 09/095,163 the U.S. Patent application;

(d) with (a) and (b) or (c) complementary molecule; With

(e) (a) and (b), (c) or degenerate nucleotide sequence (d).

It is in 1,998 01340 the common unsettled Danish Patent Application that the third preferred mannase is described in application number.More particularly, this mannase is:

I) polypeptide that produces by bacillus I633;

Ii) containing just like application number is the polypeptide of aminoacid sequence as shown in the position 33-340 of SEQID NO:2 that provides in 1,998 01340 the Danish Patent Application; Or

Iii) at i) or ii) in the analogue of polypeptide of definition, it and described polypeptide have at least 65% similarity, or by replace, disappearance or additional one or more amino acid obtain by described polypeptide, or the polyclonal antibody that the described polypeptide of relative purified form produces are immunoreactivity.

The present invention also comprises corresponding isolating polynucleotide molecule, and it is selected from:

(a) to have the polynucleotide molecule of mannosans peptide activity, described polypeptide to contain just like application number be the nucleotide sequence shown in Nucleotide 317-Nucleotide 1243 among the SEQ ID NO:1 that provides in 1,998 01340 the Danish Patent Application to coding;

(b) homologue (a);

(c) polynucleotide molecule, its coding have mannosans enzymic activity, the polypeptide identical with the aminoacid sequence at least 65% that as application number is amino-acid residue 33-amino-acid residue 340 among the SEQ ID NO:2 that provides in 1,998 01340 the Danish Patent Application;

(d) with (a) and (b) or (c) complementary molecule; With

(e) (a) and (b), (c) or degenerate nucleotide sequence (d).

The plasmid pBXM3 that contains the polynucleotide molecule (dna sequence dna) of the mannase of the present invention of encoding is converted into coli strain, it by the present inventor according to Budapest microbial preservation international convention, for the purpose of patented procedure on May 29th, 1998 at DeutscheSammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg lb, D-38124 Braunschweig, Federal Republic ofGermany has carried out preservation, and preserving number is DSM 12197.

It is in 1,998 01341 the common unsettled Danish Patent Application that the 4th kind of preferred mannase is described in application number.More particularly, this mannase is:

I) polypeptide that produces by bacillus AAI 12;

Ii) containing just like application number is the polypeptide of aminoacid sequence as shown in the position 25-362 of SEQID NO:2 that provides in 1,998 01341 the Danish Patent Application; Or

(a) to have the polynucleotide molecule of mannosans peptide activity, following polypeptide to contain just like application number be the nucleotide sequence shown in Nucleotide 225-Nucleotide 1236 among the SEQ ID NO:1 that provides in 1,998 01341 the Danish Patent Application to coding;

(b) homologue (a);

(c) polynucleotide molecule, its coding have mannosans enzymic activity, the polypeptide identical with the aminoacid sequence at least 65% that as application number is amino-acid residue 25-amino-acid residue 362 among the SEQ ID NO:2 that provides in 1,998 01341 the Danish Patent Application;

(d) with (a) and (b) or (c) complementary molecule; With

(e) (a) and (b), (c) or degenerate nucleotide sequence (d).

The plasmid pBXM that contains the polynucleotide molecule (dna sequence dna) of the mannase of the present invention of encoding is converted into coli strain, it by the present inventor according to Budapest microbial preservation international convention, for the purpose of patented procedure on October 7th, 1998 at DeutscheSammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1b, D-38124 Braunschweig, Federal Republic ofGermany has carried out preservation, and preserving number is DSM 12433.

If there is mannase, the preferably 0.0001%-2% of said composition weight, more preferably 0.0005%-0.1%, the most preferably pure enzyme of 0.001%-0.02% of its add-on in treatment compositions of the present invention then.

Composition of the present invention can also comprise xyloglucanase enzymes.Be applicable to that xyloglucanase enzymes of the present invention is the enzyme that xyloglucan is shown distinctive endoglucanase activity, its measure said composition weight preferably about 0.001% to about 1%, more preferably from about 0.01% to about 0.5%.The meaning of the term that uses among the application " endoglucanase activity " is that enzymic hydrolysis is present in 1 in any cellulose materials such as Mierocrystalline cellulose, derivatived cellulose, lichenstarch, callose or the xyloglucan, the ability of 4-β-D-glycosidic linkage.Endoglucanase activity can be measured according to method well known in the art, and some examples wherein are described in WO94/14953 and reach hereinafter.The endoglucanase activity of one unit is (as CMCU, AVIU, XGU or BGU) be defined as from dextran matrix produce 1 μ mol reducing sugar/minute, dextran matrix is Microcrystalline Cellulose (AVIU), xyloglucan (XGU) or the cereal beta-glucan (BGU) as CMC (CMCU), acid-swellable.The method mensuration that reducing sugar is pressed WO94/14953 and hereinafter described.Endoglucanase is defined as units/milligram protein to the specific activity of matrix.

Suitable enzyme shows XGU endoglucanase activity for its maximum activity (below be called " distinctive to xyloglucan "), this enzyme:

i ) DNA ( a ) ATTCATTTGT GGACAGTGGA C ( SEQ ID NO：1 ) ( b ) GTTGATCGCA CATTGAACCA ( SEQ ID NO：2 ) ( c ) ACCCCAGCCG ACCGATTGTC ( SEQ ID NO：3 ) ( d ) CTTCCTTACC TCACCATCAT ( SEQ ID NO：4 ) ( e ) TTAACATCTT TTCACCATGA ( SEQ ID NO：5 ) ( f ) AGCTTTCCCT TCTCTCCCTT ( SEQ ID NO：6 ) ( g ) GCCACCCTGG CTTCCGCTGC CAGCCTCC ( SEQ ID NO：7 ) ( h ) GACAGTAGCA ATCCAGCATT ( SEQ ID NO：8 ) ( i ) AGCATCAGCC GCTTTGTACA ( SEQ ID NO：9 ) ( j ) CCATGAAGTT CACCGTATTG ( SEQ ID NO：10 ) ( k ) GCACTGCTTC TCTCCCAGGT ( SEQ ID NO：11 ) ( l ) GTGGGCGGCC CCTCAGGCAA ( SEQ ID NO：12 ) ( m ) ACGCTCCTCC AATTTTCTCT ( SEQ ID NO：13 ) ( n ) GGCTGGTAG TAATGAGTCT ( SEQ ID NO：14 ) ( o ) GGCGCAGAGT TTGGCCAGGC ( SEQ ID NO：15 ) ( p ) CAACATCCCC GGTGTTCTGG G ( SEQ ID NO：16 ) ( q ) AAAGATTCAT TTGTGGACAG TGGACGTTGA TCGCACATTG AACCAACCCCAGCCGACCGATTGTCCTTCC TTACCTCACC ATCATTTAAC ATCTTTTCAC CATGAAGCTTTCCGTTCTCTCCCTTGCCAC CCTGGCTTCC GCTGCCAGCC TCCAGCGCCG CACACTTCTGCGGTCAGTGGGATACCGCCA CCGCCGGTGA CTTCACCCTG TACAACGACC TTTGGGGCGAGACGGCCGGCACCGGCTCCC AGTGCACTGG AGTCGACTCC TACACCGGCG ACACCATCGCTTGTCACACCAGCAGGTCCT GGTCGGAGTA GCAGCAGCGT CAAGAGCTAT GCCAACG ( SEQ IDNO：17 ) or ( r ) CAGCATCTCC ATTGAGTAAT CACGTTGGTG TTCGGTGGCC CGCCGTGTTGCGTGGCGGAGGCTGCCGGGA GACGGGTGGG GATGGTGGTG GGAGAGAATG TAGGGCGCCGTGTTTCAGTCCCTAGGCAGG ATACCGGAAA ACCGTGTGGT AGGAGGTTTA TAGGTTTCCAGGAGACGCTGTATAGGGGAT AAATGAGATT GAATGGTGGC CACACTCAAA CCAACCAGGTCCTGTACATACAATGCATAT ACCAATTATA CCTACCAAAA AAAAAAAAAAA AAAAAAAAAA AAAA ( SEQ ID NO：18 )

Ii) to by i) in definition dna sequence encoding and be obtained from microorganism Aspergillus aculeatus, the antibody that the high purifying endoglucanase of CBS 101.43 produces is immunoreactivity and distinctive to xyloglucan.

More particularly, the meaning of the term that uses among the application " distinctive to xyloglucan " is that endoglucanase shows its maximum endoglucanase activity to xyloglucan matrix, preferably be lower than 75% activity and the matrix of other cellulose such as carboxymethyl cellulose, Mierocrystalline cellulose or other dextran shown, more preferably less than 50% activity, most preferably be lower than about 25% activity.

Endo-dextranase preferably is further defined as relative reactivity to the peculiar property of xyloglucan, and it is determined as under top condition and cultivates the reducing sugar burst size that enzyme obtains with xyloglucan and other tested matrix respectively.For example, peculiar property may be defined as the activity (XGU/BGU) of xyloglucan with respect to beta-glucan, xyloglucan is with respect to the activity (XGU/CMCU) of carboxymethyl cellulose, or xyloglucan is with respect to the activity (XGU/AVIU) of the Microcrystalline Cellulose of acid-swellable, its value is preferably greater than about 50, as 75,90 or 100.

The term that uses among the application " is obtained from " and not only is meant the endoglucanase that is produced by bacterial strain CBS 101.43, but also refers to from bacterial strain CBS 101.43 isolated dna sequence encoding and the endoglucanase that produces in host's organism of translating with said dna sequence dna.The term that uses among the application " homologue " expression is by the polypeptide of dna encoding, described DNA hybridization is to same probe, under some prescribed condition, (for example be pre-soaked among the 5xSSC, and the 5xSSC under-40 ℃, prehybridization is 1 hour in the bovine chest gland DNA solution of 5xDenhardt solution and 50 μ g sex change sonications, then in the same solution that has replenished 50 μ Ci 32-P-dCTP label probes,-40 ℃ of following hybridization 18 hours and under 40 ℃, 2xSSC, washing is three times among the 0.2%SDS, and the time is 30 minutes) as DNA password to the distinctive endoglucanase of xyloglucan.More particularly, the meaning of this term be meant with above shown in coding any sequence of the distinctive endoglucanase of xyloglucan is had at least 70% homologous dna sequence dna, comprise with above shown in any sequence at least 75%, at least 80%, at least 85%, at least 90% or even at least 95% homology.Wish that this term comprises the modification to any dna sequence dna shown in above, the Nucleotide that does not for example produce by another aminoacid sequence of the polypeptide of this sequence encoding replaces, but it is used corresponding to the organic codon of the host who has introduced the dna structure that comprises any above-mentioned dna sequence dna, or the Nucleotide replacement that produces different aminoacid sequences and may produce different aminoacid sequences thus and may obtain different protein structures thus, it may produce with original enzyme has endoglucanase mutant of different nature.Other example of possible modification is with in one or more Nucleotide insertion sequences, adds one or more Nucleotide at sequence one end, or lacks one or more Nucleotide in sequence one end or sequence.

Be applicable to of the present invention the distinctive endoglucanase of xyloglucan preferably to be had XGU/BGU, XGU/CMU and/or XGU/AVIU than (as above-mentioned definition) greater than 50, a kind of endoglucanase as 75,90 or 100.

In addition, to the distinctive endoglucanase of xyloglucan when the activity to xyloglucan is 100%, preferably basically to the beta-glucan non-activity and/or carboxymethyl cellulose and/or avicel cellulose are shown maximum 25%, the activity as maximum 10% or about 5%.In addition, of the present invention to the preferred essentially no transferase active of the distinctive endoglucanase of xyloglucan, observed the distinctive most of endoglucanase of the xyloglucan of plant-sourced have been had this activity.

As described in WO 94/14953, can obtain by the mould species microorganism Aspergillus aculeatus the distinctive endoglucanase of xyloglucan.The distinctive microorganism endoglucanase of xyloglucan also is described in 94/14953.The distinctive endoglucanase of the xyloglucan that is obtained by plant is also described to some extent, but these enzymes have transferase active, when therefore no matter when needing thoroughly to degrade xyloglucan, it all is considered to inferior to the distinctive microorganism endoglucanase of xyloglucan.Another advantage of microbial enzyme is, generally the volume production that they can be higher than the enzyme in other source in microorganism host is given birth to.

If there is xyloglucanase enzymes, the preferably 0.0001%-2% of said composition weight, more preferably 0.0005%-0.1%, the most preferably pure enzyme of 0.001%-0.02% of its add-on in treatment compositions of the present invention then.

Above-mentioned enzyme can have any suitable source, for example plant, animal, bacterium, mould and yeast source.Can use the purifying or the non-purified form of these enzymes.By defining the mutant that natural enzyme is arranged that also comprises.Mutant can by as natural enzyme carried out protein and/or genetic engineering, chemistry and/or physical modification obtain.Common way is to express enzyme by host's organism, wherein the responsible genetic material that produces enzyme of clone in host's organism.

The described enzyme generally add-on in bleach system is the organized enzyme of the 0.0001%-2% of this bleach system weight.This enzyme can be used as that single component independently adds (containing a kind of ball, grain of enzyme, stable liquid etc.) or as the mixture adding (for example composite particles) of two or more enzymes.

Other suitable detergent ingredients that can add is the oxydasis scavenging agent.The example of this kind of enzyme oxidation scavengers is four ethylidene polyamine of ethoxylation.

Class of enzymes material and the method that they are added in the synthetic bleach system also are disclosed in the following patent: the WO93/07263 and the WO93/07260 that are issued to Genencor International; Be issued to the WO 89/08694 of Novo; Be issued to people's such as McCarty United States Patent (USP) 3,553,139 with 1971.1.5.Some enzymes also are disclosed in 1978.7.18 and are issued in people's such as Place United States Patent (USP) 4,101,457 and the United States Patent (USP) 4,507,219 that 1985.3.26 is issued to Hughes.Be applicable to the enzyme material of liquid detergent formula and they are added method in these prescriptions and be disclosed in the United States Patent (USP) 4,261,868 that 1981.4.14 is issued to people such as Hora.

The enzyme of enzyme stabilizers-be used for washing composition can make its stabilization with various technology.The enzyme stabilization technology is open and exemplify the United States Patent (USP) 3,600,319 that is issued to people such as Gedge at 1971.8.17, the EP199 that 1986.10.29 is issued to Venegas, in 405 and EP200,586.The enzyme stabilising system also is described in as United States Patent (USP) 3,519, in 570.The useful bacillus AC13 that produces proteolytic enzyme, zytase and cellulase is described among the WO9401532 that is issued to Novo.The enzyme that uses among the application can exist in the final product composition having and can provide the water-soluble calcium of calcium and/or magnesium ion and/or magnesium ion source to stablize to described enzyme by making.Suitable enzyme stabilizers and consumption thereof are described in United States Patent (USP) 5,576, in 282.

Other detergent ingredients-bleach system of the present invention also can randomly contain one or more following compositions: polymeric dispersant, clay soil remove agent/anti redeposition agent, whitening agent, suds suppressor, dyestuff, spices, structure elasticizer, fabric softener, carrier, hydrotropic agent, processing aid and/or pigment.The suitable example of these other detergent ingredients and consumption thereof can be at United States Patent (USP)s 5,576, search in 282.

Washing methods-except that the described laundering of textile fabrics of the application, bowl dish and other crust and individual's cleaning body part, the present invention also comprises the laundry pretreatment process to dirty fabric, and this method is included in the above-mentioned bleach system with the height conc forms before traditional aqueous cleaning solution laundering of textile fabrics and directly contacts with stain and/or dirty point.Preferably, pretreatedly this bleach system and stain/dirty point were kept in touch about 30 seconds to 24 hours before dirty substrate is arranged washing this in a conventional manner.More preferably, the pretreatment time scope is about 1-180 minute.

Following embodiment is used for illustration composition of the present invention, rather than is used for restriction or defines scope of the present invention in addition.

Used some shorteningss known to a person of ordinary skill in the art among the following embodiment, its disclosure with the application is consistent.

Example I

Bleach detergent compositions with following prescription illustration granular laundry detergent form.

A B C D E* 0.034 0.06 0.03 0.10 0.05 ( NOBS ) 2.00 2.80 2.00 1.80 5.30 ( TAED ) 0.00 0.00 0.60 0.00 0.00 5.30 0.00 0.00 4.00 0.00 0.00 5.30 3.60 0.00 4.30 12.00 0.00 12.00 0.00 21.00C45AE0.6S 0.00 15.00 0.00 15.00 0.00C2 N- 0.00 2.00 0.00 2.00 0.00C12 1.50 0.00 1.50 0.00 0.00 N- 1.70 2.00 1.70 2.00 0.00C12 1.50 0.00 1.50 0.00 0.00AE23-6.5T 2.50 3.50 2.50 3.50 1.00C25E3S 4.00 0.00 4.00 0.00 0.00 25.00 25.00 15.00 15.00 25.00/ 0.00 0.00 0.00 0.00 1.00, 3.00 3.00 3.00 3.00 0.00 0.00 0.00 0.50 0.40 0.00 0.40 0.40 0.40 0.40 0.40 2.00 2.00 2.00 0.00 8.00 3.00 3.00 3.00 3.00 6.00 5.00 5.00 5.00 5.00 5.00Savinase ( 4T ) 1.00 1.00 1.00 1.00 0.60Termamyl ( 60T ) 0.40 0.40 0.40 0.40 0.40Lipolase ( 100T ) 0.12 0.12 0.12 0.12 0.12Carezyme ( 5T ) 0.15 0.15 0.15 0.15 0.15 1.60 1.60 1.60 1.60 0.40 ( ) 0.20 0.20 0.20 0.05 0.20 0.50 0.00 0.25 0.00 0.00MgSO₄2.20 2.20 2.20 2.20 0.64Na ₂SO ₄Equal amount equal amount equal amount equal amount equal amount * organic catalyst can be any zwitter-ion organic catalyst described in the application, and preferably the imido grpup organic catalyst is more preferably dihydro-isoquinoline base organic catalyst.

Above-mentioned arbitrary composition can be used for laundering of textile fabrics, and during washing, its concentration in 25 ℃ water is 3500ppm, water: the clothing ratio is 15: 1.Its pH generally is about 9.5, still, can pass through the pH of adjusting recently of the alkylbenzene sulfonate of change acid and sodium-salt form.

Example II

A B C D E* 0.009 0.04 0.14 0.14 0.002 ( NOBS ) 1.80 0.00 0.00 1.00 1.00 ( TAED ) 0.00 1.00 2.50 3.00 0.00 5.30 0.00 0.00 0.00 0.00 0.00 9.00 17.60 9.00 9.00 21.00 12.00 0.00 12.00 12.00C45AE0.6S 0.00 0.00 15.00 0.00 0.00C2 N- 0.00 0.00 2.00 0.00 0.00C12 0.00 1.50 0.00 1.50 1.50 N- 0.00 1.70 2.00 1.70 1.70C12 1.00 1.50 0.00 1.50 1.50AE23-6.5T 0.00 2.50 3.50 2.50 2.50C25E3S 0.00 4.00 0.00 4.00 4.00 25.00 15.00 25.00 15.00 15.00, 0.00 3.00 3.00 3.00 3.00 0.30 0.50 0.00 0.50 0.50 0.00 0.40 0.40 0.40 0.40 0.00 2.00 2.00 2.00 2.00 6.00 3.00 3.00 3.00 3.00 2.00 5.00 5.00 5.00 5.00Savinase ( 4T ) 0.60 1.00 1.00 1.00 1.00Termamyl ( 60T ) 0.40 0.40 0.40 0.40 0.40Lipolase ( 100T ) 0.12 0.12 0.12 0.12 0.12Carezyme ( 5T ) 0.15 0.15 0.15 0.15 0.15 0.40 0.00 1.60 0.00 0.00 ( ) 0.20 0.30 0.20 0.30 0.30 0.25 0.00 0.00 0.00 0.00MgSO₄0.64 0.00 2.20 0.00 0.00Na ₂SO ₄Equal amount equal amount equal amount equal amount equal amount * organic catalyst can be any zwitter-ion organic catalyst described in the application, and preferably the imido grpup organic catalyst is more preferably dihydro-isoquinoline base organic catalyst.

EXAMPLE III

A kind of bleach detergent powder of the present invention comprises following compositions: composition Wt% organic catalyst * 0.01NOBS 2.0 4 hydrated sodium perborate 10C12 linear alkylbenzene sulfonate (LAS) 8 phosphate (sodium phosphate trimer) 9 sodium carbonate 20 micas 15 brightening agents; Spices 0.3 sodium chloride, 25 water and minor materials aequum to 100%* organic catalyst can be any amphion organic catalysts described in the application; Preferably the imido grpup organic catalyst is more preferably dihydro-isoquinoline base organic catalyst.

EXAMPLE IV

Be applicable to the laundry bars of the dirty fabric of hand washing with the preparation of standard extrusion molding; This laundry bars comprises following compositions: composition Wt% organic catalyst * 0.02NOBS 1.7TAED 0.2 4 hydrated sodium perborate 12C12 linear alkylbenzene sulfonate (LAS) 30 phosphate (sodium phosphate trimer) 10 sodium carbonate 5 sodium pyrophosphate 7 coconut oil base single ethanol amides, 2 Wessalith CSs (0.1-10 micron) 5 carboxymethyl celluloses 0.2 polyacrylate (molecular weight: 1400) 0.2 brightening agent, spices 0.2 proteinase-10 .3CaSO₄1MgSO ₄1 water, 4 fillers ²Balance to 100%* organic catalyst can be any zwitter-ion organic catalyst described in the application, and preferably the imido grpup organic catalyst is more preferably dihydro-isoquinoline base organic catalyst. ²Can be selected from material such as the CaCO being convenient to obtain ₃, mica, clay, silicate etc.Acid filler can be used for reducing pH.

EXAMPLE V

Be applicable to the laundry detergent composition of machine washing with the standard law preparation; Said composition comprises following compositions: it can be any amphion organic catalyst described in the application that composition Wt% organic catalyst * 0.3TAED 10.0 four hydrated sodium perborates 9.2 sodium carbonate 23.74 anion surfactants 14.80 aluminosilicates 21.30 silicate 1.85 diethylene-triamine pentaacetic acids 0.43 polyacrylic acid 2.72 brightening agents 0.23 polyethylene glycol solid 1.05 sulfate 8.21 spices 0.25 processing aid 0.10 impurity 0.43 level is weighed the * organic catalyst; Preferably the imido grpup organic catalyst is more preferably dihydro-isoquinoline base organic catalyst.

Said composition can be used for laundering of textile fabrics, and during washing, its concentration in 20-40 ℃ solution is about 1000ppm, and water and fabric ratio are about 20: 1.

It can be any amphion organic catalyst described in the application that example VI composition Wt% organic catalyst * 0.082NOBS 7.20 four hydrated sodium perborates 8.0 sodium carbonate 21.0 anion surfactants 12.0 aluminosilicates 18.0 diethylene-triamine pentaacetic acids 0.3 non-ionic surface active agent 0.5 polyacrylic acid 2.0 brightening agents 0.3 sulfate 17.0 spices 0.25 impurity 2.95 levels are weighed the * organic catalyst; Preferably the imido grpup organic catalyst is more preferably dihydro-isoquinoline base organic catalyst.

Said composition can be as the subsidiary of laundering of textile fabrics, and during use, its concentration in 5-50 ℃ solution is about 850ppm, and water and fabric ratio are about 20: 1.

Example VII A

Being fit to has following prescription with the bleaching composition that high foam phosphate shape uses: composition A (wt%) B (wt%) organic catalyst * 0.02 0.018NOBS 1.90 2.00 four hydrated sodium perborates 2.25 3.00 sodium carbonate 13.00 13.00 anion surfactants 19.00 19.00 cationic surfactants 0.60 0.60 non-ionic surface active agent-0.40 sodium phosphate trimer 22.50 22.50 diethylene-triamine pentaacetic acids 0.90 0.90 acrylic acid/maleic acid 0.90 0.90 carboxymethyl cellulose 0.40 0.40 proteinase-10 .70 0.70 amylase 0.36 0.36 cellulase 0.35 0.35 brightening agent 0.16 0.18 magnesium sulfate 0.70 0.70 water 3.0 1.0 sodium sulphate aequum aequum * organic catalysts can be any amphion organic catalysts described in the application; Preferably the imido grpup organic catalyst is more preferably dihydro-isoquinoline base organic catalyst.

Though particular of the present invention is described,, to those skilled in the art, it all is conspicuous under the situation that does not deviate from the spirit and scope of the present invention the present invention being carried out various variations and changes.These are changed in the scope of the present invention that all is in the appending claims protection.

Formulator can select any suitable method to prepare composition of the present invention, and the indefiniteness example of these methods is described in United States Patent (USP) 5,691,297; 5,574,005; 5,569,645; 5,565,422; 5,516,448; In 5,489,392 and 5,486,303.

In addition to the implementation, bleach system of the present invention can be mixed with any suitable laundry detergent composition, and its indefiniteness example is described in United States Patent (USP) 5,679,630; 5,565,145; 5,478,489; 5,470,507; 5,466,802; 5,460,752; 5,458,810; In 5,458,809 and 5,288,431.

Though the present invention is described in detail with reference to preferred embodiment and embodiment, but, to those skilled in the art, it all is conspicuous under the situation that does not deviate from scope of the present invention the present invention being carried out various variations and changes, and can not be defined as the described content of specification sheets to the present invention.

Sequence table＜110〉(the The Procter ﹠amp of P﹠G; Gamble Company)

R.R. Dykstra (Dykstra, Robert)

P.J. Kai Laite (Kellett; Patti )＜120〉＜130〉7758M＜150〉60/151,174＜151〉1999-08-27＜160〉18＜170〉PatentIn version 3.0＜210〉1＜211〉21＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉1attcatttgt ggacagtgga c 21＜210〉2＜211〉20＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉2gttgatcgca cattgaacca 20＜210〉3＜211〉20＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉3accccagccg accgattgtc 20＜210〉4＜211〉20＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉4cttccttacc tcaccatcat 20＜210〉5＜211〉20＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉5ttaacatctt ttcaccatga 20＜210〉6＜211〉20＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉6agctttccct tctctccctt 20＜210〉7＜211〉28＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉7gccaccctgg cttccgctgc cagcctcc 28＜210〉8＜211〉20＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉8gacagtagca atccagcatt 20＜210〉9＜211〉20＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉9agcatcagcc gctttgtaca 20＜210〉10＜211〉20＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉10ccatgaagtt caccgtattg 20＜210〉11＜211〉20＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉11gcactgcttc tctcccaggt 20＜210〉12＜211〉20＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉12gtgggcggcc cctcaggcaa 20＜210〉13＜211〉20＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉13acgctcctcc aattttctct 20＜210〉14＜211〉19＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉14ggctggtagt aatgagtct 19＜210〉15＜211〉20＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉15ggcgcagagt ttggccaggc 20＜210〉16＜211〉21＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉16caacatccc ggtgttctgg g 21＜210〉17＜211〉347＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉17aaagattcat ttgtggacag tggacgttga tcgcacattg aaccaacccc agccgaccga 60ttgtccttcc ttacctcacc atcatttaac atcttttcac catgaagctt tcccttctct 120cccttgccac cctggcttcc gctgccagcc tccagcgccg cacacttctg cggtcagtgg 180gataccgcca ccgccggtga cttcaccctg tacaacgacc tttggggcga gacggccggc 240accggctccc agtgcactgg agtcgactcc tacagcggcg acaccatcgc ttgtcacacc 300agcaggtcct ggtcggagta gcagcagcgt caagagctat gccaacg 347＜210〉18＜211〉294＜212〉DNA＜213〉 ( Aspergillus aculeatus )＜400〉18cagcatctcc attgagtaat cacgttggtg ttcggtggcc cgccgtgttg cgtggcggag 60gctgccggga gacgggtggg ggtggtggtg ggagagaatg tagggcgccg tgtttcagtc 120cctaggcagg ataccggaaa accgtgtggt aggaggttta taggtttcca ggagacgctg 180tataggggat aaatgagatt gaatggtggc cacactcaaa ccaaccaggt cctgtacata 240caatgcatat accaattata cctaccaaaa aaaaaaaaaa aaaaaaaaaa aaaa 294

Claims

1. bleach system that is used to wash the fabric that needs clean, it comprises the extremely zwitter-ion organic catalysis immunomodulator compounds of about 5ppm of about 0.001ppm, and this catalyst compound is selected from:

A) aryl imine zwitter-ion, it has net charge and makes an appointment with+3 to making an appointment with-3, and the aryl imine zwitter-ion is represented with following formula [II]:

R wherein ⁵-R ⁷Be independently selected from replacement or unsubstituted group, these groups are selected from H, alkyl, cycloalkyl, aryl, alkaryl, aralkyl, heterocycle, silyl, nitro, halogen, cyano group, sulfo group, alkoxyl group, ketone group, carboxyl and carbalkoxy; The group that in this formula, also exists following formula to represent:

Z wherein _p ^-With T _oForm covalent linkage, Z _p ^-Be selected from-CO ₂ ^-,-SO ₃ ^-,-OSO ₃ ^-,-SO ₂ ^-With-OSO ₂ ^-, p is 1,2 or 3; T _oBe selected from and replace or unsubstituted, saturated or undersaturated alkyl cycloalkyl, aryl, alkaryl, aralkyl and heterocycle;

B) have net charge with following formula [IV] expression and make an appointment with+3 to making an appointment with-3 De Evil ethylene imine zwitter-ions:

R wherein ^{5 ＇}-R ^{7 ＇}Be independently selected from replacement or unsubstituted group, these groups are selected from H, alkyl, cycloalkyl, aryl, alkaryl, aralkyl, heterocycle, silyl, nitro, halogen, cyano group, sulfo group, alkoxyl group, ketone group, carboxyl and carbalkoxy; The group that also exists following formula to represent in the formula: Z ' wherein _p ^-With T ' _oForm covalent linkage, Z ' _p ^-Be selected from-CO ₂ ^-,-SO ₃ ^-,-OSO ₃ ^-,-SO ₂ ^-With-OSO ₂ ^-, p is 1,2 or 3; T ' _oBe selected from and replace or unsubstituted, saturated or unsaturated alkyl cycloalkyl, aryl, alkaryl, aralkyl and heterocycle; With

C) its mixture.

2. according to the bleach system of claim 1, wherein said bleach system also comprises about 2.0ppm one or more peroxygen sources to about 1200ppm.

3. according to the bleach system of claim 1, wherein said bleach system also comprises about 0.5ppm one or more peracid to about 300ppm.

4. according to the bleach system of claim 1, wherein said bleach system also comprises about 1.0ppm one or more peralcohol to about 600ppm.

5. according to the bleach system of claim 2, wherein said peroxygen source is selected from:

(a) prefabricated peracid compound, it is selected from percarboxylic acids and salt, and percarbonic acid and salt are crossed imido acid and salt, permonosulphuric acid and salt and its mixture;

(b) hydrogen peroxide cource, it is selected from the perborate compound, percarbonate compound, superphosphate compound and its mixture; And bleach-activating agent.

6. according to the bleach system of claim 1, the concentration that exists of wherein said zwitter-ion organic catalysis immunomodulator compounds is that about 0.01ppm is to about 3ppm.

7. according to the bleach system of claim 6, the concentration that exists of wherein said zwitter-ion organic catalysis immunomodulator compounds is that about 0.1ppm is to about 2ppm.

8. according to the bleach system of claim 7, the concentration that exists of wherein said zwitter-ion organic catalysis immunomodulator compounds is that about 0.2ppm is to about 1ppm.

9. according to the bleach system of claim 1, wherein said zwitter-ion organic catalysis immunomodulator compounds is selected from:

A) have static charge+3 to about-3 aryl imine zwitter-ion approximately, represent with formula [XII]: Wherein, m is 1-3 when G exists, and m is 1-4 when G does not exist; N is the integer of 0-4; Each R ²⁶All be independently selected from replacement or unsubstituted group, these groups are selected from H, alkyl, cycloalkyl, aryl, fused-aryl, heterocycle, annelated heterocycles, nitro, halogen, cyano group, sulfo group, alkoxyl group, ketone group, carboxyl and carbalkoxy, and any two adjacent R ²⁶Substituting group can be in conjunction with forming fused-aryl, fused iso or annelated heterocycles; R ²⁵Can be replacement or unsubstituted group, these groups are selected from H, alkyl, cycloalkyl, alkaryl, aryl, aralkyl, heterocycle, silyl, nitro, halogen, cyano group, sulfo group, alkoxyl group, ketone group, carboxyl and carbalkoxy; The group that also exists following formula to represent in the formula:

Z wherein _p ^-With T _oForm covalent linkage, Z _p ^-Be selected from-CO ₂ ^-,-SO ₃ ^-,-OSO ₃ ^-,-SO ₂ ^-With-OSO ₂ ^-, p is 1,2 or 3; T _oBe selected from following radicals: Wherein q is the integer of 1-8; R ²⁹Be independently selected from replacement or unsubstituted group, these groups are selected from straight or branched H, alkyl, cycloalkyl, alkaryl, aryl, aralkyl, alkylidene group, heterocycle, alkoxyl group, aromatic carbonyl, carboxyalkyl and amide group; G is selected from: (1)-O-; (2)-N (R ³⁰)-; (3)-N (R ³⁰R ³¹)-; R ²⁷, R ²⁸, R ³⁰And R ³¹For replacing or unsubstituted group, these groups are independently selected from H, oxygen, alkyl, cycloalkyl, alkaryl, aryl, aralkyl, alkylidene group, heterocycle, alkoxyl group, aromatic carbonyl, carboxyalkyl and amide group; R ²⁵, R ²⁶, R ²⁷, R ²⁸, R ³⁰And R ³¹In any one can and R ²⁵, R ²⁶, R ²⁷, R ²⁸, R ³⁰And R ³¹In any other combine a part that forms common ring; The R of any geminal ²⁷-R ²⁸Can be in conjunction with forming carbonyl; Any adjacent R ²⁷-R ³¹Can be in conjunction with forming unsaturated part; And any one substituent R wherein ²⁷-R ³¹Can be in conjunction with form to replace or unsubstitutedly condense unsaturated part;

B) have net charge about+3 to about-3 De Evil ethylene imine zwitter-ions, represent with following formula [XIV]:

Wherein, m is 1-3 when G exists, and m is 1-4 when G does not exist; N is the integer of 0-4; Each R ^{26 ＇}All be independently selected from replacement or unsubstituted group, these groups are selected from H, alkyl, cycloalkyl, aryl, fused-aryl, heterocycle, annelated heterocycles, nitro, halogen, cyano group, sulfo group, alkoxyl group, ketone group, carboxyl and carbalkoxy, and any two adjacent R ^{26 ＇}Substituting group can be in conjunction with forming fused-aryl, fused iso or annelated heterocycles; R ^{25 ＇}Can be replacement or unsubstituted group, these groups are selected from H, alkyl, cycloalkyl, alkaryl, aryl, aralkyl, heterocycle, silyl, nitro, halogen, cyano group, sulfo group, alkoxyl group, ketone group, carboxyl and carbalkoxy; The group of representing with following formula: Z ' wherein _p ^-With T ' _oForm covalent linkage, Z ' _p ^-Be selected from-CO ₂ ^-,-SO ₃ ^-,-OSO ₃ ^-,-SO ₂ ^-With-OSO ₂ ^-, p is 1 or 2; T ' _oBe selected from following radicals: Wherein q is the integer of 1-8; R ^{29 ＇}Be independently selected from replacement or unsubstituted group, these groups are selected from the H of straight or branched, alkyl, cycloalkyl, alkaryl, aryl, aralkyl, alkylidene group, heterocycle, alkoxyl group, aromatic carbonyl, carboxyalkyl and amide group; G is selected from: (1)-O-; (2)-N (R ^{30 ＇})-; (3)-N (R ^{30 ＇}R ^{31 ＇})-; R ^{27 ＇}, R ^{28 ＇}, R ^{30 '}And R ^{31 ＇}For replacing or unsubstituted group, these groups are independently selected from H, oxygen, alkyl, cycloalkyl, alkaryl, aryl, aralkyl, alkylidene group, heterocycle, alkoxyl group, aromatic carbonyl, carboxyalkyl and amide group; R ^{25 ＇}, R ^{26 ＇}, R ^{27 ＇}, R ^{28 ＇}, R30 ＇ and R ^{31 ＇}In any one can and R ^{25 ＇}, R ^{26 ＇}, R ^{27 ＇}, R ^{28 ＇}, R ^{30 '}And R ^{31 ＇}In any other combine a part that forms common ring; The R of any geminal ^{27 ＇}-R ^{28 '}Can be in conjunction with forming carbonyl; Any adjacent R ^{27 ＇}-R ^{31 ＇}Can be in conjunction with forming unsaturated part; And substituent R wherein ^{27 ＇}-R ^{31 '}In any one group can be in conjunction with form to replace or unsubstitutedly condense unsaturated part; With

C) its mixture.

10. according to the bleach system of claim 9, wherein said zwitter-ion organic catalysis immunomodulator compounds is the aryl imine zwitter-ion suc as formula [XII] expression, wherein R ²⁵Be H or methyl, R ²⁶Be independently selected from H, alkyl and alkoxyl group reach the group of representing with following formula: Z _p ^-For-CO ₂ ^-,-SO ₃ ^-Or-OSO ₃ ^-, p is 1 or 2.

11. according to the bleach system of claim 10, wherein said zwitter-ion organic catalysis immunomodulator compounds is the aryl imine zwitter-ion suc as formula [XII] expression, wherein, and for the group of representing with following formula:

Z _p ^-For-CO ₂ ^-,-SO ₃ ^-Or-OSO ₃ ^-, p is 1, T _oBe selected from following radicals:

Wherein q is the integer of 2-4; R ²⁹Be selected from H independently of one another, the C of straight or branched ₁-C ₁₈Replacement or unsubstituted alkyl and aryl.

12. according to the bleach system of claim 1, wherein said bleach system also comprises surfactant.

13. according to the bleach system of claim 1, wherein said bleach system also comprises enzyme.

14. according to the bleach system of claim 1, wherein said bleach system also comprises sequestrant.

15. according to the bleach system of claim 2, the mol ratio of described peroxygen source that exists in the wherein said bleach system and described zwitter-ion organic catalysis immunomodulator compounds was greater than 1: 1.

16. the method for the bleach system of preparation claim 1, it comprises:

A) provide washing soln; With

B) bleaching composition that comprises a certain amount of zwitter-ion organic catalysis immunomodulator compounds is added in the described washing soln, this zwitter-ion organic catalysis immunomodulator compounds is selected from:

I) aryl imine zwitter-ion, it has net charge and makes an appointment with+3 to making an appointment with-3, represents with following formula [II]: R wherein ⁵-R ⁷Be independently selected from replacement or unsubstituted group, these groups are selected from H, alkyl, cycloalkyl, aryl, alkaryl, aralkyl, heterocycle, silyl, nitro, halogen, cyano group, sulfo group, alkoxyl group, ketone group, carboxyl and carbalkoxy; The group that in this formula, also exists following formula to represent: Z wherein _p ^-With T _oForm covalent linkage, Z _p ^-Be selected from-CO ₂ ^-,-SO ₃ ^-,-OSO ₃ ^-,-SO ₂ ^-With-OSO ₂ ^-, p is 1,2 or 3; T _oBe selected from and replace or unsubstituted, saturated or undersaturated alkyl cycloalkyl, aryl, alkaryl, aralkyl and heterocycle;

Ii) use the net charge that has of following formula [IV] expression to make an appointment with+3 to making an appointment with-3 De Evil ethylene imine zwitter-ions:

R wherein ⁵＇-R ^{7 ＇}Be independently selected from replacement or unsubstituted group, these groups are selected from H, alkyl, cycloalkyl, aryl, alkaryl, aralkyl, heterocycle, silyl, nitro, halogen, cyano group, sulfo group, alkoxyl group, ketone group, carboxyl and carbalkoxy; The group that also exists following formula to represent in the formula:

Z ' wherein _p ^-With T ' _oForm covalent linkage, Z ' _p ^-Be selected from-CO ₂ ^-,-SO ₃ ^-,-OSO ₃ ^-,-SO ₂ ^-With-OSO ₂ ^-, p is 1,2 or 3; T ' _oBe selected from and replace or unsubstituted, saturated or unsaturated alkyl cycloalkyl, aryl, alkaryl, aralkyl and heterocycle; With

C) its mixture;

Making the zwitter-ion organic catalyst compound concentrations in the described washing soln that obtains is that about 0.001ppm is to about 5ppm.

17. a method of washing the fabric that needs cleaning, this method comprises makes described fabric contact with the laundry solution of the bleach system that contains claim 1.

18. according to the method for claim 17, wherein said fabric is a colored fabric.

19. according to the method for claim 17, wherein said method is carried out in automatic washing machine.

20. a bleach system that is used to wash the fabric that needs clean, it comprises:

A) peroxygen source; With

B) zwitter-ion organic catalysis immunomodulator compounds, it is selected from:

I) aryl imine zwitter-ion, it has net charge and makes an appointment with+3 to making an appointment with-3, represents with following formula [II]:

C) its mixture;

The mol ratio of described peroxygen source that exists in the wherein said bleach system and described zwitter-ion organic catalysis immunomodulator compounds was greater than 1: 1.

21. according to the bleach system of claim 20, the mol ratio of described peroxygen source that exists in the wherein said bleach system and described zwitter-ion organic catalysis immunomodulator compounds is about 30,000: 1 to about 10: 1.

22. according to the bleach system of claim 21, the mol ratio of described peroxygen source that exists in the wherein said bleach system and described zwitter-ion organic catalysis immunomodulator compounds is about 10,000: 1 to about 50: 1.

23. according to the bleach system of claim 22, the mol ratio of described peroxygen source that exists in the wherein said bleach system and described zwitter-ion organic catalysis immunomodulator compounds is about 5,000: 1 to about 100: 1.

24. according to the bleach system of claim 23, the mol ratio of described peroxygen source that exists in the wherein said bleach system and described zwitter-ion organic catalysis immunomodulator compounds is about 3,500: 1 to about 150: 1.

25. a bleach system that is used to wash the fabric that needs clean, it comprises:

A) peracid; With

I) aryl imine zwitter-ion, it has net charge and makes an appointment with+3 to making an appointment with-3, represents with following formula [II]: R wherein ⁵-R ⁷Be independently selected from replacement or unsubstituted group, these groups are selected from H, alkyl, cycloalkyl, aryl, alkaryl, aralkyl, heterocycle, silyl, nitro, halogen, cyano group, sulfo group, alkoxyl group, ketone group, carboxyl and carbalkoxy; The group that in this formula, also exists following formula to represent:

Ii) use the net charge that has of following formula [IV] expression to make an appointment with+3 to making an appointment with-3 De Evil ethylene imine zwitter-ions: R wherein ^{5 ＇}-R ^{7 ＇}Be independently selected from replacement or unsubstituted group, these groups are selected from H, alkyl, cycloalkyl, aryl, alkaryl, aralkyl, heterocycle, silyl, nitro, halogen, cyano group, sulfo group, alkoxyl group, ketone group, carboxyl and carbalkoxy; The group that also exists following formula to represent in the formula: Z ' wherein _p ^-With T ' _oForm covalent linkage, Z ' _p ^-Be selected from-CO ₂ ^-,-SO ₃ ^-,-OSO ₃ ^-,-SO ₂ ^-With-OSO ₂ ^-, p is 1,2 or 3; T ' _oBe selected from and replace or unsubstituted, saturated or unsaturated alkyl cycloalkyl, aryl, alkaryl, aralkyl and heterocycle; With

C) its mixture; The mol ratio of described peracid that exists in the wherein said bleach system and described zwitter-ion organic catalysis immunomodulator compounds was greater than 1: 1.