CN1261400A - Laundry and cleaning compositions containing xyloglucanase enzymes - Google Patents

Abstract

Laundry or cleaning products comprising one or more enzymes exhibiting endoglucanase activity specific for xyloglucan, and methods for laundering fabrics and cleaning dishes and tableware with aqueous solutions containing an effective amount of one or more enzymes exhibiting endoglucanase activity specific for xyloglucan.

Description

The laundry and the cleaning combination that contain xyloglucanase enzymes

Invention field

The present invention relates to comprise laundry and cleaning combination with the active enzyme of xyloglucanase enzymes.

Background of invention

As described in the WO94/14953 that had before announced in the 7 days July in 1994 of Novo Nordisk, endo-dextranase (EC numbers 3.2.1.4) has constituted one group of lytic enzyme, their energy catalyse celluloses, derivatived cellulose (for example carboxymethyl cellulose and Natvosol), lichenstarch, blended β-1, β-1 in the 3-dextran (such as grain callose or xyloglucan), in the vegetable material of 4-key and other cellulose compositions 1, the interior hydrolysis of 4-β-D-glycosidic linkage.Its appointed title is interior-1,4-callose 4-glucan hydrolase, but also use its abbreviation term endo-dextranase.

Found that endo-dextranase can be produced by various types of organisms such as plant and microorganism, and allegedly confirmed that endo-dextranase has each specific specificity.For example, in each kind of plant, found the specific endo-dextranase of xyloglucan, referring to the journal of biological chemistry (Biochem.J.) (1992) of for example Fry etc., the 282nd volume, 821-828 page or leaf, Nishitani and Tominaga, journal of biological chemistry (The Journal of Biol.Chemistry) (1992), the 267th volume, No. 29, the 21058-21064 page or leaf, Hayashi etc., plant physiology (Plant Physiol) (1984), the 75th volume, the 605-610 page or leaf, McDougall and Fry, plant physiology magazine (J.Plant Physiol) (1991), the 137th volume, content among 332-336 page or leaf and the WO93/17101.Found that all these enzymes have transferase active (for example by Fry etc., 1992 and Nishitani etc., definition in 1992), therefore allegedly are not classified as real endo-dextranase.In addition, the specific endo-dextranase of xyloglucan is described among the WO94/14953 in the microbe.Wherein, stated " endo-dextranase with high xyloglucan degrading activity can have the special purpose that degraded contains the cell wall material of high-content xyloglucan; for example be applied to grape wine and fruit industry, is used for extracting pectin and is used for removing hemicellulose from fabric fibre " prevailingly.Particularly, be the purposes that these enzymes are used to prepare fabric fibre about last this character:

" vegetable fibre such as cotton, flax, hemp and jute must therefrom be removed the hemicellulose such as xyloglucan before they are applied to textiles.For reaching this purpose, II type endo-dextranase [that is, to the specific enzyme of xyloglucan] has advantage, and particularly, it can remove xyloglucan and damaged fiber element not.This endo-dextranase can use separately or use with the activated enzyme of other pectin substances to fiber (for example polygalacturonase).”

" in addition, endo-dextranase of the present invention and its analogue can be used for handling the material of cellulosic fibre or fiber-enriched cellulose fiber.This endo-dextranase for example can be used for paper industry to be improved pulp drainage and handles for example cotton fabric of fabric, to obtain more slick fabric." [the 12nd page].

The purpose of this invention is to provide and contain laundry and cleaning combination with the enzyme of specifying the xyloglucan enzyme activity level.By the detailed description of this paper, these and other purposes will be apparent.

Background document

Referring to Fry etc., journal of biological chemistry (Biochem.J) (1992), the 282nd volume, the 821-828 page or leaf, Nishitani and Tominaga, journal of biological chemistry (The Journalof Biol.Chemistry) (1992), the 267th volume, No. 29,21058-21064 page or leaf, Hayashi etc., plant physiology (Plant Physiol) (1984), the 75th volume, 605-610 page or leaf, McDougall and Fry, plant physiology magazine (J.Plant Physiol) (1991), the 137th volume, 332-336 page or leaf, WO93/17101 and WO94/14953.Also referring to US5356803, Glycosylase (interior-D, interior-H, interior-F and the PNGaseF) application in laundry and cleaning combination in the II type.

Summary of the invention

The present invention relates to laundry or cleaning products, it comprises the weight by said composition, preferably about 0.001%-1%, and more preferably from about one or more of 0.01%-0.5% show the enzyme of special endoglucanase activity to xyloglucan.The invention still further relates to the method for laundering of textile fabrics (preferred clothes), this method comprise fabric that needs are cleaned with contain significant quantity one or more aqueous solution that xyloglucan shows the enzyme of special endoglucanase activity is contacted, preferably contact with the aqueous solution of thing combined according to the invention.The invention still further relates to the method for cleaning disc and tableware, this method comprise dish that needs are cleaned or tableware with contain significant quantity one or more aqueous solution that xyloglucan shows the enzyme of special endoglucanase activity is contacted, preferably contact, more preferably in the automatic dishwashing machine, contact with the aqueous solution of thing combined according to the invention.

Term used herein " endoglucanase activity " meaning is that enzymic hydrolysis is present in for example 1 in Mierocrystalline cellulose, derivatived cellulose, lichenstarch, callose or the xyloglucan of any cellulose materials, the ability of 4-β-D-glycosidic linkage.Endoglucanase activity can be measured according to method well known in the art, and the example is described in WO94/14953 and hereinafter.The endoglucanase activity of one unit (CMCU for example, AVIU, XGU or BGU) be defined as from dextran matrix producing 1 μ mol reducing sugar/minute, dextran matrix is CMC (CMCU) for example, the Microcrystalline Cellulose of acid-swellable (AVIU), xyloglucan (XGU) or cereal beta-glucan (BGU).The method mensuration that reducing sugar is pressed WO94/14953 and hereinafter described.Endo-dextranase is to the specific activity unit of the being defined as/milligram albumen of matrix.

More specifically, the present invention relates to comprise the laundry and the cleaning combination of the enzyme of the XGU endoglucanase activity (hereinafter " special ") that shows to its maximum activity, wherein enzyme to xyloglucan:

i ) DNA ( a ) ATTCATTTGT GGACAGTGGA C ( SEQ ID No：1 ) ( b ) GTTGATCGCA CATTGAACCA ( SEQ ID NO：2 ) ( c ) ACCCCAGCCG ACCGATTGTC ( SEQ ID NO：3 ) ( d ) CTTCCTTACC TCACCATCAT ( SEQ ID NO：4 ) ( e ) TTAACATCTT TTCACCATGA ( SEQ ID NO：5 ) ( f ) AGCTTTCCCT TCTCTCCCTT ( SEQ ID NO：6 ) ( g ) GCCACCCTGG CTTCCGCTGC CAGCCTCC ( SEQ ID NO：7 ) ( h ) GACAGTAGCA ATCCAGCATT ( SEQ ID NO：8 ) ( i ) AGCATCAGCC GCTTTGTACA ( SEQ ID NO：9 ) j ) CCATGAAGTT CACCGTATTG ( SEQ ID NO：10 ) ( k ) GCACTGCTTC TCTCCCAGGT ( SEQ ID NO：11 ) ( l ) GTGGGCGGCC CCTCAGGCAA ( SEQ ID NO：12 ) ( m ) ACGCTCCTCC AATTTTCTCT ( SEQ ID NO：13 ) ( n ) GGCTGGTAG TAATGAGTCT ( SEQ ID NO：14 ) ( o ) GGCGCAGAGT TTGGCCAGGC ( SEQ ID NO：15 ) ( p ) CAACATCCCC GGTGTTCTGG G ( SEQ ID NO：16 ) ( q ) AAAGATTCAT TTGTGGACAG TGGACGTTGA TCGCACATTGAACCAACCCC AGCCGACCGATTGTCCTTCC TTACCTCACC ATCATTTAAC ATCTTTTCAC CATGAAGCTTTCCCTTCTCTCCCTTGCCAC CCTGGCTTCC GCTGCCAGCC TCCAGCGCCG CACACTTCTGCGGTCAGTGGGATACCGCCA CCGCCGGTGA CTTCACCCTG TACAACGACC TTTGGGGCGAGACGGCCGGCACCGGCTCCC AGTGCACTGG AGTCGACTCC TACAGCGGCG ACACCATCGCTTGTCACACCAGCAGGTCCT GGTCGGAGTA GCAGCAGCGT CAAGAGCTAT GCCAACG ( SEQ ID NO：17 ) ( r ) CAGCATCTCC ATTGAGTAAT CACGTTGGTG TTCGGTGGCCCGCCGTGTTG CGTGGCGGAGGCTGCCGGGA GACGGGTGGG GATGGTGGTG GGAGAGAATGTAGGGCGCCG TGTTTCAGTCCCTAGGCAGG ATACCGGAAA ACCGTGTGGT AGGAGGTTTA TAGGTTTCCAGGAGACGCTGTATAGGGGAT AAATGAGATT GAATGGTGGC CACACTCAAA CCAACCAGGTCCTGTACATACAATGCATAT ACCAATTATA CCTACCAAAA AAAAAAAAAAAAAAAAAAAA AAAA ( SEQ ID NO：18 )

Ii) to by i) in definition dna sequence encoding and be obtained from microorganism Aspergillus aculeatus, the antibody that the high purifying endo-dextranase of CBS101.43 produces is immunoreactivity and xyloglucan is had specificity.

More specifically, term used herein " special to the xyloglucan " meaning is that endo-dextranase shows its maximum endoglucanase activity to xyloglucan matrix, with for example carboxymethyl cellulose, Mierocrystalline cellulose or other dextran show and preferably are lower than 75% activity to other cellulose matrix, more preferably less than 50% activity, most preferably be lower than about 25% activity.

Preferably, endo-dextranase also is defined as respectively the relative reactivity determined by the reducing sugar that discharges under top condition that enzyme obtains and tested other matrix cultivating with xyloglucan to the specificity of xyloglucan.For example, specificity can be defined as the activity (XGU/BGU) of the relative beta-glucan of xyloglucan, the activity of the relative carboxymethyl cellulose of xyloglucan (XGU/CMCU), or the Microcrystalline Cellulose activity (XGU/AVIU) of the relative acid-swellable of xyloglucan, it is preferably greater than about 50, and for example 75,90 or 100.

Term used herein " is obtained from " and not only is meant the endo-dextranase that is produced by bacterial strain CBS101.43, but also refers to by isolated dna sequence encoding from bacterial strain CBS101.43 and the endo-dextranase that produces in said dna sequence dna host transformed organism.

Term used herein " homologue " expression is by the polypeptide of dna encoding, described DNA hybridization to under some prescribed condition, (for example be pre-soaked among 5 * SSC, with 5 * SSC under-40 ℃, prehybridization is 1 hour in the bovine chest gland DNA solution of 5 * Denhardt solution and 50 μ g sex change sonications, then in the same solution of replenishing with the probe of 50 μ Ci 32-P-dCTP marks,-40 ℃ of following hybridization 18 hours and under 40 ℃, 2 * SSC, among the 0.2%SDS, wash three times, carried out 30 minutes) probe identical of encoding to the DNA of the specific endo-dextranase of xyloglucan.More specifically, this term meaning be meant with above shown in coding any sequence of the specific endo-dextranase of xyloglucan is had at least 70% homologous dna sequence dna, comprise with above shown in any sequence at least 75%, at least 80%, at least 85%, at least 90% or even at least 95% homology.This term meaning is the modification that comprises any dna sequence dna shown in above, the Nucleotide that does not for example produce by another aminoacid sequence of the polypeptide of this sequence encoding replaces, and the organic codon of host that its dna structure that is equivalent to comprise any dna sequence dna injects is used, or produce different aminoacid sequences and may produce different aminoacid sequences and the Nucleotide replacement that may produce different protein structures thus thus, it may produce with natural enzyme has endo-dextranase mutant of different nature.Other examples of possible modification are in one or more Nucleotide insertion sequences, locate to add one or more Nucleotide at one of sequence end, or lack one or more Nucleotide in one of sequence end or sequence.

Unless otherwise indicated, all umbers used herein, percentage ratio and ratio are that percentage ratio is represented by weight.The relevant portion of all documents, patent or other documents that this paper quotes or all quote for referencial use at this paper.

Detailed Description Of The Invention

The cleaning character that the specific endo-dextranase of xyloglucan has been confirmed to be they at this paper is particularly useful in laundry and cleaning combination.

Useful in the present invention preferably has XGU/BGU to the specific endo-dextranase of xyloglucan, XGU/CMU and/or XGU/AVIU than (as above definition) greater than 50, a kind of endo-dextranase of 75,90 or 100 for example.

In addition, to the specific endo-dextranase of xyloglucan when the activity to xyloglucan is 100%, preferably show maximum 25%, for example maximum 10% or about 5% activity to the beta-glucan non-activity and/or to carboxymethyl cellulose and/or avicel cellulose basically.In addition, the present invention is to the preferred essentially no transferase active of the specific endo-dextranase of xyloglucan, observes the specific most of endo-dextranases of the xyloglucan of plant-sourced are had this activity.

Can be to the specific endo-dextranase of xyloglucan by obtaining as the mould species microorganism Aspergillus aculeatus of in WO94/14953, describing.The specific microorganism endo-dextranase of xyloglucan also is described among the WO94/14953.The specific endo-dextranase of the xyloglucan that is obtained by plant is also described to some extent, but these enzymes have transferase active, when therefore no matter when needing thoroughly to degrade xyloglucan, it all is considered to inferior to the specific microorganism endo-dextranase of xyloglucan.Another advantage of microbial enzyme is, and is general, the volume production life that they can be higher than the enzyme in other sources in microorganism host.

Enzyme of the present invention can separate by general method, comprise :-in suitable carrier the clone from the dna library of aspergillus bacterium class,-transform suitable yeast host cell with said carrier,-cultivate host cell under suitable condition, with express by interesting any enzyme of a clones coding in the dna library and-come screening positive clone by any endoglucanase activity of measuring the enzyme that produces by this clone.

The more detailed description of this screening method is disclosed in WO94/14953.

Encode this enzyme dna sequence dna for example can by the screening microorganism Aspergillus aculeatus, for example the cDNA storehouse of bacterial strain CBS101.43 (public can obtain from Centraalbureau voorSchimmelcultures) and select to express and to have hydrolysis and contain β-1 between two glucose molecules the polymkeric substance (for example Mierocrystalline cellulose, cereal beta-glucan or xyloglucan) of glucose, 3 and/or the clone of the enzyme of β-1,4 bond energy power separate.Then can be by for example WO94/14953, the standard step of describing among the embodiment 1 is separated suitable dna sequence dna from the clone.The dna sequence dna of expectation coding homology enzyme can obtain by the cDNA storehouse of similar another microbe of screening, described another microbe is mould particularly, Aspergillus bacterial strain for example, particularly microorganism Aspergillus aculeatus or black aspergillus, Trichoderma bacterial strain, particularly T.harianun, T.reesie, fusarium bacterial strain, particularly fusarium oxysporum, or Humicola bacterial strain.

In addition, the DNA of code book invention endo-dextranase can be according to known step, and by using the oligonucleotide probe based on dna sequence dna preparation disclosed herein, for example the 20mer probe separates from the DNA that above-mentioned any organism obtains easily.For example, the oligonucleotide probe of Shi Heing can for example a)-p) prepare based on any part nucleotide sequence listed in WO94/14953.

In the implantable then recombinant expression vector of this dna sequence dna.This carrier can be any carrier that stands the recombinant DNA step easily, and the host cell of its injection is depended in the selection of carrier usually.Therefore, carrier can be the spontaneous carrier that duplicates, and promptly carrier exists as extrachromosomal entity, and duplicating with THE REPLICATION OF CHROMOSOME of it is irrelevant, for example plasmid.In addition, carrier can be a kind of carrier that is attached to when introducing host cell in the host cell chromosome group and duplicates with its bonded karyomit(e).

In carrier, coding should be operably connected with the promotor and the terminator sequence that are fit to the dna sequence dna of the specific endo-dextranase of xyloglucan.Promotor can be any dna sequence dna that shows transcriptional activity in the host cell of selecting, and it can obtain from coding and host cell homology or allogenic proteinic gene.Being used for encode the respectively method of dna sequence dna of endo-dextranase, promotor and terminator and the method for carrier that their implant are fit to of ligation is to well known to a person skilled in the art (reference example such as Sambrook etc., the molecular cloning laboratory manual, (Molecular Cloning.A Laboratory Manual), Cold SpringHarbor, NY1989).

Be applicable to dna sequence dna the transformed host cells for example yeast or the filamentary mould cell of eukaryotic cell, particularly fungal cell preferably of the enzyme of the present composition with coding.Particularly, this cell can belong to the aspergillus bacterial classification, most preferably is aspergillus oryzae or black aspergillus.Fungal cell can be used method regenerative cell's wall well known in the art then with comprising that protoplastis forms and the method for protoplast transformation transforms.Aspergillus is described in EP238023 (NovoNordisk A/S) as the application of host microorganism.Host cell can also be a yeast cell, for example sugar yeast bacterial strain, particularly Saccharomyces cerevisiae.

The medium that is used to cultivate transformed host cells can be the medium of the host cell discussed of being suitable for growing of any routine.That is expressed can be secreted in the substratum and available known method therefrom reclaims easily to the specific endo-dextranase of xyloglucan, comprise by centrifugal or filtration isolated cell from medium, by the salt protein ingredient in the ammonium sulfate precipitation medium for example, then by chromatography method for example ion exchange chromatography, affinity chromatography etc.

The endo-dextranase of purifying can be used for the immunity of animal like this, is used to produce antibody.More specifically, according to N.Axelsen etc. at quantitative immunoelectrophoresis handbook (A Manual ofQuantitative Immunoeletrophoresis), the Blackwell technical press, 1973, the 23rd chapter or A.Johnstone and R.Thorpe, immunochemistry is put into practice (Immunochemistry in Practice), the Blackwell technical press, the method of describing in 1982 (more specifically being the 27-31 pages or leaves) can improve anti-antiserum(antisera) to the specific endo-dextranase of xyloglucan by making rabbit (or other rodentss) immunity.The immunoglobulin (Ig) of purifying can be obtained by antiserum(antisera), for example by salt precipitation ((NH ₄) ₂SO ₄), pass through dialysis and ion exchange chromatography then for example on DEAE-Sephadex.Proteic immunochemistry sign can (O.Ouchterlony learns to do volume (Handbook of Experimental Immunology) (D.M.Weir edits) at experiment immunization by Wu Hetelang Nissl double diffusion analysis, the Blackwell technical press, 1967, the article of 655-706 page or leaf), crossed immunoelectrophoresis (N.Axelsen etc., super (supra), the 3rd and 4 chapters) or any method in the rocket immunoelectrophoresis (N.Axelsen etc., the 2nd chapter) carry out.

Be used for the present composition the specific endo-dextranase of xyloglucan be can be made into and be substantially free of the other plant cell wall degrading enzyme.This make this enzyme to use separately or with other enzymes for example Galactanase and zytase use, obtain being used for the best of breed of the enzyme of special applications.Therefore can design enzyme composition, the specific part that it can only the degrading plant cell.

The zymin that is used for the present composition can prepare according to the prior art known method, and it can be liquid or dry preparation form.For example, zymin can be particle or microparticle form.The enzyme that is included in the preparation can also be stablized according to method well known in the art.

The zymin that is used for the present composition is except containing the specific endo-dextranase of xyloglucan, also contain one or more other detergent enzymes and/or other plant cell wall degrading enzyme, for example have the Mierocrystalline cellulose of separating, separate xylan or separate pectose active those, for example zytase, arabanase, rhamno-galacturonic acid enzyme, pectin acetylase, Galactanase, polygalacturonase, pectin lyase, pectate lyase, interior-dextranase or pectin methyl esterase.Other enzyme can be by belonging to Aspergillus, and the microorganism of preferred black aspergillus, microorganism Aspergillus aculeatus, Aspergillus awamori or aspergillus oryzae produces.Test method

Standard is cultivated: in order to characterize enzyme, cultivate in the Eppendorf test tube that comprises 1ml matrix (by MegaZyme, AZCL-xyloglucan matrix that Australia obtains or pure polysaccharide).The 0.4%AZCL-matrix suspension of 0.5ml is mixed with the 0.5ml 0.1M Citrate trianion/phosphate buffered saline buffer with best pH, and add the suitably enzyme solution of dilution of 10 μ l.In Eppendorf Theromixers, cultivate down 15 minutes (if not explanation in addition) in 30 ℃, then 95 ℃ of following heat-inactivations 20 minutes.The cultivation of enzyme repeats three times.The preparation blank test wherein adds enzyme, but inactivation immediately.After centrifugal,, on microtiter plate, measure the absorption of supernatant liquor and deduct blank at the 620nm place.

Measure the activity of enzyme to different holosaccharides: by xyloglucan and the beta-glucan (AZCL-xyloglucan and AZCL-HE Mierocrystalline cellulose) that MegaZyme obtains, CMC (Blanose that obtains by Aqualon) and Avicell (Microcrystalline Cellulose that obtains by Merck).Before use, Avicell under the room temperature in 85% ortho-phosphoric acid swelling 1 hour, and with acetone and water washing.0.5% solution/suspension of preparation different substrates adds 10 μ l enzyme solution in 1ml matrix in having the 0.1M acetate buffer of best pH (if not explanation in addition), as previously discussed, before heat inactivation, cultivates 15 minutes down at 30 ℃.Measure reducing sugar by reacting with the PHBAH reaction reagent on microtiter plate, wherein PHBAH reagent comprises 0.15g P-hydroxybenzoic acid hydrazides (Sigma H-9882), 0.50g Seignette salt (Merck8087) and 2%NaOH solution to 10.0ml.Deduct blank result.Use glucose as standard.

The matrix that obtained by MegaZyme (being used for enzyme described below: act on the EG II of AZCL-xyloglucan, act on the EG III of pure beta-glucan and act on the EG IV of AZCL-beta-glucan) is measured best pH.0.4% matrix of 0.5ml is mixed with the 0.5ml 0.1M Citrate trianion with different pH/phosphate buffered saline buffer, and add the suitably enzyme solution of dilution of 10 μ l.Cultivate by above-mentioned.Can have the be complementary best pH of required any pH scope of pH with the present composition or purging method though be used for enzyme of the present invention, be used for enzyme of the present invention preferably at the about 6-11 of pH, preferred 7-11 more preferably from about has activity in about 10.5 scopes of 8-.

Under best pH, in the 0.1M acetate buffer, by the specificity of the different enzymes of above test to different AZCL-matrix.

Under best pH, before enzyme is used to cultivate the AZCL-beta-glucan, enzyme is placed in having 0.1M citric acid/trisodium phosphate buffer of different pH measured pH stability in 1 hour.

Under best pH, under different temperature, cultivate enzyme with AZCL-beta-glucan matrix and measured optimum temps in 15 minutes.

Before using relevant matrix cultivation under 30 ℃, at various temperatures, the enzyme that is diluted in the water is placed the stability of measuring temperature in 1 hour.

Under substrate concn scope 0.025-1.5% (hereinafter: be used for the xyloglucan of EG II and be used for the beta-glucan of EG IV) cultivate and measure Km and specific activity, assaying reaction speed (v), figure S/v is the function of S, carries out linear regression analysis, finds slope (=1/V _Maximum) and intercept (Km/V _Maximum), and calculating K m and specific activity (=V _Maximum/ E), wherein E is the amount of the enzyme of adding.

Prepare 1% solution/suspension of above-mentioned holosaccharide, be used for gel permeation chromatography.Add the enzyme of appropriate amount, and before heat inactivation, cultivated 0,1,2,4 and 24 hour.25 μ l samples are infused in three TSK-posts arranging (PW G4000, PW G3000, PW G2500), and the 0.4M acetate buffer of using pH3.0 is with 0.8 ml/min speed wash-out saccharides.With the saccharides of Shimadzu RI detector mensuration wash-out, collect data and pass through the Dionex software processes.Use dextran (obtaining) as molecular weight standard from Sersa.Substrate specificity

With respect to optimum substrate (100%), discharge by the reducing sugar of different enzymes in the homopolysaccharide never and to measure relative reactivity, its give in WO94/14953 and manifolding in following table.Enzyme EG II EG III EG IV Microcrystalline Cellulose 1% 0% 3%CMC 1% 2% 11% beta-glucans 0% 100% 100% xyloglucans 100% 31% 0%

By these results, the specificity of different endo-dextranases is represented as: enzyme EG II EG III EG IVXGU/BGU ∞ 0.31 0XGU/CMC 104 18 0XGU/AVIU 114 ∞ 0BGU/XGU 0 3.2 ∞ BGU/CMC 0 58 9.4BGU/AVIU 0 ∞ 25

The substrate specificity result that AZCL-matrix is measured returns in WO94/14953, and manifolding is in following table: enzyme EG II EG III EG IVHE-cellulose 1% 100% 100% beta glucans 0% 36% 56% xyloglucans 100% 33% 1%Curdlan 0% 2% 4%

By this specificity result as can be seen, compare with EG IV with EG III, the EG II that is used for the present composition of this paper definition has specificity to xyloglucan, and other two kinds of endo-dextranases then do not have specificity.EG III has activity to all types of matrix, but it does not have high reactivity to xyloglucan, the xyloglucan and beta-glucan had extraordinary specificity and EG IV can not degrade.(resulting as a result some is different to reducing sugar and AZCL-matrix.A kind of explanation to this is that some AZCL-matrix are more responsive than other.In this case, as if the AZCL-HE-Mierocrystalline cellulose is more responsive than AZCL-beta-glucan).

The Km of EG II and EG III and specific activity are given in WO94/14953.Wherein use the 1/V that obtains by linear regression analysis _MaximumAnd Km/V _MaximumThe standard deviation interval of calculating enzyme, be found in the following table: enzyme matrix Km specific activity r ^Λ2

% matrix unit/mgEG II xyloglucan 0.242-0.306 106-119 0.98EG III beta-glucan 0.136-0.207 165-186 0.98

Optimum temps and temperature/pH stability-EG II and EG III have similar optimum temps (optimum activity is between 30 ℃-60 ℃) and temperature stability (stablizing 1 hour) under height to 60 ℃, but EG III is more stable than EG II under the alkaline pH condition.

It has confirmed substrate specificity gel permeation chromatography, has shown that EG II is degraded into xyloglucan fully and has about 7-9 repeats the residue of subunit for known xyloglucan oligopolymer (Fry, 1989).EG III with xyloglucan degraded to lower degree, the EG IV xyloglucan of not degrading fully.EG III is degraded into DP3-4 and higher oligomers largely with beta-glucan.This with beta-glucan by the 3-4 β-1 that becomes a row, the glucose unit of 4-bonding is formed, and wherein is inserted with single β-1, the 3-key is consistent.Cleaning combination component and detergent composition

Detergent composition of the present invention contains laundry described below or cleaning combination component.The exact nature of these components and its incorporation will depend on the physical form of composition and the character of its cleaning operation that is used for.

According to detergent composition of the present invention can be liquid, cream, gel, bar, sheet, powder or particle form.Particulate composition can also be " closely knit " form, and liquid composition can also be " concentrating " form.

The present composition for example can be formulated as hand washing and machine laundry detergent composition, the fabric softener composition that it adds when comprising laundry additive composition and being applicable to the composition of the dirty fabric of immersion/pre-treatment, rinsing.Pre-treatment or aftertreatment to fabric comprise gel, spraying and liquid fabric condition composition.

When preparation is suitable for composition in the washing machine washing method, the present composition preferably contains tensio-active agent and these two kinds of components of washing-aid compound and additional one or more detergent components, and this detergent component is preferably selected from organic polymer, SYNTHETIC OPTICAL WHITNER, additional enzymes, suds suppressor, dispersion agent, lime soap dispersing agent, soil-suspending agent and anti redeposition agent and corrosion inhibitor.Laundry composition also can contain softening agent, and it is as additional detergent component.

The present composition also can be used as the detergent additives product.This additive product is the performance that is used for replenishing or promoting conventional detergent composition.

If need, in the density range of 20 ℃ of laundry detergent compositions of the present invention of measuring down at 400-1200g/l, preferred 600-950g/l composition.

" closely knit " form of the present composition by density and, with regard to composition, embodied best by the amount of mineral filler salt.Mineral filler salt is the conventional component of powder detergent composition.In conventional detergent composition, filling salt exists with significant amount, is generally the 17-35% of total composition weight.

In closely knit composition, the content of filling salt is no more than 15% of total composition, preferably is no more than 10%, is most preferably not exceeding 5% of composition weight.

Mineral filler salt, for example those of indication in the present composition are selected from basic metal and alkaline earth metal sulphate and muriate.

Preferred filling salt is a sodium sulfate.

According to liquid detergent composition of the present invention can also be " conc forms ", and in this case, liquid detergent composition according to the present invention will contain the water of lower amount than conventional liq washing composition.

The water-content of general concentrated liquid detergent by detergent composition weight, preferably is less than 40%, more preferably less than 30%, most preferably is less than 20%.Tensio-active agent

Preferably, detergent composition of the present invention comprises tensio-active agent or surfactant system, and wherein tensio-active agent can be selected from non-ionic type and/or anionic and/or cationic and/or both sexes and/or amphoteric ion type and/or semi-polarity tensio-active agent.

The general content of tensio-active agent is 0.1% to 60% weight, and preferred incorporation is 1% to 35% of detergent composition weight of the present invention, most preferably 1%-30%.

The enzyme component compatibility that exists in the preferred tensio-active agent of being prepared and the present composition.In liquid or gelatinous composition, the tensio-active agent of preparation preferably makes the stability of any enzyme in its promotion or these compositions of not degrading at least.

The example of nonionic, negatively charged ion, positively charged ion, both sexes, zwitter-ion and the semi-polar nonionic surfactants that is fit to is disclosed among U.S. Pat 5707950 and the US5576282.

Highly preferred nonionogenic tenside is the polyhydroxy fatty acid amide surfactant of following formula:

R ²-C (O)-N (R ¹)-Z is R wherein ¹Be H, or R ¹Be C _1-4Alkyl, 2-hydroxyethyl, 2-hydroxypropyl or its mixture, R ²Be C _5-31Alkyl, Z are the polyhydroxy alkyls with the straight-chain alkyl chain that directly is connected with at least 3 hydroxyls, or its oxyalkylated derivative.Preferred R ¹Be methyl, R ²It is straight chain C _11-15Alkyl or C _16-18Alkyl or alkenyl be Oleum Cocois alkyl or its mixture for example, and Z is that for example glucose, fructose, maltose, lactose obtain by reducing sugar in reductive amination process.

Highly preferred anion surfactant comprises alkyl alkoxylated sulfate surfactant, and it is formula RO (A) _mSO ₃The water-soluble salt of M or acid, wherein R is unsubstituted C ₁₀-C ₂₄Alkyl or have C ₁₀-C ₂₄The hydroxyalkyl of moieties, preferred C ₁₂-C ₂₀Alkyl or hydroxyalkyl, more preferably C ₁₂-C ₁₈Alkyl or hydroxyalkyl, A are oxyethyl group or propoxy-unit, and the m value is greater than 0, generally between about 0.5 to about 6, more preferably between about 0.5 to about 3, M is H or positively charged ion, and it can be the ammonium cation of metallic cation (for example sodium, potassium, lithium, calcium, magnesium etc.), ammonium or replacement for example.Alkyl ethoxylated sulfate and alkyl propoxylated sulphates are that this paper expects.

When containing them, laundry detergent composition of the present invention typically contains has an appointment 1% to about 40%, and preferred about 3% to this anion surfactant of about 20% weight.

The highly preferred cationic surfactant that is used for the present composition is the soluble quaternary ammonium compound, and it has following formula:

R ₁R ₂R ₃R ₄N ⁺X ^-R wherein ₁Be C ₈-C ₁₆Alkyl, each R ₂, R ₃And R ₄Be C independently ₁-C ₄Alkyl, C ₁-C ₄Hydroxyalkyl, benzyl and-(C ₂H ₄O) _xH, wherein the x value is 2 to 5, X is a negatively charged ion.R ₂, R ₃, or R ₄In no more than one should be benzyl.

When comprising them, detergent composition of the present invention typically contains 0.2% to about 25%, and preferred about 1% to this cats product of about 8% weight.

When comprising them, detergent composition of the present invention typically contains 0.2% to about 15%, and preferred about 1% to this amphoterics of about 10% weight.

When comprising them, detergent composition of the present invention typically contains 0.2% to about 15%, and preferred about 1% to this zwitterionics of about 10% weight.

When comprising them, detergent composition of the present invention typically contains 0.2% to about 15%, and preferred about 1% to this semi-polar nonionic surfactants of about 10% weight.

Detergent composition of the present invention also can comprise the cosurfactant that is selected from uncle or tertiary amine.

Be used for suitable primary amine of the present invention and comprise formula R ₁NH ₂Amine, R wherein ₁Be C ₆-C ₁₂, preferred C ₆-C ₁₀Alkyl chain, or R ₄X (CH ₂) _n, X is-O-,-C (O) NH-or-NH-, R ₄Be C ₆-C ₁₂Alkyl chain, n are 1-5, preferred 3.R ₁Alkyl chain can be a straight or branched, and can preferably be less than 5 ethylene oxide moieties and disconnect by 12 of as many as.

According to following formula, preferred amine is positive alkylamine.Be used for the amine that the present invention is fit to and be selected from 1-hexylamine, 1-octylame, 1-decyl amine and lauryl amine.Other preferred primary amine comprises C8-C10 oxygen propylamine, octyloxy propyl group amine, 2-ethylhexyl oxygen propyl group amine, lauryl amido propyl group amine and amido propyl group amine.

Be used for the tertiary amine that the present invention is fit to and comprise formula R ₁R ₂R ₃The tertiary amine of N, wherein R ₁And R ₂Be C ₁-C ₈Alkyl chain or R ₃Be C ₆-C ₁₂, preferred C ₆-C ₁₀Alkyl chain, or R ₃Be R ₄X (CH ₂) _n, wherein X is-O-,-C (O) NH-or-NH-, R ₄Be C ₄-C ₁₂, n is 1-5, preferred 2-3, R ₅Be H or C ₁-C ₂Alkyl, x are 1-6.

R ₃And R ₄It can be straight or branched; R ₃Alkyl chain can preferably be less than 5 ethylene oxide moieties and disconnect by 12 of as many as.

Preferred tertiary amine is R ₁R ₂R ₃N, wherein R ₁Be C ₆-C ₁₂Alkyl chain, R ₂And R ₃Be C ₁-C ₃Alkyl or

R wherein ₅Be H or CH ₃, x=1-2.

The amidoamines of following formula further preferably: R wherein ₁Be C ₆-C ₁₂Alkyl; N is 2-4, and preferred n is 3; R ₂And R ₃Be C ₁-C ₄

The most preferred amine of the present invention comprises 1-octylame, 1-hexylamine, 1-decyl amine, 1-lauryl amine, C8-C10 oxygen propylamine, N-Oleum Cocois 1-3 diaminopropanes, Oleum Cocois alkyl dimethyl amine, lauryl dimethyl amine, lauryl two (hydroxyethyl) amine, Oleum Cocois two (hydroxyethyl) amine, 2 moles of propenoxylated lauryl amines, 2 moles of propenoxylated octylames, lauryl amido propyl-dimethyl amine, C8-C10 amido propyl-dimethyl amine and C10 amido propyl-dimethyl amines.

Being used for the most preferred amine of the present composition is 1-hexylamine, 1-octylame, 1-decyl amine, 1-lauryl amine.Particularly suitable is oleyl amine, lauryl amido propyl group amine and the Oleum Cocois amido propyl group amine of dodecyl dimethyl amine and dihydroxy ethyl Oleum Cocois alkylamine and 7 moles of ethoxylations.

The enzyme component that tensio-active agent of the present invention and surfactant system preferably are formulated into and are contained in the composition is compatible.In liquid or gelatinous composition, the preparation tensio-active agent preferably makes the stability of any enzyme in its promotion or these compositions of not degrading at least.Washing assistant

The present composition also can comprise washing assistant or builder system.The builder system of any routine all is applicable to the present invention, comprise silico-aluminate material, silicate, multi-carboxylate, alkyl or alkenyl succinic and lipid acid and for example material, metal ion chelation agent for example amino polyphosphonate, particularly ethylenediamine tetramethylene phosphonic acid and the diethylenetriamine pentamethylenophosphonic acid(DTPP) of ethylenediamine tetraacetic acid (EDTA), diethylenetriamine pentamethylene acetate.Phosphate builders also can be used for the present invention.

The present invention can comprise suitable washing assistant or washing salt.The content of washing composition salt/washing assistant can change in wide region according to the end-use of composition and the physical form of hope.When existing, the present composition typically comprises at least about 1% washing assistant, more typically is that about 10%-is about 80%, the about 50% weight washing assistant of the most about 15%-.But do not mean that the content that eliminating is lower or higher.

Inorganic or phosphorus-containing detergent salt comprises, but be not limited to this, following basic metal, ammonium and alkanol ammonium salt: poly-phosphate (is exemplified as tri-polyphosphate, pyrophosphate salt and glassy polymeric metaphosphate), phosphonate, phytinic acid, silicate, carbonate (comprising supercarbonate and sesquicarbonate), vitriol and silico-aluminate.But, need non-phosphorus Cleaning Aid Agent in certain areas.Importantly, even so-called " weak " washing assistant (with phosphate ratio) as Citrate trianion down, or good unexpectedly in the effect of (this situation at use zeolite or layered silicate washing assistant time can take place) present composition under so-called " hang down to help and wash " situation.

The organic detergent builder compound that is fit to the object of the invention includes, but are not limited to this: various multi-carboxylate's compounds.＂ multi-carboxylate ＂ used herein refers to has many carboxylate group, the compound of preferred at least 3 carboxylate group.The multi-carboxy acid salt washing agent can add in the composition with sour form usually, but also can add with the form of neutralized salt.When using with the form of salt, basic metal is preferred as sodium, potassium and lithium or alkanol ammonium salt.

The silicate-like builder that is fit to, carbonate, silico-aluminate washing assistant, multi-carboxy acid salt washing agent, Citrate trianion washing assistant, in the U.S. Pat 4566984 of Bush disclosed 3,3-dicarboxyl-4-oxa--1, the example of 6-adipate washing assistant and relevant compound, succsinic acid washing assistant, phosphorous washing assistant and lipid acid is disclosed in U.S. Pat 5576282,5728671 and 5707950.

Other washing assistants that are fit to can be mineral ion exchange materials, the silico-aluminate material of inorganic hydration normally, for example zeolite A, X, B, HS or the MAP of hydration of the synthetic zeolite of hydration more specifically.

Being suitable for concrete multi-carboxylate of the present invention is the multi-carboxylate of containing a carboxyl, comprises lactic acid, oxyacetic acid and their ether derivant, as is disclosed in belgian patent Nos.831, in 368,821,369 and 821,370.The multi-carboxylate of containing two carboxyls comprises the water-soluble salt of succsinic acid, propanedioic acid, (ethylenedioxy) oxalic acid, toxilic acid, diethyl alkyd, tartrate, tartronic acid and fumaric acid; and be described in German Patent 2; 446; 686 and 2,446,687 and U.S. Pat 3; 935; ether carboxylate in 257, and the sulfinyl carboxylate salt of describing in the belgian patent 840,623.The multi-carboxylate of containing three carboxyls comprises particularly water miscible Citrate trianion, aconitate and citraconate, and the succinate derivative for example is described in English Patent 1,379, carboxy methoxy-succinic acid salt in 241, be described in the newborn acyloxy succinate in the Netherlands patent applications 7205873, for example be described in English Patent No.1 with oxygen multi-carboxylate material, the 2-oxa--1 in 387,447,1,3-tricarballylic acid salt.

The multi-carboxylate of containing four carboxyls comprises English Patent No.1, disclosed oxygen di-succinate, 1,1,2 in 261,829,2-ethane tetracarboxylic acid hydrochlorate, 1,1,3,3-propane tetracarboxylic acid salt and 1,1,2,3-propane tetracarboxylic acid salt.Containing the substituent multi-carboxylate of sulfo group comprises and is disclosed in English Patent Nos.1,398,421 and 1,398,422 and United States Patent (USP) 3,936,448 in the sulfo-succinic acid salt derivative, with English Patent No1, the sulfonated pyrolysis Citrate trianion of describing in 082,179 is disclosed in English Patent No.1 and contain the substituent multi-carboxylate of phosphine, in 439,000.

Alicyclic ring and heterocyclic multi-carboxylate comprise pentamethylene-suitable, suitable, suitable-tetracarboxylic acid hydrochlorate, cyclopentadiene pentacarboxylic acid salt, 2,3,4,5-tetrahydrofuran (THF)-suitable, suitable, suitable-tetracarboxylic acid hydrochlorate, 2, the 5-tetrahydrofuran (THF)-along dicarboxylate, 2,2,5,5-tetrahydrofuran (THF) tetracarboxylic acid hydrochlorate, 1,2,3,4,5,6-hexane hexacarboxylic acid salt and polyvalent alcohol be the carboxymethyl derivant of sorbyl alcohol, N.F,USP MANNITOL and Xylitol for example.Aromatic multi-carboxy acid's salt comprises English Patent No.1, disclosed melitic acid, 1,2,4 in 425,343, the derivative of 5-pyromellitic acid and phthalic acid.

More than in these compounds, preferred multi-carboxylate is the hydroxycarboxylate of containing three carboxyls of as many as in each molecule, Citrate trianion more specifically.

The preferred builder system that is used for the present composition comprises for example zeolite A or have for example mixture of citric acid of lamellated silicate (SKS-6) and water-soluble carboxylate sequestrant of water-insoluble silico-aluminate washing assistant.

Preferred builder system comprises for example zeolite A and the water-soluble carboxylate sequestrant mixture of citric acid for example of water-insoluble silico-aluminate washing assistant.The preferred builder system that is used for liquid detergent composition of the present invention is soap and multi-carboxylate.

Other water-soluble organic salt that is fit to is the acid of homopolymerization or copolymerization or their salt, and wherein poly carboxylic acid comprises at least two carboxyls that are separated from each other by no more than two carbon atoms.Such polymkeric substance is disclosed in GB-A-1, in 596,756.The example of this class salt is the polyacrylate with MW2000-5000, and the multipolymer of they and maleic anhydride, and this multipolymer has molecular weight 20,000 to 70,000, particularly about 40,000.

The general content of detergent builder compound salt is 5% to 80% of composition weight, and is preferred 10% to 70%, the most normally 30% to 60%.SYNTHETIC OPTICAL WHITNER

The other optionally washing agent component that can be included in the detergent composition of the present invention comprises SYNTHETIC OPTICAL WHITNER, for example hydrogen peroxide, PB1, PB4 and have the percarbonate of granularity 400-800 micron.These bleaching components can comprise one or more oxygen bleaching agents and according to one or more bleach-activating agents of selected SYNTHETIC OPTICAL WHITNER.When having the oxygen bleaching compound, it usually exists to about 25% content with about 1%.

Being used for bleaching components of the present invention can be any SYNTHETIC OPTICAL WHITNER that is applicable to detergent composition, comprises oxygen bleaching agent and other SYNTHETIC OPTICAL WHITNER well known in the art.Be applicable to that SYNTHETIC OPTICAL WHITNER of the present invention can be activatory or inactive SYNTHETIC OPTICAL WHITNER.

The example of the SYNTHETIC OPTICAL WHITNER that is fit to is disclosed among U.S. Pat 5707950 and the US5576282.

The hydrogen peroxide releasing agent can with for example be disclosed in the bleach-activating agent in the U.S. Pat 5707950 or the sulfocarbolate (NACA-OBS of N-nonanoyl-6-aminocaprolc acid; be described among the WO94/28106) combine use; these bleach-activating agents are crossed the peracid that hydrolysis forms active bleaching thing, thereby cause the bleaching effect that improves.Also the activator of Shi Heing is the citrate of acidylate.

The SYNTHETIC OPTICAL WHITNER that is suitable for that is used for detergent composition of the present invention, comprise peroxy acid and comprise bleach-activating agent and the bleach system of peroxy bleaching compound is described in WO95/27772, WO95/27773, WO95/27774, WO95/27775 and the U.S. Pat 5707950.

The metallic catalyzer that is used for bleaching composition comprises the catalyzer that contains cobalt, and five amine cobaltous acetate (III) salt and manganiferous catalyzer for example are for example at EPA549271, EPA549272; EPA458397; US5246621; EPA458398; Those that describe among US5194416 and the US5114611.The bleaching composition that contains peralcohol, manganiferous bleaching catalyst and sequestrant is described in the patent application 94870206.3.The dye transfer restraining effect

Detergent composition of the present invention can comprise that also being used for being suppressed at the dyestuff that comprises dissolving that the fabric washing of being with yarn dyed fabric and conditioning operation process are run into and suspension is transferred to compound on the another kind of fabric from a kind of fabric.The polymeric dye transfer inhibitor

Detergent composition of the present invention also can comprise 0.001% to 10%, and is preferred 0.01% to 2%, more preferably 0.05% to 1% weight polymeric dye transfer inhibitor.Usually said polymeric dye transfer inhibitor is mixed in the detergent composition is to be transferred on the fabric of washing simultaneously from the fabric of being with look in order to suppress dyestuff.Before the fugitive dye under band yarn dyed fabric washing had an opportunity to be attached to other article the washing, these polymkeric substance had the ability with its chelating or absorption.

Particularly suitable polymeric dye transfer inhibitor is multipolymer, polyvinylpyrrolidonepolymers polymers, Ju Yi Xi oxazolidinone and the polyvinyl imidazol or their mixture of polyamine N-oxide pllymers, N-vinyl pyrrolidone and N-vinyl imidazole.The example of this dye transfer inhibitor is disclosed among U.S. Pat 5707950 and the US5576282.

Other dye transfer inhibitors that are fit to include, but are not limited to crosslinked polymkeric substance.Cross-linked polymer is that its skeleton interconnects to polymkeric substance to a certain degree; These keys can be chemistry or physical property, can have active group on the skeleton or on side chain.Cross-linked polymer has been described in the polymer science magazine, the 22nd volume, 1035-1039 page or leaf.

In one embodiment, cross-linked polymer is to prepare with such method, and promptly they form three-dimensional rigid structure, and it can be captured in dyestuff in the hole that is formed by three-dimensional structure.In another embodiment, cross-linked polymer captures dyestuff by swelling.

This cross-linked polymer is described in the european patent application 94870213.9 of pending trial.

In addition, this polymkeric substance also strengthens the performance of enzyme of the present invention.Dispersion agent

Detergent composition of the present invention also can contain dispersion agent: suitable water-soluble organic salt, and they are acid or its salt of homopolymerization or copolymerization, wherein poly carboxylic acid comprises at least two carboxyls that are separated from each other by no more than 2 carbon atoms.

Such polymkeric substance is disclosed among the GB-A-1596756.The example of this salt is the multipolymer of the polyacrylate of MW2000-5000 and they and maleic anhydride, and this polymkeric substance has molecular weight 1000-100000.

Especially the multipolymer of acrylate and methylacrylate, the 480N of molecular weight 4000 for example, by the weight of composition, it can 0.5%-20% weight add in the detergent composition of the present invention.

The present composition can contain calcium soap peptizing agent compound, and it has and is no more than 8, preferably is no more than 7, be most preferably not exceeding 6 as the ability (LSDP) of the dispersion calcium soap of definition hereinafter.The content of calcium soap peptizing agent compound is pressed composition weight meter, is preferably 0%-20%.

The numeric measure that the calcium soap peptizing agent is renderd a service is provided by the ability (LSDP) of lime soap dispersing agent, the ability of described lime soap dispersing agent is to use H.C.Borghetty and C.A.Bergman, the lime soap dispersing agent test determination of describing in the article of 88-90 page or leaf (1950) can will (J.Am.Oil.Chem.Soc.) the 27th be rolled up by U.S. oiling association.This calcium soap distributed test method is extensive use of by the professional in present technique field, and reference example is as, following survey article; W.N.Linfield, tensio-active agent science book series (Surfactant Science Series), the 7th volume p3; W.N.Linfield, surfactant detergent (Tenside Surf.Det.), the 27th volume, the 1st 59-163 page or leaf (1990); And M.K.Nagarajan, W.F.Masler, makeup and toilet articles (Cosmetic and Toiletries), the 104th volume, 71-73 page or leaf (1989).LSDP disperses the dispersion agent that the calcium soap settling needs and the weight % ratio of sodium oleate, and said calcium soap settling is by at the 333ppm of 30ml CaCO ₃(Ca: Mg=3: 2) the 0.025g sodium oleate in the equivalent hardness water forms.

Tensio-active agent with good calcium soap sol ability comprises some amine oxide, trimethyl-glycine, sultaine, alkyl ethoxy sulfate and ethoxylated alcohol.

Being used for the LSDP of having of the present invention is no more than 8 tensio-active agent example and comprises C ₁₆-C ₁₈Dimethyl oxidation amine, has the C of average degree of ethoxylation 1-5 ₁₂-C ₁₈Alkyl ethoxy sulfate, particularly has a C that ethoxylation degree is 3 (LSDP=4) ₁₂-C ₁₅Alkyl ethoxy sulfate surfactant and have the C that average degree of ethoxylation is 12 (LSDP=6) or 30 ₁₄-C ₁₅Ethoxylated alcohol is sold by trade(brand)name Lutensol A012 and Lutensol A030 respectively by BASF GmbH.

Be applicable to that polymeric calcium soap sol of the present invention is described in the article of M.K.Nagarajan and W.F.Masler, see makeup and toilet articles (Cosmetic andToiletries), the 104th volume, 71-73 page or leaf (1989).

The hydrophobic bleach agent is the amino caproyl of 4-[N-capryloyl-6-for example] benzene sulfonate, the amino caproyl of 4-[N-nonanoyl-6-] benzene sulfonate, the amino caproyl of 4-[N-decanoyl-6-] benzene sulfonate and their mixture; Also can be used as this soap sol component with the combination of nonanoyl oxygen benzene sulfonate and hydrophilic/hydrophobic SYNTHETIC OPTICAL WHITNER preparation.

The example of the dispersion agent that other are fit to is disclosed in U.S. Pat 5576282 and 5728671.Conventional detergent enzyme

Detergent composition of the present invention also contains one or more enzymes that cleaning performance and/or nursing fabric benefit are provided except containing hexosaminidase (hexosaminidase).

Said enzyme comprises and is selected from those following enzymes: hemicellulase, peroxidase, proteolytic enzyme, cellulase, zytase, lipase, Phospholipid hydrolase, esterase, at, polygalacturonase, M-Zyme, reductase enzyme, oxydase, phenol oxidase, lipoxygenase, lignoenzyme, Starch debranching enzyme, tannase, pentosanase, malic enzyme (malanase), beta-glucanase, arabinofuranosidase/xylosidase, Unidasa, chondroitinase, laccase and known amylase, or their mixture.

The example of the enzyme that is fit to is disclosed in U.S. Pat 5576282,5728671 and 5707950.

Preferred combination is to contain the conventional detergent composition that is suitable for enzyme such as proteolytic enzyme, lipase, at and/or cellulase and hexosaminidase bonded mixed enzyme.

Particularly suitable proteolytic enzyme is described in the PCT open source literature: The Procter ﹠amp; The WO95/30010 that announce the November 9 nineteen ninety-five of GambleCompany; The Procter ﹠amp; The WO95/30011 that announce the November 9 nineteen ninety-five of GambleCompany; The Procter ﹠amp; The WO95/29979 that announce the November 9 nineteen ninety-five of GambleCompany.

Except disclosed peroxidase in U.S. Pat 5576282,5728671 and 5707950, other peroxidase that are fit to are disclosed in the European patent application EP of submitting on February 20th, 1,996 96870013.8.What also be fit to is laccase.

Preferred toughener is the thiodiphenylamine of replacement and the cloves acid esters (C of phenoxazine (phenoxasine) lysivane propionic acid (PPT), 10-ethyl thiodiphenylamine-4-carboxylic acid (EPC), 10-phenoxazine propionic acid (POP) and 10-first base phenoxazine (as described in WO94/12621) and replacement ₃-C ₅The alkyl cloves acid esters that replaces) and phenol.SPC-D or Sodium peroxoborate are preferred hydrogen peroxide cources.

In detergent composition weight, the incorporation of peroxidase described in the detergent composition is generally the 0.0001-2% organized enzyme.

Other preferred enzyme that detergent composition of the present invention can comprise comprises lipase.The spendable suitable lipase of washing composition comprises by the microorganism in the Rhodopseudomonas family, as those lipase of Situ Ci Shi (stutzeri) aeruginosa atcc 19.154 generations, as is disclosed in the English Patent 1372034.The lipase that is fit to comprises that the antibody with lipase that is produced by microorganism Pseudomonas fluorescens IAM1057 shows those lipase of positive immunological cross-reaction.This lipase can be by Amano Pharmaceutical Co.Ltd.Nagoya, and Japan has bought, and commodity are called lipase P " Amano ", hereinafter are referred to as " Amano-P ".Other merchants that are fit to sell lipase and comprise Amano-CES, the lipase that obtains by Chromobacter viscosum, for example, and Chromobacter viscosum var.lipolyticum NRRLB3673, they are from Toyo Jozo Co., Tagata, Japan; Chromobacter viscosum lipase, it is from U.S.Biochemical Corp., U.S.A. and the DisoynthCo. of Holland and the lipase that is obtained by gladiolus pseudomonas (Pseudomonas gladioli).Particularly suitable lipase is M1 Lipase for example ^RAnd Lipomax ^R(Gist-Brocades) and Lipolase ^RWith Lipolase Ultra ^R(Novo), found that be very effective when they and the present composition are used in combination.

Also the enzyme of Shi Heing is at [EC 3.1.1.50], and it is considered to a kind of lipase of particular variety, does not promptly need the lipase of interface activation.Adding in detergent composition for example has been described among the WO-A-88/09367 (Genencor).

Lipase and/or the at generally incorporation in detergent composition are 0.0001% to 2% organized enzyme of detergent composition weight.

Can comprise known amylase (α and/or β), be used to remove spot based on carbohydrate.The WO/94/02597 of the Novo Nordisk A/S that on February 3rd, 1994 announced has described the cleaning combination that mixes mutant amylase.Also referring to the WO/95/10603 of the WO/94/18314 of the Genencor that announced on August 18th, 1994 and the Novo Nordisk A/S that announces April 20 nineteen ninety-five.Other the known amylase that is used for detergent composition comprises a-and beta-amylase.A-amylase is that prior art is known, is included in US5003257; EP252666; WO/91/00353; FR2676456; EP285123; EP525610; Those disclosed amylase in EP368341 and the british patent specification 1296839 (Novo).Other amylase that is fit to is stable enhanced amylase, be included in the WO94/18314 that announced on August 18th, 1994 and the WO96/05295 of the Genencor that announces on February 22nd, 1996 in the Purafact Ox Am that describes ^RWith the disclosed amylase variants of buying from Novo Nordisk A/S among the WO95/10603 that announces in April, 95.

The example that the merchant sells a-amylase product is Termamyl ^, Ban ^, Fungamyl ^And Duramyl ^, all can buy from Novo Nordisk A/S Denmark.WO95/26397 has described other amylase that is fit to: a-amylase is characterised in that and passes through Phadebas ^The measuring of a-amylase activity is higher than Termamyl in 25 ℃ of-55 ℃ of temperature and pH value its specific activity under the 8-10 scope ^Specific activity at least 25%.Have improvement about activity level and thermostability and more other amylolytic enzyme of the horizontal combinatorial property of high reactivity be described among the WO95/35382.

Above-mentioned enzyme can be from any suitable source, as plant, animal, bacterium, mould and yeast source.Can use the purifying or the non-purified form of these enzymes.By determining also to comprise the mutant of natural enzyme.Mutant can obtain by for example protein and/or genetic engineering, chemistry and/or the physically modified to natural enzyme.Common way is to express enzyme by host's organism, and the clone wherein is responsible for producing the genetic material of enzyme in host's organism.

The described enzyme generally incorporation in detergent composition is 0.0001% to 2% organized enzyme of detergent composition weight.Enzyme can be used as one-component independently and adds and (contain a kind of ball, grain of enzyme, stable liquid etc..) or add (for example composite particles) as the mixture of two or more enzymes.

The detergent component that other that can add is fit to is the oxydasis scavenging agent, and the example of this kind of enzyme oxidation scavengers is four ethylidene polyamine of ethoxylation.

Various enzyme materials and their methods in the synthetic detergent composition of mixing also are disclosed in WO 9307262 and the WO 9307260 of Genencor International, in the people's such as McCarty that the WO8908694 of Novo and on January 5th, 1971 authorize the U.S. Pat 3553139.Some enzymes also be disclosed in the people's such as Place that authorized on July 18th, 1978 U.S. Pat 4101457 and the U.S. Pat 4507219 of the Hughes that authorized on March 26th, 1985 in.Be used for the enzyme material of liquid detergent formula and they are incorporated in these prescriptions, be disclosed in the people's such as Hora that authorized on April 14th, 1981 the U.S. Pat 4261868.The enzyme that is used for washing composition can make its stabilization with various technology.The enzyme stabilization technology is open and illustrate the people's such as Gedge that authorize on August 17th, 1971 U.S. Pat 3600319, EP199405 and October in 1986 disclosed Venegas on the 29th European patent EP 200586 in.The enzyme stabilising system for example also is described in the U.S. Pat 3519570.The useful bacillus AC13 that produces proteolytic enzyme, zytase and cellulase is described among the WO 9401532A of Novo.Sequestrant

Detergent composition of the present invention can also randomly contain one or more iron and/or manganese sequestrant.This class sequestrant can be selected from aminocarboxylate, amino phosphonates do, and aromatic chelating agent of multifunctional replacement and composition thereof, all sequestrants are defined hereinafter.Do not accept the restriction of opinion, it is believed that the advantage of these materials is that partly they have the outstanding ability of removing magnesium and mn ion from washing soln by forming the soluble chelating agent.

The example of the sequestrant that is fit to is disclosed in the U.S. Pat 5728671.

The present composition also can contain water miscible methylglycine oxalic acid (MGDA) salt (or sour form) as sequestrant, or as the useful auxiliary washing assistant of insoluble washing assistant for example such as zeolite, layered silicate etc.

If the use sequestrant, then the consumption of these sequestrants is generally about 0.1%-15% of detergent composition weight of the present invention.If use, more preferably amount of chelant is about 0.1%-3.0% of said composition weight.Suds suppressor

Another kind of optional component is a suds suppressor, is exemplified as polysiloxane and silicon dioxide-poly-mixture of siloxanes.The example of the suds suppressor that is fit to is disclosed in U.S. Pat 5707950 and 5728671.The consumption of these suds suppressors is generally 0.001% to 2% of composition weight, and preferred 0.01% to 1%.Softening agent

Fabric softener also can mix in the laundry detergent composition of the present invention.These softening agents can be inorganic or organic type.The example of inorganic softening agent is disclosed in the terre verte class among GB-A-1400898 and the USP 5,019,292.The organic fabric softening agent comprises as being disclosed in the water-insoluble tertiary amine among GB-A 1,514 276 and the EP-B 0 011 340 and being disclosed among EP-B-0 026527 and the EP-B-0 026 528 mixture of the former tertiary amine and single C12-C14 quaternary ammonium salt, and as being disclosed in the two long-chain acid amides among the EP-B-0242 919.Other organic constituent that is fit to that is used for the fabric softener system comprises the high molecular weight polyethylene oxide material that is disclosed in EP-A-0299 575 and 0 313 146.

Particularly suitable fabric softener is disclosed in U.S. Pat 5707950 and 5728673.

The content of terre verte is generally 2% to 20%, more preferably 5% to 15% weight, and this material is to mix component and join in all the other components of prescription as doing.The organic fabric softening agent for example incorporation of the acid amides material of water-insoluble tertiary amine or two long-chains is 0.5% to 5% weight, 1% to 3% weight normally, and the add-on of high molecular weight polyethylene oxide material and water-soluble cationic material is 0.1% to 2%, normally 0.15% to 1.5% weight.Though in some cases, mix that particle adds or they are sprayed onto as melt liquid may be more convenient on other solid ingredient of composition as doing for these materials, usually their added in the spray-dired part of composition.

The soft component of typical cationic fabric comprises the soft actives of water-insoluble quaternary ammonium fabric, and the most normally used is two long alkyl chain ammonium chloride or methylsulfuric acid ammonium.

Wherein the preferred cation softening agent comprises following: 1) chlorination ditallow Dimethyl Ammonium (DTDMAC); 2) chlorination dihydro tallow Dimethyl Ammonium; 3) methylsulfuric acid dihydro tallow Dimethyl Ammonium; 4) Varisoft TA 100; 5) chlorination two oil base Dimethyl Ammonium; 6) chlorination two palmityl hydroxyethyl ammonium methyls; 7) chlorination stearyl benzyl dimethyl ammonium; 8) chlorination tallow trimethyl ammonium; 9) chlorination hydrogenation tallow trimethyl ammonium; 10) chlorination C _12-14Alkyl hydroxyethyl dimethyl ammonium; 11) chlorination C _12-18Alkyl dihydroxy ethyl ammonium methyl; 12) chlorination two (stearoyl-oxy ethyl) Dimethyl Ammonium (DSOEDMAC); 13) chlorination two (butter acyloxy ethyl) Dimethyl Ammonium; 14) methylsulfuric acid ditallow tetrahydroglyoxaline; 15) methylsulfuric acid 1-(2-butter amido ethyl)-2-tallow tetrahydroglyoxaline.

The chlorination that biodegradable quaternary ammonium compound has used as tradition and the surrogate of methylsulfuric acid double long-chain alkyl ammonium and exist.This quaternary ammonium compound contains by functional group carboxyl long-chain alkane (alkene) group at interval for example.Described material and the fabric sofetening composition that contains them are at many publications, and be for example open among EP-A-0040562 and the EP-A-0239910.

The anionic unrestricted example compatible with softening agent that is used for quaternary ammonium compound and amine precursor comprises chlorine root or methylsulfate.Other

Can use other components that are used for detergent composition, for example soil-suspending agent, dirt release agent, white dyes, abrasive material, sterilant, tarnish inhibitor, tinting material and/or seal or non-encapsulated perfume, the example be disclosed in U.S. Pat 5707950,5576282 and and 5728671 in.

Free chlorine in the tap water known in the art can make the enzyme rapid deactivation that is included in the detergent composition.Therefore, in prescription, use and account for total composition weight and be higher than 0.1% chlorine scavenger for example perborate, ammonium sulfate, S-WAT or polymine will provide improvement to detergent enzyme stability in the washing whole process.The composition that comprises chlorine scavenger is described in the european patent application of submitting on January 31st, 1,992 92870018.6.

Alkoxylate multi-carboxylate for example by the polyacrylate preparation those, is applicable to the present invention, so that extra degrease performance to be provided.This class material is described in WO91/08281 and PCT90/01815, page 4 and hereinafter wait, and it quotes for referencial use at this paper.From chemically, these materials comprise that there is the polyacrylate of an oxyethyl group side chain every 7-8 acrylate unit.Side chain has formula :-(CH ₂CH ₂O) _m(CH ₂) _nCH ₃, wherein m is 2-3, n is 6-12.This side chain is connected with polyacrylate " skeleton " by ester bond, to form the polymkeric substance of " pectination " structure type.Its molecular weight can change, but generally in about 50000 scopes of about 2000-.This alkoxylate multi-carboxylate can account for about 0.05%-about 10% of present composition weight.Washing methods

The present composition can be used for comprising immersion process in any washing or the purging method basically, and pretreatment process and having in the method for rinse step can add independent rinse aid composition in described rinse step.

Method described herein comprises by usual method and with the method that hereinafter exemplifies explanation fabric being contacted with washing soln.

The inventive method can be finished in washing process easily.This purging method preferably carries out under 5 ℃ to 95 ℃, particularly carries out under 10 ℃ to 60 ℃.The pH of treatment soln is preferably 7 to 11.

Following examples are to be used to illustrate composition of the present invention, rather than are used for restriction or define scope of the present invention in addition.In detergent composition, the content of enzyme accounts for total composition weight by pure enzyme to be represented, unless otherwise indicated, detergent component is represented by accounting for total composition weight.The component symbol of wherein writing a Chinese character in simplified form has to give a definition: LAS: straight chain C ₁₂Sodium alkyl benzene sulfonate TAS: tallow alkyl sodium sulfate CXYAS: C _1X-C _1YSodium alkyl sulfate 25EY: with the condensation of average Y moles of ethylene oxide mainly be the C of straight chain ₁₂-C ₁₅Primary alconol CXYEZ; With the condensation of average Z moles of ethylene oxide mainly be the C of straight chain _1X-C _1YPrimary alconol XYEZS: every mole of C with average Z moles of ethylene oxide condensation _1X-C _1YSodium alkyl sulfate QAS: R ₂.N ⁺(CH ₃) ₂(C ₂H ₄OH), R ₂=C ₁₂-C ₁₄Soap: the straight-chain alkyl carboxylic acid's sodium non-ionic type table that obtains by 80/20 mixture of butter and Oleum Cocois: have average degree of ethoxylation and be 3.8 and average propoxylation degree be 4.5 C ₁₃-C ₁₅Surface-active agent blended ethoxylated/propoxylated fatty alcohol, by BASF Gmbh with trade(brand)name

Plurafax LF404 sells CFAA: C ₁₂-C ₁₄Alkyl N-methyl glucose amide TFAA: C ₁₆-C ₁₈Alkyl N-methyl glucose amide TPKFA: C ₁₂-C ₁₄The full cut lipid acid DEQA of topping: chlorination two (tallowyloxyethyl) Dimethyl Ammonium Neodol 45-: C14-C15 straight chain primary alcohol ethoxylate 13 silicate of selling by Shell Chemical company: amorphous sodium silicate (SiO ₂: Na ₂O ratio=2.0) NaSKS-6: formula δ-Na ₂Si ₂O ₅Crystalline layered silicate carbonate: granularity is at the anhydrous sodium carbonate supercarbonate between the 200 μ m-900 μ m: the anhydrous sodium bicarbonate STPP of granularity between 400 μ m-1200 μ m: anhydrous sodium tripolyphosphate MA/AA: 1: 4 toxilic acid/acrylic copolymer, the about 70000-80000 zeolite of molecular-weight average A: formula Na ₁₂(AlO ₂SiO ₂) ₁₂27H ₂The hydrated sodium aluminosilicate of O, primary particle size be 0.1 to

10 microns Citrate trianions: citrate trisodium dihydrate, activity are 86.4%, and size-grade distribution is at 425 μ m-850

μ m citric acid: Citric Acid, usp, Anhydrous Powder PB1: empirical formula NaBO ₂.H ₂O ₂Anhydrous sodium perborate monohydrate SYNTHETIC OPTICAL WHITNER PB4: anhydrous sodium perborate tetrahydrate percarbonate: empirical formula is 2Na ₂CO ₃3H ₂O ₂Anhydrous percarbonate bleach TAED: tetraacetyl ethylene diamine NOBS: the floating of the nonanoyl oxygen benzene sulfonate photoactivation of sodium-salt form: the sulfonated phthalocyanine zinc white agent proteolytic enzyme of sealing with the dextrin polymer soluble: by Novo Nordisk A/S with trade(brand)name Savinase, Alcalase, Durazym

With the albumen of selling with trade(brand)name Maxacal, Maxapem by Gist Brocades

Lytic enzyme and patent WO91/06637 and/or WO95/10591 and/or

The proteolytic enzyme amylase of describing among the EP251446: in WO94/18314, WO96/05295, describe by Genencor by trade(brand)name

Purafact Ox Am ^RThe amylolytic enzyme of selling; Get by Novo Nordisk A/S

The Termamyl that arrives ^, Fungamyl ^And Duramyl ^And in WO95/26397

Those amylolytic enzyme lipase of describing: by Novo Nordisk A/S with trade(brand)name Lipolase, Lipolase Ultra

The lipolytic enzyme xyloglucanase enzymes of selling: described above and in WO94/14953, be defined as EG II to the xyloglucan spy

The endo-dextranase cellulase of the opposite sex; By Novo Nordisk A/S with trade(brand)name Carezyme, Celluzyme and/or

The cellulase CMC that Endolase sells: Xylo-Mucine HEDP: 1,1-hydroxyl ethane di 2 ethylhexyl phosphonic acid DETPMP: diethylenetriamine five (methylene phosphonic acid), by Monsanto with trade(brand)name Dequest

2060 sell PVNO: poly-(4-vinylpridine)-N-oxide compound PVPVI: poly-(4-vinylpridine)-N-oxide compound/vinyl imidazole and vinyl pyrrolidone

Multipolymer whitening agent 1: 4,4 '-two (2-sulfo group styryl) biphenyl disodium whitening agent 2: 4,4 '-two (4-phenylamino-6-morpholino-1,3,5-triazines 2-yl) stilbene-2:2 '-two

The disodium sulfonate polysiloxane is anti-: polydimethylsiloxane foam control agent and mixture as the siloxanes-oxyalkylene copolymers infusion of dispersion agent; the ratio of described foam control agent and described dispersion agent is 10: 1-100: 1 granular suds suppressing agent: 12% siloxanes/silicon-dioxide; 18% stearyl alcohol, 70% pearl starch SRP1: sulfo group benzoyl or hydroxyethyl sulfonate be end capped to have the oxygen ethyleneoxy group and to benzene

The ester SRP2 of diacyl skeleton: poly-(terephthalic acid 1, the inferior propyl ester of 2-) short block polymer vitriol of diethoxyization: anhydrous sodium sulphate HMWPEO: high molecular weight polyethylene oxide embodiment 1

Preparation is according to following detergent formulations of the present invention, and wherein I and III are the phosphorated detergent composition, and II is the detergent composition that contains zeolite.

I II III

Blowing powder: STPP 24.0-24.0 Wessalith CSs-24.0-C45AS, 9.0 6.0 13.0 MA/AA, 2.0 4.0 2.0 LAS, 6.0 8.0 11.0 TAS 2.0--silicate 7.0 3.0 3.0 CMC 1.0 1.0 0.5 brightening agents 2 0.2 0.2 0.2 soaps 1.0 1.0 1.0 DETPMP 0.4 0.4 0.2 spray C45E7 2.5 2.5 2.0 C25E3 2.5 2.5 2.0 polysiloxanes anti-foaming agents 0.3 0.3 0.3 spices 0.3 0.3 0.3

Dried additive: sodium sulphate 3.0 3.0 5.0 counterbalances that bleaching agent 0.02 0.02 0.02 proteinase-10 .01 0.01 0.01 lipase 0.009 0.009--amylase 0.002--0.001 xyloglucanase enzymes 0.05 0.05 0.05 of carbonate 6.0 13.0 15.0 PB4 18.0 18.0 10.0 PB1 4.0 4.0 0 TAED 3.0 3.0 1.0 photoactivation is dry mixed, (moisture and other a small amount of components) 100.0 100.0 100.0 density, (g/l) 630 670 670 embodiment 2

Preparation is according to the following detergent formulations that does not contain SYNTHETIC OPTICAL WHITNER that is used in particular for washing colored clothes of the present invention:

I II III

Blowing powdery zeolite A 15.0 15.0-sodium sulphate 0.0 5.0-LAS 3.0 3.0-DETPMP 0.4 0.5-CMC 0.4 0.4-MA/AA 4.0 4.0-

Agglomerate C45AS--11.0LAS 6.0 5.0-TAS 3.0 2.0-silicate 4.0 4.0-Wessalith CS 10.0 15.0 13.0CMC--0.5MA/AA--2.0 carbonate 9.0 7.0 7.0

Spray spices 0.3 0.3 0.5C45E7 4.0 4.0 4.0C25E3 2.0 2.0 2.0

Dried additive MA/AA--3.0NaSKS-6--12.0 citrate 10.0-8.0 bicarbonates 7.0 3.0 5.0 carbonate 8.0 5.0 7.0PVPVI/PVNO 0.5 0.5 0.5 proteinase-10 .026 0.016 0.047 lipase 0.009--0.009 amylase 0.005 0.005--xyloglucanase enzymes 0.05 0.05 0.05 cellulase 0.006 0.006--polysiloxanes anti-foaming agent 5.0 5.0 5.0

Dried additive sulfuric acid sodium 0.0 9.0 0.0 equipoises (moisture and other small number of groups branches) 100.0 100.0 100.0 density (g/l) 700 700 700 embodiment 3

Preparation is according to following detergent formulations of the present invention:

(moisture and other lack 100 100 100 100 to the floating agent 70ppm 45ppm-10ppm brightening agent 1 0.2 0.2 0.08 0.2PBI 6.0 2.0--NOBS 2.0 1.0--counterbalances of I II III IVLAS 20.0 14.0 24.0 22.0QAS 0.7 1.0-0.7TFAA-1.0--C25E5/C45E7-2.0-0.5C45E3S-2.5--STPP 30.0 18.0 30.0 22.0 silicate 9.0 5.0 10.0 8.0 carbonate 13.0 7.5-5.0 bicarbonate-7.5--DETPMP 0.7 1.0--SRP1 0.3 0.2-0.1MA/AA 2.0 1.5 2.0 1.0CMC 0.8 0.4 0.4 0.2 xyloglucan enzymes 0.05 0.05 0.05 0.05 proteinase-10 .008 0.01 0.026 0.026 amylase 0.007--0.005 0.002 lipase 0.004----0.002 cellulase 0.0015 0.0005--photoactivation

The amount component) embodiment 4

Preparation is according to following liquid detergent preparation of the present invention:

I II III IV V VI VII VIIILAS 10.0 13.0 9.0-25.0---C25AS 4.0 1.0 2.0 10.0-13.0 18.0 15.0C25E3S 1.0--3.0-2.0 2.0 4.0C25E7 6.0 8.0 13.0 2.5--4.0 4.0TFAA---4.5-6.0 8.0 8.0QAS----3.0 1.0--TPKFA 2.0-13.0 2.0-15.0 7.0 7.0---5.0--4.0 4.0 2.0 3.0 1.0 1.5 1.0 1.0 1.0 1.0/ 12.0 10.0--15.0--- 4.0 2.0 1.0-1.0--- 4.0 4.0 7.0 2.0 7.0 2.0 3.0 2.01,2- 4.0 4.0 2.0 7.0 6.0 8.0 10.0 13.---5.0--9.0 9.0--8-----NaOH ( pH ) 8.0 8.0 7.6 7.7 8.0 7.5 8.0 8.2 0.5-0.5 0.2--0.4 0.3DETPMP 1.0 1.0 0.5 1.0 2.0 1.2 1.0-SRP2 0.3-0.3 0.1--0.2 0.1PVNO-------0.10 0.05 0.05 0.05 0.05 0.05 0.05 0.05 0.05 .005 .005 .004 .003 0.08 .005 .003 .006-.002-.000--.003 .003

2 amylase .002----.004 .002 .008 .005 .005 cellulases---.000--.0004 .0004

1 boric acid 0.1 0.2-2.0 1.0 1.5 2.5 2.5 sodium formiate--1.0-----calcium chloride-0.01-0.01----

5 wilkinites----4.0 4.0--suspended clay----0.6 0.3--SD3 equipoise moisture and 100 100 100 100 100 100 100 100 other a small amount of component embodiment 5

Preparation is according to the granular fabric detergent composition of of the present invention providing " washing process softness " ability:

As many as 100% embodiment 6 of I II45AS-10.0LAS 7.6-68AS 1.3-45E7 4.0-25E3-5.0 coconut alkyl dimethyl ethoxy 1.4 1.0 ammonium chloride citrates 5.0 3.0Na-SKS-6-11.0 Wessalith CSs 15.0 15.0MA/AA 4.0 4.0DETPMP 0.4 0.4PB1 15.0-percarbonate-15.0TAED 5.0 5.0 terre vertes 10.0 5.0HMWPEO-0.1 xyloglucan enzymes 0.05 0.05 proteinase-10 .02 0.01 lipase 0.02 0.01 starch acid 0.01 0.005 cellulase 0.001-silicate 3.0 5.0 carbonate 10.0 10.0 granular suds suppressing agent 1.0 4.0CMC 0.2 0.1 water/a small amount of component

Preparation is according to synthetic bar fabric detergent composition of the present invention:

I II III IV C26 AS 20.00 20.00 20.00 20.00 CFAA, 5.0 5.0 5.0 5.0 LAS (C11-13) 10.0 10.0 10.0 10.0 sodium carbonate 25.0 25.0 25.0 25.0 sodium pyrophosphates 7.0 7.0 7.0 7.0 STPP 7.0 7.0 7.0 7.0 Wessalith CSs, 5.0 5.0 5.0 5.0 CMC, 0.2 0.2 0.2 0.2 polyacrylates (MW 1400) 0.2 0.2 0.2 0.2 coconut oil single ethanol amides 5.0 5.0 5.0 5.0 xyloglucan enzymes 0.05 0.05 0.05 0.05 amylase 0.01--0.005--proteinase-10 .3-0.5 0.05 brightening agent, spices 0.2 0.2 0.2 0.2 CaSO4 1.0 1.0 1.0 1.0 MgSO4 1.0 1.0 1.0 1.0 water 4.0 4.0 4.0 4.0 fillers^*: surplus can be selected from easily for example CaCO of material to 100%* ₃, talcum, clay (kaolin, terre verte), silicate etc.

Sequence table (1) general information: (i) applicant: Convents, Andre C.

Moese, Rosa Laura (ii) invention exercise question: the laundry and cleaning combination (iii) sequence number that contain xyloglucanase enzymes: 18 (iv) mailing address:

(A) addressee: THE PROCTER ﹠ GAMBLE COMPANY

(B) street: 11810 East Miami River Road

(C) city: Ross

(D) state: OH

(E) country: USA

(F) ZIP:45061 (v) computer-reader form:

(A) bearer type: floppy disk

(B) computer: IBM PC compatible

(C) operating system: PC-DOS/MS-DOS

(D) software: PatentIn Release#1.0, Version #1.30 (vi) has application materials now:

(A) application number:

(B) applying date:

(C) classification: (viii) agent's information:

(A) name: Zerby, Kim Willm

(B) registration number: 32,323

(C) reference/number of putting on record: 6613P (ix) communication information:

(A) phone: (513) 627-2885

(B) fax: the information of (513) 627-0318 (2) SEQ ID NO:1: (i) sequence signature:

(A) length: 21 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:1:ATTCATTTGT GGACAGTGGA C 21 (2) SEQ ID NO:2: (i) sequence signature:

(A) length: 20 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:2:GTTGATCGCA CATTGAACCA 20 (2) SEQ ID NO:3: (i) sequence signature:

(A) length: 20 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:3:ACCCCAGCCG ACCGATTGTC 20 (2) SEQ ID NO:4: (i) sequence signature:

(A) length: 20 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:4:CTTCCTTACC TCACCATCAT 20 (2) SEQ ID NO:5: (i) sequence signature:

(A) length: 20 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:5:TTAACATCTT TTCACCATGA 20 (2) SEQ ID NO:6: (i) sequence signature:

(A) length: 20 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:6:AGCTTTCCCT TCTCTCCCTT 20 (2) SEQ ID NO:7: (i) sequence signature:

(A) length: 28 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:7:GCCACCCTGG CTTCCGCTGC CAGCCTCC 28 (2) SEQ ID NO:8: (i) sequence signature:

(A) length: 20 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:8:GACAGTAGCA ATCCAGCATT 20 (2) SEQ ID NO:9: (i) sequence signature:

(A) length: 20 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:9:AGCATCAGCC GCTTTGTACA 20 (2) SEQ ID NO:10: (i) sequence signature:

(A) length: 20 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:10:CCATGAAGTT CACCGTATTG 20 (2) SEQ ID NO:11: (i) sequence signature:

(A) length: 20 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:11:GCACTGCTTC TCTCCCAGGT 20 (2) SEQ ID NO:12: (i) sequence signature:

(A) length: 20 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:12:GTGGGCGGCC CCTCAGGCAA 20 (2) SEQ ID NO:13: (i) sequence signature:

(A) length: 20 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:13:ACGCTCCTCC AATTTTCTCT 20 (2) SEQ ID NO:14: (i) sequence signature:

(A) length: 19 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:14:GGCTGGTAGT AATGAGTCT 19 (2) SEQ ID NO:15: (i) sequence signature:

(A) length: 20 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:15:GGCGCAGAGT TTGGCCAGGC 20 (2) SEQ ID NO:16: (i) sequence signature:

(A) length: 21 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:16:CAACATCCCC GGTGTTCTGG G 21 (2) SEQ ID NO:17: (i) sequence signature:

(A) length: 347 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: the information of SEQ ID NO:17:AAAGATTCAT TTGTGGACAG TGGACGTTGA TCGCACATTG AACCAACCCC AGCCGACCGA 60 TTGTCCTTCC TTACCTCACC ATCATTTAAC ATCTTTTCAC CATGAAGCTT TCCCTTCTCT 120 CCCTTGCCAC CCTGGCTTCC GCTGCCAGCC TCCAGCGCCG CACACTTCTG CGGTCAGTGG 180 GATACCGCCA CCGCCGGTGA CTTCACCCTG TACAACGACC TTTGGGGCGA GACGGCCGGC 240 ACCGGCTCCC AGTGCACTGG AGTCGACTCC TACAGCGGCG ACACCATCGC TTGTCACACC 300 AGCAGGTCCT GGTCGGAGTA GCAGCAGCGT CAAGAGCTAT GCCAACG 347 (2) SEQ ID NO:18: (i) sequence signature:

(A) length: 294 base-pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: SEQ ID NO:18:CAGCATCTCC ATTGAGTAAT CACGTTGGTG TTCGGTGGCC CGCCGTGTTG CGTGGCGGAG 60 GCTGCCGGGA GACGGGTGGG GATGGTGGTG GGAGAGAATG TAGGGCGCCG TGTTTCAGTC 120 CCTAGGCAGG ATACCGGAAA ACCGTGTGGT AGGAGGTTTA TAGGTTTCCA GGAGACGCTG 180 TATAGGGGAT AAATGAGATT GAATGGTGGC CACACTCAAA CCAACCAGGT CCTGTACATA 240 CAATGCATAT ACCAATTATA CCTACCAAAA AAAAAAAAAA AAAAAAAAAA AAAA 294

Claims (12)

1. one kind comprises one or more show the enzyme of special endoglucanase activity to xyloglucan laundry or cleaning products.

2. according to the laundry or the cleaning products of claim 1, the wherein said enzyme that xyloglucan is shown special endoglucanase activity is selected from undefined enzyme:

i ) DNA ( a ) ATTCATTTGT GGACAGTGGA C ( SEQ ID No：1 ) ( b ) GTTGATCGCA CATTGAACCA ( SEQ ID NO：2 ) ( c ) ACCCCAGCCG ACCGATTGTC ( SEQ ID NO：3 ) ( d ) CTTCCTTACC TCACCATCAT ( SEQ ID NO：4 ) ( e ) TTAACATCTT TTCACCATGA ( SEQ ID NO：5 ) ( f ) AGCTTTCCCT TCTCTCCCTT ( SEQ ID NO：6 ) ( g ) GCCACCCTGG CTTCCGCTGC CAGCCTCC ( SEQ ID NO：7 ) ( h ) GACAGTAGCA ATCCAGCATT ( SEQ ID NO：8 ) ( i ) AGCATCAGCC GCTTTGTACA ( SEQ ID NO：9 ) ( j ) CCATGAAGTT CACCGTATTG ( SEQ ID NO：10 ) ( k ) GCACTGCTTC TCTCCCAGGT ( SEQ ID NO：11 ) ( l ) GTGGGCGGCC CCTCAGGCAA ( SEQ ID NO：12 ) ( m ) ACGCTCCTCC AATTTTCTCT ( SEQ ID NO：13 ) ( n ) GGCTGGTAG TAATGAGTCT ( SEQ ID NO：14 ) ( o ) GGCGCAGAGT TTGGCCAGGC ( SEQ ID NO：15 ) ( p ) CAACATCCCC GGTGTTCTGG G ( SEQ ID NO：16 ) ( q ) AAAGATTCAT TTGTGGACAG TGGACGTTGA TCGCACATTGAACCAACCCC AGCCGACCGATTGTCCTTCC TTACCTCACC ATCATTTAAC ATCTTTTCAC CATGAAGCTTTCCCTTCTCTCCCTTGCCAC CCTGGCTTCC GCTGCCAGCC TCCAGCGCCG CACACTTCTGCGGTCAGTGGGATACCGCCA CCGCCGGTGA CTTCACCCTG TACAACGACC TTTGGGGCGAGACGGCCGGCACCGGCTCCC AGTGCACTGG AGTCGACTCC TACAGCGGCG ACACCATCGCTTGTCACACCAGCAGGTCCT GGTCGGAGTA GCAGCAGCGT CAAGAGCTAT GCCAACG ( SEQ ID NO：17 ) ( r ) CAGCATCTCC ATTGAGTAAT CACGTTGGTG TTCGGTGGCCCGCCGTGTTG CGTGGCGGAGGCTGCCGGGA GACGGGTGGG GATGGTGGTG GGAGAGAATGTAGGGCGCCG TGTTTCAGTCCCTAGGCAGG ATACCGGAAA ACCGTGTGGT AGGAGGTTTA TAGGTTTCCAGGAGACGCTGTATAGGGGAT AAATGAGATT GAATGGTGGC CACACTCAAA CCAACCAGGTCCTGTACATACAATGCATAT ACCAATTATA CCTACCAAAA AAAAAAAAAA AAAAAAAAAAAAAA ( SEQ ID NO：18 )

Ii) this enzyme is to by i) in definition dna sequence encoding and be obtained from microorganism Aspergillus aculeatus, the antibody that the high purifying endo-dextranase of CBS101.43 produces is immunoreactivity and xyloglucan is had specificity.

3. according to the laundry or the cleaning products of claim 1 or 2, the wherein said enzyme that xyloglucan is shown special endoglucanase activity shows the cellulose matrix of other non-xyloglucans and is lower than 75% activity, more preferably less than 50% activity, most preferably be lower than 25% activity.

4. according to laundry or the cleaning products of arbitrary claim 1-3, the wherein said enzyme that xyloglucan is shown special endoglucanase activity has the activity (XGU/BGU) of the relative beta-glucan of xyloglucan, the activity of the relative carboxymethyl cellulose of xyloglucan (XGU/CMCU), or the activity of the Microcrystalline Cellulose of the relative acid-swellable of xyloglucan (XGU/AVIU), it is preferably greater than 50, more preferably greater than 75.

5. according to laundry or the cleaning products of arbitrary claim 1-4, it also comprises laundry or cleaning combination component, is selected from detersive surfactant, detergency enzymes, washing assistant, SYNTHETIC OPTICAL WHITNER and its mixture.

6. according to laundry or the cleaning products of arbitrary claim 1-5, wherein detergency enzymes is selected from proteolytic enzyme, amylase, lipase, cellulase and their mixture.

7. according to laundry or the cleaning products of arbitrary claim 1-6, wherein washing assistant is selected from zeolite, phosphoric acid salt and their mixture.

8. according to laundry or the cleaning products of arbitrary claim 1-7, wherein SYNTHETIC OPTICAL WHITNER is selected from perborate, percarbonate and their mixture, preferably also comprises bleach-activating agent.

9. according to laundry or the cleaning products of arbitrary claim 1-8, wherein tensio-active agent is selected from anion surfactant, preferred alkyl vitriol and/or linear alkyl sulfonate surfactant, cats product, nonionogenic tenside and their mixture.

10. the method for a laundering of textile fabrics, described method comprise fabric that needs are cleaned with contain significant quantity one or more aqueous solution that xyloglucan shows the enzyme of special endoglucanase activity is contacted, preferably contact with the aqueous solution according to the composition of arbitrary claim 1-9.

11. the method for cleaning disc and tableware, this method comprise dish that needs are cleaned or tableware with contain significant quantity one or more aqueous solution that xyloglucan shows the enzyme of special endoglucanase activity is contacted, preferably contact with the aqueous solution according to the composition of arbitrary claim 1-9.

12. according to the method for the cleaning disc and the tableware of claim 11, wherein said method is carried out in the automatic dishwashing machine.