CN1376204B - Flex seed specific promoters - Google Patents

Abstract

Novel methods for the expression of non-native genes in flax seeds and the seeds of other plant species are provided. The methods involve the use of seed-specific promoters obtained from flax. Additionally provided are novel flax seed-specific promoters, chimeric nucleic acid constructs comprising novel flax seed-specific promoters, transgenic plant cells, transgenic plants and transgenic plant seeds containing novel flax seed-specific promoters. The promoters and methods are useful, for example, for altering the seed oil and protein composition in flax seed or other plant seeds.

Description

Flex seed specific promoters

Invention field

The present invention relates to be used to change the plant genetic engineering method of plant seed composition, more particularly, the present invention relates to from flax, obtain, and can instruct the promotor of non-natural expression of gene in flex seed and other plant seed.

Background of invention

Flax or Semen Lini (Linum usitataissimum) are the important oil grain crops of economically valuable.Oleum lini and powder are the valuable starting material that obtain from flex seed.Another kind has the starting material of economic worth, and flax fiber is to obtain from the stem of this plant.The oleum lini component can be used for non-edible purpose, for example be used to make varnish and oil plant, and the new variety that are called Linola by new cultivation, many edible product have been can be used for making recently, as butter and salad oil and seasonings (Green (1986) " Can.J.Plant Sci. ", 66 volumes: the 499-503 page or leaf).Flax powder at first can be used as the composition in the feed of ruminating animal, and flax fiber can be used for making the linen textiles.Understood the Economic Importance of flax as the starting material source, consider the performance on the agricultural, for example: seed production, to pathogenic agent and cryogenic resistance, with the raw-material output and the quality that are suitable in the post-treatment application, further improveing and distinguish available flax crop needs.Though confirm as exploitation Linola kind, by traditional plant breeding, flax kind that obtains improveing is possible, but because the time that needs is long, develop good agricultural plants strain need be in plant breeding great amount of investment, the genetically engineered plant technology allow directly from incoherent kind isolated genes and with these transgenosis in good agronomy background, thereby reduce the new needed time of kind of exploitation significantly.In addition, genetically engineered plant allow to be produced under the nature situation product such as the therapeutical agent that can not obtain from flax.

In order to develop new flax kind by genetically engineered plant, external source or non-natural expression of gene that control imports are crucial.Purposes according to the plant lines of developing, the non-natural expression of gene feature that needs, in non-natural expression of gene water, the specified time of the specified plant tissue of non-natural genetic expression or organ and plant life non-natural genetic expression in the cycle is to change.For example, the oil that changes seed is formed low-level ground of the enzyme seed-specific expression that may need seed development early to participate in the interim fatty acid metabolism.(referring to for example: United States Patent (USP) 5,420,034).On the other hand, gather in the crops the leaf of this plant, the expression of medical protein may preferably need high-caliber leaf specific expressed.(referring to for example, United States Patent (USP): 5,929,304).

In order to control non-natural expression of gene feature, can utilize many factors.Factor is the selection of the transcripting promoter that utilized.Effectively the compatible promotor of plant is a lot of at present, in detail some in the promotor of document record comprise composition promotor such as 35-SCaMv promotor (people such as Rothstein, (1987) " gene " 53 volumes: the 153-161 page or leaf), and ubiquitin promoter (United States Patent (USP) 5,614,399), tissue-specific promoter such as seed specific promoters, as phaseolin promoter (people such as Sengupta-Gopalan, (1985), the 3320-3324 page or leaf) and inducible promoters PNAS USA 82 volume:, as heat (people such as Czarneacka, (1989), " molecular cytobiology ", 9 (8): the 3457-3464 page or leaf), UV-light, inductor and wound (people such as Lois, (1989) EMBO is (6) J.8: the 1641-1648 page or leaf), or chemicals such as endogenous hormones (people (1991) such as Skriver, institute of NAS newspaper, 88 (16) volumes: derivable those promotors 7266-7270 page or leaf). for non-natural expression of gene feature in the controlling plant, available other factor comprises transcribes modifying factor as intron, polyadenylation site and Transcription Termination site. the factor that non-natural expression of gene feature can further be utilized influence translation as, the codon bias that ribosome bind site and host show is grasped. in addition, itself can influence the survival of transgenic plant the non-natural gene, thereby the expression level that restriction specifically can reach. in some cases, by being specific to the mode of tissue, as marking protein in leaf or seed, or owing to exist or lack the specific target sequence that protein can be delivered to different subcellular fractions and come limit protein matter at different subcellular fractions such as tenuigenin, accumulation in endoplasmic reticulum or the vacuole may can overcome this problem. and another factor that influence expression characteristic is that construct is with the seat that self inserts in the host chromosome. and the effect of this factor can provide about why the different plants with same recombinant precursor conversion can make the recombinant protein expression level that fluctuation is arranged.

Known to the inventor, the non-natural expression of gene is only on the books in PCT patent application WO 98/18948 in the flex seed.This application discloses two stearyls-acyl carrier protein desaturase (SAD) gene that obtains from flax.Relevant SAD promoter sequence can be used for modifying flax and other plant to express endogenous or foreign gene.It is non-seed specific in flax that but the method that WO 98/18948 is taught is subjected to the SAD promotor, and makes it at leaf, stem, the restriction of expressing in flower and the seed.So the non-natural expression of gene may produce unwanted side effect in non-seed tissue.In addition, utilize the SAD promotor to allow to control expression level and expression time limitedly.

So this area requires further improvement non-natural expression of gene method in flex seed and other plant seed.

Summary of the invention

The seed-specific expression method of non-natural gene in the plant that the present invention relates to improve.The present invention be more particularly directed to the method that has improved of the seed-specific expression of non-natural gene in flax.

So, on the one hand, the invention provides the expression method of the nucleotide sequence that needs in the flex seed, the method comprising the steps of:

(a) preparation contains chimeric nucleic acid construct as the following ingredients that is operably connected at 5 ' to 3 ' transcriptional orientation:

(1) seed specific promoters that from flax, obtains; With

(2) nucleotide sequence of Xu Yaoing, the nucleic acid of wherein said needs is non-natural for described flex seed specific promoters;

(b) described chimeric nucleic acid construct is imported the line cell; With

(c) described line cell being grown into can seed bearing sophisticated line, and the nucleotide sequence of wherein said needs is expressed in seed under described flex seed specific promoters control.

In embodiment preferred of the present invention, promotor gives at least one expression characteristic of non-natural nucleotide sequence, and the timing of expressing in the cycle as plant life is that the expression characteristic when giving the natural acid sequence is similar.In other embodiment preferred, flex seed specific promoters is the oleosin promotor, 2S storage protein promotor or class legumin seed storage protein promotor.

In others, the invention provides the transgenosis flex seed of the method that comprises following step:

(a) preparation contains chimeric nucleic acid construct as the following ingredients that is operably connected at 5 ' to 3 ' transcriptional orientation:

(1) seed specific promoters that obtains from flax; With

(2) nucleotide sequence of Xu Yaoing, the described nucleic acid that wherein needs is non-natural for described seed specific promoters;

(b) in the line cell, import described chimeric nucleic acid construct; With

(c) make described line cell grow into can long seed sophisticated line, the nucleotide sequence of wherein said needs is under the control of described seed specific promoters, expresses in seed.

In embodiment preferred of the present invention, at least a promotor gives the expression characteristic of non-natural nucleotide sequence, and for example: in the life cycle of plant, the timing of expression is that the expression characteristic when giving the natural acid sequence is similar.In other embodiment, flex seed specific promoters is the oleosin promotor, 2S storage protein promotor or class legumin seed storage protein promotor.

In yet another aspect, the invention provides the transgenosis flex seed for preparing according to following method:

(a) the chimeric nucleic acid construct of the composition that is operably connected below containing at 5 ' to 3 ' transcriptional orientation of preparation:

(1) seed specific promoters that obtains from flax; With

(2) nucleotide sequence of Xu Yaoing, the nucleic acid of wherein said needs is non-natural to described seed specific promoters;

(b) described chimeric nucleic acid construct is imported the line cell; With

(c) described line cell being grown into can seed bearing ripe line, and the nucleotide sequence of wherein said needs is under the control of described seed specific promoters, expresses in seed.

On the other hand, the invention provides by the preparation of following method can seed bearing line:

(a) the chimeric nucleic acid construct of the preparation composition that can be operatively connected below containing at 5 ' to 3 ' transcriptional orientation:

(1) seed specific promoters that obtains from flax; With

(2) nucleotide sequence of Xu Yaoing, the nucleic acid of wherein said needs is non-natural to described seed specific promoters;

(b) described chimeric nucleic acid construct is imported the line cell; With

(c) described line cell being grown into can seed bearing ripe line, and the nucleotide sequence of wherein said needs is expressed in seed under the control of described seed specific promoters.

On the other hand, the invention provides and be used for flex seed and other floristic seed non-natural expression of gene, for example be used for the protein of seed or the new flex seed specific promoters of the modification that oil is formed.

In preferred embodiments, seed specific promoters comprises:

(a) as Fig. 1 (SEQ.ID.NO.:1), Fig. 2 (SEQ.ID.NO.:4), the nucleotide sequence shown in Fig. 3 (SEQ.ID.NO.:6) or Fig. 4 (SEQ.ID.NO.:8), wherein T also can be U;

(b) with the nucleotide sequence of (a) nucleic acid array complementation;

(c) have with (a) or the nucleotide sequence of the basic sequence homology of nucleotide sequence (b);

(d) be (a), (b) or the nucleotide sequence of nucleotide sequence analogue (c);

(e) with (a), (b), (c) or the nucleotide sequence of under stringent hybridization condition, hybridizing of nucleotide sequence (d).

On the other hand, the invention provides the chimeric nucleic acid sequence that contains first nucleotide sequence that obtains from flax that is operably connected with second nucleotide sequence that to described first nucleotide sequence is non-natural, wherein said first nucleotide sequence contains new flex seed specific promoters.

Other features and advantages of the present invention can easily be understood from following detailed description.But, should be appreciated that, because the technician in the field of this circumstantial letter can understand the variations and modifications in the spirit and scope of the present invention, so when expression the preferred embodiments of the invention, only the mode by explanation has provided detailed description and specific embodiment.

Brief description of drawings

The present invention is described below with reference to the accompanying drawings, wherein:

Fig. 1 has represented the dna sequence dna of flax genomic clone of coding 16.0kDa oleosin (SEQ.ID.NO.:2 and 3), (SEQ.ID.NO.:1).

The dna sequence dna (SEQ.ID.NO.:4) of flax genomic clone of Fig. 2 presentation code 18.6kDa oleosin (SEQ.ID.NO.:5).

The dna sequence dna (SEQ.ID.NO.:6) of flax genomic clone of Fig. 3 presentation code 2S storage protein (SEQ.ID.NO.:7).

The dna sequence dna (SEQ.ID.NO.:8) of flax genomic clone of Fig. 4 presentation code 54.5kDa class legumin storage protein (SEQ.ID.NOS:9-12).

Fig. 5 has represented the Southern engram analysis result with flax genomic dna of flax oil protein D NA sequence detection.

Fig. 6 has represented the result to the Northern engram analysis of the proteic seed-specific expression of flax oil.

Fig. 7 has represented the result of the Northern engram analysis that proteic growth is expressed to oleum lini matter in the seed development process.

Fig. 8 has represented the GUS activity with flax embryo of flax oil protein promoter-GUS-flax terminator gene construct bombardment.

Fig. 9 has represented to express with the developmental flax embryo and the GUS in the Arabidopsis seed of 2S protein gene promotor GUS syzygy plant transformed.

The tissue specific expression of GUS in the transgenosis line that Figure 10 represents to transform with karyophan promotor-GUS-karyophan terminator gene construct.

The temporary transient expression of GUS in the transgenosis line that Figure 11 has represented to transform with karyophan promotor-GUS-karyophan terminator gene construct.

Figure 12 is illustrated in the expression of GUS in the transgene rape plant (L1 is to L9) that transforms with karyophan promotor-GUS-karyophan terminator gene construct.

Figure 13 has represented the expression with transgenic arabidopsis platymiscium GUS in the different times of seed development of karyophan promotor-GUS-karyophan terminator gene construct conversion.

Detailed description of the present invention

Mention as mentioned, the present invention relates in the plant, particularly the modification method of the expression of non-natural gene in flax. The invention provides the method that allows the seed-specific expression of non-natural gene in flax. The advantage of method of the present invention is to have obtained the better control to the expression of non-natural gene in the flex seed. The expression of non-natural gene is confined to seed, therefore, has limited in other plant organ or tissue and has expressed the potential unsatisfactory impact that produces. In addition, the method that provides allows to control better expression characteristic, such as the expression timing of expression and development of plants non-natural gene in the cycle of non-natural gene. Method of the present invention is particularly useful, because according to the present invention, with valuable raw material such as oil, the seed that protein is relevant with polysaccharide forms and can change in amount and property.

Therefore, in one aspect, the invention provides the method for expressing the nucleotide sequence that needs in flex seed, method comprises step:

(a) preparation contains the chimeric nucleic acid construct of the composition that is operably connected at 5 ' to 3 ' transcriptional orientation;

These compositions have:

(1) seed specific promoters that obtains from flax; With

(2) nucleotide sequence that needs, the nucleic acid of wherein said needs is non-natural for described flex seed specific promoters;

(b) in the line cell, import described chimeric nucleic acid construct; With

(c) described line Growth of Cells being become can seed bearing maturation plant, and the nucleotide sequence of wherein said needs is to express in seed under the control of described flex seed specific promoters.

As used herein, term " non-natural " refers to any nucleotide sequence, comprises any RNA or dna sequence dna, and this sequence does not combine with the seed specific promoters normal condition. This nucleotide sequence comprises the heterologous nucleic acid sequence that obtains from the floristics that is different from promoter, and the homologous nucleotide sequence that obtains from the floristics that is same as promoter, but the promoter of these nucleotide sequences and wild type (non-transgenic) plant is irrelevant.

When being connected with the seed specific promoters that obtains from flax, the non-natural nucleotide sequence has produced the chimeric construct body. Will the chimeric construct body import and produce transgenosis line cell in the line cell, compare the line cell of obvious different manifestations type or the line that therefrom grows into thereby produced with non-transgenic line cell or the line that therefrom grows into. In non-conversion line cell or the line that therefrom grows into, do not exist nucleotide sequence with the chimeric construct body identical in abutting connection with nucleotide sequence. At this on the one hand, those sequences that chimeric nucleic acid sequence comprises contain flax promoter, is connected with the nucleotide sequence that obtains from another floristics, or with from flax, but with being connected of this promoter be abnormal nucleotide sequence connection. The sequence that further comprises of chimeric nucleic acid sequence contains flax promoter and normally is connected with this promoter but also contains the nucleotide sequence of non-natural nucleotide sequence as used herein. For example, if promoter is flex seed specific oleosin promoter, be the sequence that the sequence of " non-natural " also comprises the fusion between the coded sequence that contains with the natural linseed oil plasmagene that is connected of oily promoter and the needs that are connected with this promoter non-natural to flax oil protein promoter. The term non-natural also refers to contain fusion above, and this gene contains the cutting sequence of the gene of separating the nucleotide sequence that normally is connected with promoter sequence and the protein of encoding needs in addition.

Term " nucleotide sequence " refers to contain naturally occurring base, the sequence of the nucleotides of the key of (side chain) or nucleoside monomers between sugar and the sugar. This term also comprises and contains monomer that the non-natural of bringing into play identity function exists or sequence modification or that replace of its part. Nucleotide sequence of the present invention can be ribonucleic acid (RNA) or DNA (DNA), and can contain naturally occurring base, comprises adenine, guanine, cytimidine, thymine and uracil. Sequence also can contain modified base, such as xanthine, and hypoxanthine, the 2-aminoadenine, 6-methyl, 2-propyl group, with other alkyl adenine, 5-halogen uracil, 5-halogen cytimidine, the 6-azauracil, 6-nitrogen cytosine and 6-azathymine, pseudouracil, the 4-thiouracil, 8-halogen adenine, 8-aminoadenine, 8-mercaptan adenine, 8-sulfanyl adenine, 8-hydroxyadenine and other 8-substituting group adenine, 8-halogen guanine, the amino guanine of 8-, 8-mercaptan guanine, 8-sulfanyl guanine, 8-hydroxyl guanine and other 8-substituting group guanine, other nitrogen and denitrogenation uracil, thymidine, cytimidine, adenine, or guanine, 5-trifluoromethyl uracil and 5-three Flucytosines.

Term " seed specific promoters " refers to gene predominant expression in vegetable seeds of expressing under the control of this promoter, and does not express in other plant tissue or do not have substantive the expression, typically is less than 5% of whole expression.

In other side, the invention provides the new flex seed specific promoters that in flex seed and other floristic seed, is used for expressing the non-natural gene. These promoters can be used for modifying for example protein of seed, oil or composition of Salvia polysaccharide. In preferred embodiments, seed specific promoters comprises:

(a) such as Fig. 1 (SEQ.ID.NO.:1), Fig. 2 (SEQ.ID.NO.:4), the nucleotide sequence shown in Fig. 3 (SEQ.ID.NO.:6) or Fig. 4 (SEQ.ID.NO.:8), wherein T also can be U;

(b) with the nucleotide sequence of (a) nucleic acid array complementation;

(c) with (a) or the affiliated nucleotide sequence of nucleotide sequence (b) with basic sequence homology;

(d) be (a), (b) or the nucleotide sequence of the analog of nucleotide sequence (c); Or

(e) with (a), (b), (c) or the nucleotide sequence of under stringent hybridization condition, hybridizing of nucleotide sequence (d).

Term " sequence with basic sequence homology " refers to (a) or the sequence (b) is compared those nucleotide sequences slight or inessential sequence variation are arranged, and these sequences play a role in essentially identical mode and can drive the seed-specific expression of non-natural nucleotide sequence. These variations may be because local sudden change or structural modification. Nucleotide sequence with basic homology comprises with Fig. 1 (SEQ.ID.NO.:1), Fig. 2 (SEQ.ID.NO.:4), nucleotide sequence shown in Fig. 3 (SEQ.ID.NO.:6) or Fig. 4 (SEQ.ID.NO.:8) has 65% at least, more preferably at least 85%, the nucleotide sequence of the homogeneity of 90-95% most preferably.

Term " sequence of hybridization " refer to can be under stringent hybridization condition with (a), (b), (c) or the nucleotide sequence of sequence hybridization (d). Promote the suitable stringent hybridization condition of DNA hybridization " be well known by persons skilled in the art, perhaps can be at " molecular biology ", John Wiley and Sons, New York (1989) are found in the general scheme among the 6.3.1-6.3.6. For example, can utilize following condition: 6.0 * sodium chloride/sodium citrate (SSC), about 45 ℃, then wash with 2.0 * SSC in 50 ℃. Condition according to the washing step utilization can be selected strict degree. For example, can strictly spend from height: about 0.2 * SSC, 50 ℃ of lower salinity of selecting in the washing step. In addition, the temperature in the washing step can be under about 65 ℃ high strict degree condition.

Term " as the nucleotide sequence of analog " refers to and (a), (b) or sequence (c) compare, modified nucleotide sequence, modification does not wherein change the purposes of aforesaid sequence (namely as seed specific promoters). Sequence or the analog modified may have than (a), (b) or the better characteristic of the sequence (c). An example modifying the preparation analog is with base such as the xanthine modified, hypoxanthine, 2-aminoadenine, the 6-methyl, 2-propyl group and other alkyl adenine, 5-halogen uracil, 5-halogen cytimidine, 6-azauracil, 6-nitrogen cytosine and 6-azathymine, pseudouracil, 4-thiouracil, 8-halogen adenine, the 8-aminoadenine, 8-mercaptan adenine, 8-mercaptan alkyl adenine, 8-hydroxyadenine and other 8-substituting group adenine, 8-halogen guanine, the amino guanine of 8-, 8-mercaptan guanine, 8-mercaptan alkyl guanine, 8-hydroxyl guanine and other 8-substituting group guanine, other nitrogen and denitrogenation uracil, thymidine, cytimidine, adenine, or guanine, 5-trifluoromethyl uracil and 5-three Flucytosines replace Fig. 1, Fig. 2, a naturally occurring base of the sequence shown in Fig. 3 or Fig. 4 (namely, adenine, guanine, cytimidine or thymidine).

Another example of modifying is to be included in Fig. 1, Fig. 2, the phosphate backbone in the nucleic acid molecules shown in Fig. 3 or Fig. 4, phosphorus or the oxygen heteroatom of the modification in the key between key or short chain hetero atom or heterocycle sugar between short-chain alkyl or cycloalkyl sugar. For example, nucleotide sequence can contain thiophosphate, phosphotriester, methyl phosphonate, and phosphorodithioate.

Another example of nucleic acid molecules analog of the present invention is peptide nucleic acid (PNA), wherein use to peptide in the similar polyamide skeleton found replace deoxyribose (or ribose) phosphate backbone (P.E.Nielsen among the DNA (or RNA), Deng the people, " science " 1991,254 volumes, 1997). The PNA analog shown the degraded to enzyme have resistance and in vivo with external life with prolongation. Owing to lack electrical charge rejection between PNA chain and DNA chain, PNA is also stronger with the combination of the dna sequence dna of complementation. Other nucleic acid analog can contain and has main polymer chain, ring-type main chain, or the nucleotides of acyclic main chain. For example, nucleotides can have morpholine backbone structure (U.S. Patent number, 5,034,506). Analog also can contain group, and such as reporter group, one is improved the pharmacokinetics of nucleotide sequence or the group of medicine dynamic behaviour.

In yet another aspect, the invention provides chimeric nucleic acid sequence, contain first nucleotide sequence that obtains from flax that is operably connected with second nucleotide sequence, wherein second nucleotide sequence is non-natural to described first nucleotide sequence, and wherein said first nucleotide sequence contains new flex seed specific promoters. Preferably, promoter is from Fig. 1, Fig. 2, the nucleotide sequence of selecting in the group of the promoter of Fig. 3 and Fig. 4 or hybridize with their under stringent condition.

According to the present invention, chimeric nucleic acid sequence can be mixed the recombinant expression carrier that can guarantee to have good expression in seed cell with known method. Therefore, the present invention includes the recombinant expression carrier that contains the chimeric nucleic acid sequence of the present invention that is suitable in seed cell, expressing.

Term " is suitable for expressing in seed cell " and refers to that recombinant expression carrier contains chimeric nucleic acid sequence of the present invention, regulatory region and terminator, be to select according to the seed cell that is used for expressing, it functionally is connected with the nucleotide sequence of the polypeptide that the amino acid that coding needs forms. Functionally connecting the chimeric nucleic acid sequence that refers to coded polypeptide is connected with the terminator that is connected to express in seed cell with the adjusting sequence. Typical construct in 5 ' to 3 ' direction by the regulatory region of finishing with the promoter that can instruct the expression in the plant, polypeptid coding area and in plant cell the transcription termination region of performance function form. These constructs can prepare according to the method known to the skilled of biology field (referring to such as the people such as Sambrook, (nineteen ninety), " molecular cloning " second edition, cold spring port publishing house). Can relate in the preparation of construct such as restriction digestion, connect gel electrophoresis, the technology such as dna sequencing and PCR. Many cloning vectors are to carry out necessary clone's step can adopt. That be specially adapted to this purpose is cloning vector such as pBR322 with the dubbing system of performance function in Escherichia coli, pUC series, M13mp series, pACYC184, pBluescript etc. Nucleotide sequence can be imported these carriers, and these carriers can be used for transformed into escherichia coli, Escherichia coli can grow in suitable culture medium. Behind results and dissolved cell, can from cell, reclaim plasmid. Last construct can import the plant vector that is suitable for being integrated into plant, such as Ti and Ri plasmid.

The method of expressing the non-natural gene according to the present invention in flex seed can utilize any flex seed specific promoters to implement and the restriction of the concrete flex seed specific promoters do not selected. In preferred embodiment of the present invention, flex seed specific promoters give the non-natural nucleotide sequence at least one give the expression characteristic of natural acid sequence similar or identical expression characteristic with natural promoter. As used herein, term " expression characteristic " refers to that flex seed specific promoters gives any detectable characteristic or the effect of the nucleotide sequence that is operably connected with flex seed specific promoters. So, in preferred embodiments, the non-natural nucleotide sequence the timing that plant life was expressed in the cycle be with the natural acid sequence in the expression timing similar or identical. In other preferred embodiment, the expression of heterologous nucleic acid sequence is similar or identical with the expression of natural acid sequence. In other specific embodiment, the change of non-natural gene pairs illumination condition, the change of wavelength or luminous intensity, the for example change of temperature, tissue injury, chemical reagent be the reaction of the change in concentration of plant hormone and pesticide for example, is to like the reacting phase of these stimulations with the natural acid sequence. Other expression characteristic that needs that flex seed specific promoters gives can be those skilled in the art recognize that, and therefore can be selected flex seed specific promoters.

Can comprise and seed storage protein such as all albumins and globulin by flex seed specific promoters used according to the invention, comprise the promoter that vicilin is relevant with the class legumin, and and seed storage protein, such as the incoherent seed specific promoters of oleosin. What other needed especially is and fatty acid metabolism, such as acyl carrier protein (ACP), and saturated enzyme, desaturase extends the relevant promoter of enzyme etc.

In preferred embodiment of the present invention, used seed specific promoters is the oleosin promoter, class legumin seed storage protein promoter or 2S storage protein promoter. In particularly preferred embodiments, seed specific promoters has Fig. 1, Fig. 2, Fig. 3 or sequence shown in Figure 4 maybe can from flax obtain and under stringent condition with any nucleotide sequence of any hybridization of these four kinds of nucleotide sequences.

Can utilize other flex seed specific promoters according to the present invention. these promoters can obtain in many ways. after having separated flex seed protein, can partly check order, thereby the designing nucleic acid probe for the identification of seed specific RNA. in order further to increase the RNA relevant with seed specific, can prepare cDNA from seed cell, cDNA can cut from the mRNA of non-seed cell or the remaining seed cDNA of cDNA. and can be used to then complementary series to survey genome dna library. just can obtain subsequently with the sequence of cDNA hybridization, relevant promoter region also can separate. and it also is possible being used to from other floristic known seed specific genescreen the genome dna library from the flex seed tissue preparation and separating subsequently the promoter related of them. because seed storage protein is relatively rich the seed, it also is possible obtaining sequence information by random sequencing flex seed cDNA library. with the cDNA sequence that the sequence of known seed storage protein is complementary can be for the identification of relevant promoter. can seek the database that contains the sequence information that the order-checking from large-scale for example Arabidopsis and corn obtains to known seed specific protein and/or promoter, this information can be for the identification of the promoter sequence in the flax with sequence similarity. and the alternative approach of separating other flex seed specific promoters can be utilized, and those skilled in the art can find new flex seed specific promoters and used according to the invention.

The nucleotide sequence of the needs that are connected with promoter can be the nucleotide sequence of any needs, the peptide or the protein that comprise the coding needs, for example any RNA or the dna sequence dna of enzyme, or with the sequence of genome sequence complementation, wherein genome sequence can be at least a open read frame, introne, the non-coding targeting sequencing, or complementary series is wherein transcribed inhibition mRNA processing, for example any sequence of splicing or translation. The nucleotide sequence of these needs can synthesize, naturally origin or their combination. In addition, the nucleotide sequence that needs can be the fragment of native sequences, for example includes only the structure of catalytic domain or particular importance. The characteristic of nucleotide sequence as required, synthetic sequence with the preferred codon of plant may need. The preferred codon of plant can be determined in the codon that frequency is the highest from the protein of expressing with maximum the specified plant kind of needs.

Can the encode recombinant protein of any kind of the nucleotide sequence that needs, the example of the recombinant protein that can express by method of the present invention comprise the valuable protein that the protein with favourable catalysis maybe will run up to high level and extract when needing. Protein with catalysis includes, but are not limited to tie the protein of the new phenotypes of seed. New phenotype can comprise following modification: seed-protein or seed oil form or seed polysaccharide forms as changing, improve the production that needs product or characteristic that is pre-stored in, with utilize antisense, ribozyme or altogether inhibition technology reduce or even suppress unwanted gene outcome (Izant and Weintraub (1984) " cell " 26 volumes: 1007-1015 page or leaf, antisense; Hazelhoff and Gerlach (1988) " nature " 334 volumes: 585-591 page or leaf, ribozyme; The people such as Napoli (nineteen ninety) " plant cell " 2 volumes: the 279-289 page or leaf, suppress altogether).

Although can detect the cellular expression of change in different embryo tissues such as plumular axis and cotyledon, but still the protein that expectation needs is expressed in all embryo tissues. The nucleotide sequence that needs can be expressed in any period of seed development. The timing of expressing may be according to special-purpose of the present invention and difference. The expression of the enzyme that participation oil is modified may just need at the early stage of seed development, for example before the accumulation of seed storage protein.

Except promoter region and the nucleotide sequence of needs, the nucleotide sequence that can stop transcribing is also included within the expression vector usually. Transcription terminator preferably is about 200 to 1,000 nucleotide base pair, any such sequence that can contain performance function in plant, such as the nopaline synthase terminator (people such as Bevan, (nineteen eighty-three) " nucleic acids research " 11 volumes: the 369-385 page or leaf), the Kidney bean albumen terminator (people such as Van der Geest, (1994) " plant magazine " 6 (3): the 413-423 page or leaf), the terminator of the octopine synthase gene of Agrobacterium tumefaciens or other are similarly brought into play the element of function. These transcription termination regions can be such as An (1987), " Enzymology method " 153 volumes: 292 pages of described obtaining, or Already in from commercial sources such as ClonTech, Palo Alto is in the plasmid that California obtains. The selection of suitable terminator may be influential to transcription rate.

The chimeric construct body can further contain just like the AMV leader (Jobling and Gehrke (1987), " nature " 32 volume: the enhancer 622-625 page or leaf) or introne. the design that it should be understood that expression vector can be according to the factor as the type of Plants types choice and/or polypeptide to be expressed and difference.

Also will contain marker gene under the expression vector normal condition. Marker gene comprises can distinguish all genes of transformed plant cells and non-transformed cell, comprises the marker gene that can select and can screen. For convenience, mark can be for herbicide such as sweet ammonia phosphorus or phosphorus silk rhzomorph, or for the kanamycins of antibiotic such as the characteristic that gives can select by chemical method, G418, bleomycin, hygromycin, the resistance marker of chloramphenicol etc. The mark that can screen can be used for observing the evaluation transformant. They include but not limited to β-glucuronidase or uidA gene, beta-lactamase gene or green fluorescent protein matter (people's (nineteen ninety-five) Plant Cell Rep. such as Niedz; 14 volumes: 403 pages).

In order to import nucleotide sequence in vegetable cell, usually, the technician can utilize various technology.Agrobacterium-mediated line cell transformation has had report, though other various technology (referring to following) import the chimeric DNA construct at flax cell in the time of also can needing being used for, roll up according to Dong and McHughen (1993) " plant science " 88: 61-77 page or leaf professor's method can obtain flax transformant.

The conversion line of cultivating according to conventional agriculture practice known to those skilled in the art is that permission is seed bearing.Thereby can obtain flex seed, and the characteristic that has changed with respect to wild type seeds of analyzing that it needs from sophisticated line.

Can make two generations or more, comprise the generation recombinant polypeptide thereby can identify plant and strain with the phenotype feature that needs for plant-growth and hybridization or selfing.The homozygosity that guarantees plant can hereditaryly continuously need to guarantee the reorganization characteristic.The method of the plant that selection is isozygotied is the known to the skilled of field of plant breeding, comprises samsara self-pollination and selection and flower pesticide and microspores culture.By transforming haploid cell or tissue, then breed the monoploid plantlet, change into diplont by any known the whole bag of tricks (for example, handling) subsequently and also can obtain the plant of isozygotying with colchicine or other microtubule lytic reagent.

The present invention can comprise that also described method comprises according to the transgenosis flex seed of following method preparation:

(a) prepare the chimeric nucleic acid construct that contains the following composition that is operably connected on 5 ' to the 3 ' transcriptional orientation:

(1) seed specific promoters that obtains from flax; With

(2) nucleotide sequence of Xu Yaoing, the nucleic acid of wherein said needs is non-natural to described seed specific promoters;

(b) in the line cell, import described chimeric nucleic acid construct; With

(c) described line cell being grown into can seed bearing ripe line,

The nucleotide sequence of wherein said needs is to express in seed under the control of described seed specific promoters.

In embodiment preferred of the present invention, seed specific promoters is the group from flex seed specific promoters, comprises 2S storage protein promotor, glb promoter, select in oleosin promotor and the class legumin seed storage protein promotor.Fig. 1 (SEQ.ID.NO.:1), Fig. 2 (SEQ.ID.NO.:4) has represented specific promoter sequence among Fig. 3 (SEQ.ID.NO.:6) and Fig. 4 (SEQ.ID.NO.:8).

What the present invention further provides can be enough following method preparation can seed bearing line:

(a) preparation contains the following chimeric nucleic acid construct that is operatively connected composition at 5 ' to 3 ' transcriptional orientation:

(1) seed specific promoters that obtains from flax; With

(2) nucleotide sequence of Xu Yaoing, the described nucleic acid that wherein needs is non-natural to described seed specific promoters;

(b) in the line cell, import described chimeric nucleic acid construct; With

(c) make described line cell grow into the seed bearing ripe line of energy,

The nucleotide sequence of wherein said needs is to express in seed under the control of described seed specific promoters.

The present invention further provides Fig. 1 (SEQ.ID.NO.:1), Fig. 2 (SEQ.ID.NO.:4), the using method of the new promotor shown in Fig. 3 (SEQ.ID.NO.:6) and Fig. 4 (SEQ.ID.NO.:8) in the floristics beyond flax.Therefore, the present invention also comprises and containing from Fig. 1, Fig. 2, the preparation of the chimeric nucleic acid construct of promotor of selecting in the group of Fig. 3 and promotor shown in Figure 4 and the nucleotide sequence that needs, with with the seed-specific method, with the nucleotide sequence of needs in the floristics beyond flax and under the control of flax promotor, express.

In another aspect of this invention, provide the method for expressing the nucleotide sequence that needs in plant seed, this method comprises:

(a) preparation contains the chimeric nucleic acid construct of the following composition that is operably connected at 5 ' to 3 ' transcriptional orientation:

(1) seed specific promoters of from the group of the seed specific promoters that is grouped into by following one-tenth, selecting:

(i) Fig. 1 (SEQ.ID.NO.:1), Fig. 2 (SEQ.ID.NO.:4), the nucleotide sequence shown in Fig. 3 (SEQ.ID.NO.:6) or Fig. 4 (SEQ.ID.NO.:8), wherein T also can be U;

(ii) with the nucleotide sequence of the nucleic acid array complementation of (i);

The (iii) nucleotide sequence that has the basic sequence homology with (i) or nucleotide sequence (ii); With

(iv) be (i), (ii) or the nucleotide sequence of the analogue of nucleotide sequence (iii);

(v) with (i), (ii), (iii) or nucleotide sequence (iv), the nucleotide sequence of hybridize under stringent condition; With

(2) nucleic acid of described needs;

(b) the chimeric nucleic acid construct is imported vegetable cell;

(c) described plant cell growth being become can seed bearing maturation plant; The nucleotide sequence of wherein said needs is to express in seed under the control of described seed specific promoters.

For with nucleotide sequence, particularly DNA imports plant host cell, can utilize various technology usually, for example, can utilize as people such as Moloney (1989) Plant Cell Rep.; 8 volumes: people's (1988) " biotechnology " such as 238-242 page or leaf or Hinchee 6 volumes: the described conversion scheme of 915-922 page or leaf, or other technology well known by persons skilled in the art, utilize the standard soil bacillus carrier, the chimeric DNA construct can be imported from dicotyledons, as tobacco with produce the kind of oil, the host cell that obtains as colea (Brassica napus).For example, utilize the T-DNA transformed plant cells to carry out extensive studies and, people such as Hoekema, (1985 years) at EP 0 120 516, the V chapter: " binary plant vector system " Offset-drukkerij Kanters BV, Alblasserdam) in; People such as Knauf, (nineteen eighty-three), " genetic analysis of the host expresses of edaphic bacillus ", 245 pages, " the interactional molecular genetics of bacterium-plant ", and Puhler, A edits, Springer-Verlag, center, New York; With people such as An, (1985), " EMBO magazine ", 4 volumes: fully narration the 277-284 page or leaf).Edaphic bacillus transforms and also can be used for transforming monocots kind (United States Patent (USP) 5,591,616).

For convenience, utilizing Agrobacterium tumefaciens or hair root edaphic bacillus to cultivate explant can make and transcribe construct and shift into plant host cell.After utilizing edaphic bacillus to transform, vegetable cell is dispersed in the suitable substratum selects, reclaim callus then, stem and final plant.The edaphic bacillus host cell will contain plasmid, and this plasmid contains transfers to the necessary vir gene of vegetable cell with T-DNA.In order to inject and electroporation (referring to as follows), can will remove Ti-plasmids (the shortage oncogene), particularly T-DNA district of arm) can import vegetable cell.

The utilization of non-agrobacterium technology allows to utilize conversion and the expression of construct acquisition as herein described in many unifacial leaves and dicotyledons kind. and these technology are particularly useful for unmanageable floristic conversion in the edaphic bacillus conversion system. and other technology of transgenosis comprises particle bombardment (Sanford, (1988), " biotechnology trend " 6 volumes: 299-302 page or leaf, electroporation (people such as Fromm, (1985), " institute of NAS newspaper ", 82 volumes: 5824-5828 page or leaf; Riggs and Bates, (1986), " institute of NAS newspaper ", 83 volumes: the 5602-5606 page or leaf), the DNA of PEG mediation absorbs (people such as Potrykus, (1985), " molecular gene genetics ", 199 volumes: the 169-177 page or leaf), microinjection (people such as Reich, " biotechnology " (1986) 4 volume: the 1001-1004 page or leaf) and siloxanes carbide filament (people's (nineteen ninety) PlantCell Rep. such as Kaeppler, 9 roll up: the 415-418 page or leaf).

In other specific application, as in colea, as people such as Moloney, (1989) Plant Cell Rep., 8 volumes: the 238-242 page or leaf is described, and being hit the host cell of accepting the recombinant DNA construction body by target will be that petiole from cotyledon obtains usually.Utilization has other example of the oily seed of commercial use to be included in (the people such as Hinchee of transformant leaf in the soybean explant, (1988) " biotechnology ", the 6:915-922 page or leaf) and the stem of cotton transform (people such as Umbeck, (1987) " biotechnology ", 5 volumes: the 263-266 page or leaf).

After conversion, cell, for example blade is grown on the selection substratum.In case stem begins to occur, and just they is downcut, and is placed on the substratum of long root.After forming enough roots, plant is transferred in the soil.Then, test the existence of mark in the conversion plant of inferring.Utilize suitable probe that genomic dna is carried out the Southern engram analysis, show in the genome that is incorporated into host cell.

Method provided by the invention can be used in combination with large-scale floristics.Particularly preferred vegetable cell used according to the invention comprises the cell from following plants: soybean (Glycinemax), rape (Brassica napus, Brassica campestris), Sunflower Receptacle (Helianthus annuus), cotton (Gossypium hirsutum), corn (Zea mays), tobacco (Nicotiana, tobacum), clover (Medicago Sativa), wheat (Triticumsp.), barley (Hordeum vulgare), oat (Avena Sativa L.), Chinese sorghum (Sorghumbicolor), Arabidopis thaliana (Arabidopsis thaliana), potato (Solanum sp.), flax/Semen Lini (Linum usitatissimum), safflower (Carthamus tinctorius), oil palm (Eleais guineeis), Semen arachidis hypogaeae (Arachis hypogaea), Brazil's nut (Bertholletia excelsa), coconut (Cocus nucifera), castor-oil plant (Ricinuscommunis), coriander (Coriandrum sativum), pumpkin (Cucurbita maxima), shrub (Simmondsia chinensis) and paddy rice (Oryza sativa).

The present invention has various uses; comprise by the polypeptide that changed of accumulation or new recombinant peptide or by introducing or remove the metabolism step; improve the inherent value of plant seed. utilize the present invention may cause (for example improving proteinic quality; increase essential or rare amino acid whose concentration); form the raising liquid mass by modifying fat; or the carbohydrate composition of improveing or increasing. example comprises that rich sulfoprotein matter is as in the seed that lacks at sulfur-containing amino acid; the expression of those rich sulfoprotein matter of in Lupinus albus or Brazilian nut, finding. the improvement of protein quality also can be passed through indispensable amino acid; comprise Methionin; halfcystine; the expression of methionine(Met) and tryptophane rich in protein or protein fragments realizes. perhaps; can express the fatty acyl group coenzyme A; a kind of transferring enzyme that can change the ratio of lipid acid in the triglyceride level (storage fat). in seed, allow in the situation of accumulation recombinant protein; protein also can be the peptide with pharmacy or industrial value. in this case; can from seed, extract peptide; if it is and suitable to desired use; can crude product or the form utilization of purifying. same; polypeptide expressed can be the fragment or the derivative of natural protein in seed. pharmaceutically useful protein can comprise; but be not limited to antithrombotics; as r-hirudin; antibody; comprise monoclonal antibody and antibody fragment; vaccine; cytokine or somatomedin such as ox somatomedin; cholinergic differentiation factor (CDF); ciliary neurotrophic factor (CNTF); fibroblast growth factor (FGF); the long factor of sashimi (raw fish); gonad-stimulating hormone; granulocyte colony-stimulating factor (G-CSF); granulocyte-macrophage colony stimutaing factor (GM-CSF); human growth hormone; interferon alpha (IFN-α); interferon beta (IFN-β), interferon-gamma (IFN-γ), interleukin-11-α (IL1-α); interleukin-11-β (IL1-β); interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4); interleukin-5 (IL-5); interleukin-6 (IL-6), interleukin-10 (IL-10), leukaemia inhibitory factor (LIF); Trx; macrophage colony stimulating factor (M-CSF), myelomonocyte somatomedin, nerve growth factor (NGF); oncostatin M; thrombocyte origin somatomedin (PDGF), prolactin antagonist, transforming growth factor-alpha (TGF-α); transforming grouth factor beta 2 (TGF-β 2); tumor necrosis factor alpha (TNF-α), tumor necrosis factor (TNF-β). the protein of pharmaceutical use also can comprise mammalian proteins matter, for example; but be not limited to α-1-antitrypsin; anti-obesity proteins, blood protein, collagen protein; collagenase; elastin, elastoser, erepsin; Fibrinogen; oxyphorase, human serum albumin, Regular Insulin; lactoferrin, myohaemoglobin and pulmonary surfactant protein.

There is the peptide of industrial use may include, but are not limited to α-Dian Fenmei or other amylase, amyloglucosidase, arabanase, catalase, cellobiohydrolase, cellulase, chitinase, Quimotrase, desaturase, endo-dextranase, rennin, interior Galactanase, esterase, beta-galactosidase enzymes, alpha-galactosidase or other tilactase, gastric lipase enzyme, dextranase, glucose isomerase, hemicellulase, lytic enzyme, isomerase, ligninase, lipase, lyase, N,O-Diacetylmuramidase, oxydase, oxydo-reductase, papoid, polygalacturonase, pectin lyase, peroxidase, Phosphoric acid esterase, phytase, proteolytic enzyme, Starch debranching enzyme, reductase enzyme, seryl proteolytic enzyme, Trx, transferring enzyme, trypsinase, and zytase.

Following unrestricted embodiment is explanation of the present invention:

Embodiment

Embodiment 1

The separation of seed-specific flax promotor

Seed specific cDNA clone is separated to from flex seed specific cDNA library.With these cDNA cloning and sequencings, utilize other sequence in Basic Local Alignment Search Tool (BLAST) these sequences of comparison and public database such as the gene pool.This finds that relatively the aminoacid sequence of the supposition of several isolating cDNA and oleosin low and high molecular weight classification, the storage protein of 2S-albumin and class legumin have the similarity of height.Respectively from the coding oleosin, the cDNA of the storage protein of 2S albumin and class legumin partly prepares probe, and the genomic library that utilizes these probe screenings to prepare from flax strain Forge, this strain is the (people such as Anderson of isozygotying for four rust resistance genes, (1997), " vegetable cell " 9 volumes: the 641-651 page or leaf).After highly strict screening, identify several positive λ clone for each probe.The fragment subclone be will insert and plasmid vector pBluescript and order-checking advanced.Sequence information discloses, and we have been separated to oleosin in the genome, albuminous considerable part of 2S and cDNA class legumin cDNA.Fig. 1 to 4 has represented to contain the high and lower molecular weight oleosin isoform of coding, the sequence information of the genomic clone of the albuminous sequence of 2S and class legumin gene respectively.

Fig. 1 and SEQ.ID.NO.:1 have represented the dna sequence dna of flax genomic clone of coding 16.0kDa oleosin (lower molecular weight or L-isoform). and the regulatory element of supposition has obtained identifying and indicating. and these regulatory elements comprise that reversing repeats (base pair 805 to 813 and 821 to 829; Base pair 1858 to 1866 and 1877 to 1885), repeat (base pair 184 to 193 and 1102 and 1111 in the same way; Base pair 393 to 402 and 1701 to 1710; Base pair 683 to 692 and 1546 to 1555; Base pair 770 to 781 and 799 to 810; Base pair 955 to 964 and 1936 to 1945; Base pair 1483 to 1496 and 1513 to 1526), xitix response element (ABRE) (base pair 1859 to 1866), CACA box (base pair 1933 to 1936), TATA box (base pair 1925 to 1931) and CAT box (base pair 3020 to 3025). open reading-frame (ORF) be interrupt with 1 short intron (mark) and 2 exons turned over the pool, and IUPAC single-letter amino acid code is represented.

Fig. 2 and SEQ.ID.NO.:4 have represented the dna sequence dna of flax genomic clone of the oleosin (high molecular or H-isoform) of coding 18.6kDa.The regulatory element of inferring is identified and has been indicated.These elements comprise repetition (base pair 14-25 and 1427-1438 in the same way; Base pair 80-89 and 1242-1251; Base pair 177-186 and 837-846; Base pair 1281-1290 and 1242-1251; Base pair 1591-1600 and 1678-1287).This open reading-frame (ORF) is not interrupted by intron, has translated and has represented with IUPAC single-letter amino acid code.

Fig. 3 and SEQ.ID.NO.:6 have represented the dna sequence dna of flax genomic clone of coding 2S storage protein.Nucleotide sequence analysis to this clone shows that it has 174 amino acid whose open reading-frame (ORF)s, and these amino acid show with plant 2S storage protein group homology.This sequence encoding and wild cabbage (Brassica oleracea) 2S storage protein has 38% global similarity, comprises conservative fully open reading-frame (ORF) of one section rich L-glutamic acid sequence QQQGQQQGQQQ (SEQ.ID.NO.:13).In addition, 2S storage protein gene promotor contains the modulator promoter element of several suppositions.These elements comprise repetition (the base pair 25-36 of rich AT, 97-108 and 167-190), the similar repetition of RY (base pair 240-247), G-box-like (base pair 274-280), the similar motif of seed-specific box (base pair 285-290) and TATA box (base pair 327-333).

Fig. 4 and SEQ.ID.NO.:8 have represented the dna sequence dna of flax genomic clone of the class flax legumin seed storage protein of coding 54.4kDa.This class legumin seed storage protein gene also can be described as " karyophan ".With the aminoacid sequence of the supposition of karyophan gene and class legumin protein from R.Communis, from the legumin precursor of M.salicifolia.Q.robur and G.hirsutum, and relatively from the 12S seed storage protein of A.thaliana from the gluten precursor of O.Sativa.The karyophan gene show with from R.Communis, M.salicifolia, Q.robur, G.hirsutum, the corresponding proteins matter of O.Saliva and A.thaliana has 59/15,47/16 respectively, sequence identity/the similarity of 50/17,45/17,43/18 and 43/18 percentage ratio.The regulatory element of the supposition in promoter region is identified and is indicated.These elements comprise that reversing repeats (base pair 265 to 276 and 281 to 292; Base pair 513 to 524 and 535 to 545), repeat (base pair 1349 to 1360 and 1367 to 1378; Base pair 1513 to 1529 and 1554 to 1572), xitix response element (ABRE) (base pair 1223 and 1231), legumin box (RY repetition) (between base pair 1223 and 1231), possible vicilin box district (base pair 1887 to 1894), CAAT box (base pair 1782 to 1785) and TATA box (base pair 1966 to 1970).Equally, indicated the signal peptide (base pair 2034-2080) that is used for ER film guiding.Open reading-frame (ORF) is with 3 short introns (being labeled) interruption, and 4 exons are translated and represent with the IUPAC single-letter amino acid code.

Fig. 5 has represented the Southern engram analysis of flax genomic dna.Separated 60 μ g flax genomic dnas from leaf, with EcoRI (swimming lane 1), HindIII (swimming lane 2) and BamHI (swimming lane 3) digest, and load on separately the swimming lane.A) usefulness guides at random ³²The 3TcDNA of P-mark (high molecular flax oleosin isoform) is hybridized.B) usefulness guides at random ³²The 7R cDNA of P-mark (lower molecular weight oleosin isoform) is hybridized.The result proves, 3T (high molecular oil albumen isoform) and 7R (lower molecular weight oleosin isoform) oleosin cDNA and the hybridization of flax genomic dna.More particularly, these results show that 3T seemingly represents the 2-copy gene in flax, and is seen as two bands in every digestion swimming lane.As if equally, 7R has represented a plurality of gene families in flax, because every digestion swimming lane all detects a plurality of bands.

Embodiment 2

The seed-specific expression of flax oleosin gene

Fig. 6 has represented the Northern engram analysis to the proteic seed-specific expression of flax oil. the Northern hybridization of two kinds of oleosin mRNA in different tissues. from different tissues, R, root; C, cotyledon; L, leaf; S, the seed pod membrane; E, embryo extract the total RNA. of 10 μ g with the cDNA (identical with the encoding sequence shown in Fig. 2) of (A) coding high molecular (H)-isoform and (B) cDNA (identical with the encoding sequence shown in Figure 1) detection membrane of coding lower molecular weight (L) isoform. and two kinds of transcripts are only expressed in embryo and the seed pod membrane that contains embryo.

Embodiment 3

The growth of oleum lini matter protein gene is expressed in the seed development process

Fig. 7 has represented the Northern engram analysis that proteic growth is expressed to oleum lini matter in the seed development process.Load the total RNA of 15 μ g in each swimming lane on agarose/formaldehyde gel, and on Hybond N+ film trace.10J: use ³²Flax oleosin cDNA clone (lower molecular weight isoform) of P dCTP mark surveys this film.Be the fate (DPA) after flowering period each period of expression.3T) total RNA of loading 15 μ g in the every swimming lane on agarose/formaldehyde gel, and trace on the Hybond N+ film.3T: use ³²Flax oleosin cDNA clone (high molecular isoform) of P dCTP mark surveys this film.Transcript was expressed in the phase very early of growing (6DPA, early cotyledon period).Express maximum 16 to 20DPA (late cotyledon period), and in 22DPA (sophisticated embryo), express decline.

Embodiment 4

When the adjusting of regulating sequence at flax oleosin is controlled following time, the instantaneous seed-specific expression of β-glucuronidase (GUS)

Utilize the Protocols in Molecular Biology (for example referring to: people such as Sambrook, (nineteen ninety), " molecular cloning ", second edition, cold spring port press) of standard, comprise restriction enzyme digestion, connect and polymerase chain reaction (PCR) prepares two constructs.

Construct pSC54: will be placed on from the β-glucuronidase reporter gene encoding sequence in carrier GUSN358＞S (Clontech laboratory) between the terminator sequence of the promoter sequence of Nucleotide 21 to 1852 and Nucleotide 2395 to 3501 (as shown in Figure 1).This insertion fragment cloning advances pBluescript, and the carrier that obtains is called pSC54.

Construct pSC60: will be positioned over from the encoding sequence of the β-glucuronidase reporter gene in carrier GUSN 358＞S (Clontech laboratory) between the terminator sequence of the promoter sequence of Nucleotide 1 to 2023 and Nucleotide 2867 to 3925 (as shown in Figure 2).This insertion fragment cloning is advanced pBluescript, and the carrier that obtains is called pSC60.

Utilize standard scheme to carry out particle bombardment (for example referring to people such as Abenes (1997) PlantCell Rep.; 17 volumes: the 1-7 page or leaf) with pSC54, a pSC60 and a promoterless GUS construct (contrast) import flax embryo.That has measured when Fig. 8 has represented after particle bombardment 48 hours use pSC54, the GUS activity of flax embryo that pSC60 and no promotor GUS construct bombard.As visible, flax oleosin is regulated the expression that sequence is enough to start GUS in flax embryo.

Embodiment 5

When controlling following time in the adjusting of flax 2S storage protein gene promotor, the stable seed-specific expression of β-glucuronidase in flax and the Arabidopis thaliana (GUS)

As follows, will mix no promotor-GUSpBI101 preparing carriers GUS reporter gene construct from 5 ' and 3 ' district of the described dna fragmentation of Fig. 3.

Primer (having represented the position in Fig. 3) below having utilized will carry out pcr amplification from the amplicon of 5 ' of the described dna fragmentation of Fig. 3 terminal 400bp:

5 ' primer (1): 5 '-TCCACTATGTAGGTCATA-3 ' is (SEQ.ID.NO.:14)

3 ' primer (1): 5 '-CTITAAGGTGTGAGAGTC-3 ' is (SEQ.I.NO.:15)

The PCR primer also contains the restriction site of HindIII and BamHI, can be used for 5 ' the UTR amplicons cloned of 400bp is entered GUS reporter gene front, in the HindIII/BamHI site of pBI101 carrier. the primer (having represented the position in Fig. 3) below utilizing, will carry out pcr amplification from the amplicon of the 736bp in 3 ' the untranslated district (3 ' UTR) of the described dna fragmentation of Fig. 3:

5 ' primer (2): 5 '-AGGGGTGATCGATTA-3 ' is (SEQ.ID.NO.:16)

3 ' primer (2): 5 '-GATAGAACCCACACGAGC-3 ' is (SEQ.ID.NO.:17)

These PCR primers also contain the restriction site of SacI and EcoRI.Cut out the NOS terminator of pBI101 carrier with SacI/EcoRI digestion, and alternative with 3 ' the UTR amplicon of the 736bp of the similar digestion of the described dna fragmentation of Fig. 3.

Then, according to foregoing scheme, GUS reporter gene construct electroporation is advanced Agrobacterium tumefaciens strains A GL1 and carry out flax (people such as Finnegam, the 625-633 page or leaf) and intend the angle mustard and belong to that (people's " institute of NAS newspaper " such as Valvekens, 85 roll up: the conversion 5536-5540 page or leaf) (1993) " molecular biology of plants " 22 (4):.

The various mensuration of carrying out the active sign of GUS on the histology that are organized in that will have the flax and the Arabidopsis plant of GUS reporter gene construct.In flax, the leaf tissue that will from the seed of growing, cut out, root tissue and medium sophisticated embryo all dye and are used for the GUS determination of activity.For Arabidopsis, the seed of growing is carried out original position GUS dyeing in silique.

Various tissues are immersed in the X-gluc that contains 0.5mM, 0.5M potassium phosphate buffer (pH7.0), 1mM EDTA, the 0.5M Sorbitol Powder in histological chemistry's damping fluid of the Tripotassium iron hexacyanide of 0.5mM and the yellow prussiate of potash of 0.5mM, carries out GUS dyeing.Under 37 ℃, carried out staining reaction 12-16 hour, add 95% ethanol termination reaction.In 95% ethanol, clean the chlorophyll of removing in the tissue subsequently repeatedly, take a picture again.Fig. 9 has represented that the significantly strong active sign of GUS is arranged in flax embryo of growing and Arabidopsis seed, and at root or the leaf of flax, or the sign that does not have tangible GUS reporter gene to express in the wall of Arabidopsis silique.

Embodiment 6

When the adjusting of regulating sequence at flax class legumin storage protein gene is controlled following time, flax, the stable seed-specific expression of β-glucuronidase in Arabidopsis and the colea (GUS)

Utilize the Protocols in Molecular Biology of standard, comprise restriction enzyme digestion, connection and polymerase chain reaction (PCR) can prepare construct.In order to obtain in being suitable for the configuration that is connected with the GUS encoding sequence, containing dna fragmentation, utilized the approach of PCR-based from about 2,000 bases of 5 ' transcription initiation region of class flax legumin seed storage protein.Comprising the accurate sequence of utilizing the PCR amplification expression analysis to need.In order to carry out necessary pcr amplification, synthesize two oligonucleotide primers (Beckman Oligo 1000M DNA synthesizer), they have following sequences:

5 ' primer: 5 ' TA TCTAGA 3 ' (SJ-634) (SEQ.ID.NO.:18)

The base pair of italic is answered is Nucleotide 1 to 21 in the sequence of reporting among Fig. 4.Other 5 ' Nucleotide in this sequence in primer is different with promoter sequence, but for an XbaI site being placed on 5 ' end of amplified production, these Nucleotide are also included within wherein.XbaI site (5 '-TCTAGA-3 ') is a underscoring (SEQ.ID.NO.:19).

Second (3 ') primer of synthetic has following sequence:

3 ' primer: 5 ' 3 ' (SJ-618) (SEQ.ID.NO.:20)

This primer contains the accurate complement (representing with italic) of the sequence of the base of reporting among Fig. 4 2343 to 2363.(5 '-CCATGG-3 ') (SEQ.ID.NO.:21) crossed over initiation codon between the base pair 2034 and 2039 because natural NcoI site, so this primer is not to design with additional restriction enzyme sites, thereby allow the storage protein promotor to insert suitable cloning vector.

These two primers are used for pcr amplification reaction, have produced to contain and have the XbaI site and apart from the dna fragmentation of the sequence between 1 and 2342 Nucleotide of the flex seed storage protein gene in the NcoI site of 3 ' terminal 302 base pairs at 5 ' end.Utilize the condition of enzyme manufacturers suggestion and 94 ℃ (sex change) 1 minute, 55 ℃ (annealing) 1 minute and 72 ℃ of (extension) temperature program(me)s of 3.5 minutes utilize enzyme Pfu (Strategene) to carry out pcr amplification.Template is the legumin seed storage protein genomic clone that Fig. 4 represents.

Subsequently, the amplified production that obtains with XbaI and NcoI digestion is to pipette the 2kb promoter region that needs.This promoter fragment is cloned the XbaI and the NcoI site of the plasmid of the XbaI of pGUS1318 of into name and NcoI digestion, (cut plasmid pGUSN358S (Clontech laboratory) and GUS is inserted fragment cloning advance to be used for to contain the pBluescript KS+ (Strategene) in NcoI site in multiple clone site with NcoI and EcoRI.The plasmid that contains promotor-GUS syzygy that obtains is called pPGUS1318.Increased from the terminator of the legumin seed storage protein of flax equally from genomic clone above-mentioned.In order to carry out necessary pcr amplification, synthesized oligonucleotide primer with following sequence:

5 ' primer: 5 ' GC AAGCTTAATGTGACGGTGAAATAATAACGG 3 ' (SJ620) (SEQ.ID.NO.:22)

The italic base is corresponding to nucleotide position 3780 to 3803 in the sequence of Fig. 4 report.Other 5 ' Nucleotide of this sequence in the primer is different with promoter sequence, but places a HindIII site for 5 ' end at amplified production, and these Nucleotide are included in wherein.Rule below (SEQ.ID.NO.:23) in HindIII site (5 '-AAGCTT-3 ').

Second (3 ') primer of synthetic has following sequence:

3 ' primer: 5 ' TA GGTACCTGGCAGGTAAAGACTCTGCTC3 ' is (SEQ.ID.NO.:.24) (SJ-618)

This primer contains the accurate complement (representing with italic) of sequence of the base 4311 to 4290 of Fig. 4 report.Other 5 ' Nucleotide of this sequence in the primer is different with promoter sequence, but places a KpnI site for 5 ' end at amplified production, and these Nucleotide also comprise wherein.KpnI site (5 '-GGTACC-3 ') is a underscoring (SEQ.ID.NO.:25).

These two primers are used for pcr amplification reaction, produce and to contain the dna fragmentation that has the sequence between the Nucleotide 3779 and 4311 of flex seed storage protein gene terminator that HindIII site and 3 ' end have the KpnI site at 5 ' end.The amplification that utilizes PCT as mentioned above.Digest the pPGUS1318 carrier of the top promotor that contains amplification with XhoI, and handle the end of a passivation of generation with Klenow.Use the KpnI digested vector subsequently, top amplification terminator sequence is inserted, make it be positioned at 3 ' end of GUS encoding sequence.What obtain contains flax storage protein promotor, and the carrier of GUS and flex seed storage protein terminator is called pPGUST.

The XbaI-KpnI that will contain the pPGUST of karyophan promotor-GUS encoding sequence-karyophan terminator sequence inserts fragment and connects into XbaI-KpnI site from edaphic bacillus binary plasmid pPZP221 deutero-carrier pSBS3000 (people such as Hajdukiewicz; (1994); " molecular biology of plants "; the 25:989-994 page or leaf). in pSBS3000; the plant gentamicin resistant gene that replaces pPZP221 with celery ubiquitin promoter-phosphinothricin acetyltransferase gene-celery ubiquitin terminator sequence; to give resistance to weedicide (careless ammonium phosphine). the carrier that obtains is called pSBS2089. in addition; the XbaI-KpnI that will contain the pPGUST of karyophan promotor-GUS encoding sequence-karyophan terminator sequence inserts fragment and connects into XbaI-KpnI site (MacBride and the Summerfield of edaphic bacillus binary plasmid pCGN1559; nineteen ninety; " molecular biology of plants "; 14 volumes: 269-276 page or leaf; given resistance to the microbiotic gentamicin). the carrier that obtains is called pSBS2083. and plasmid pSBS2089 and pSBS2083 are entered edaphic bacillus bacterial strain EHA101. edaphic bacillus bacterial strain EHA101 (pSBS2089) by electroporation is used to transform flax and Arabidopsis; edaphic bacillus bacterial strain EHA101 (pSBS2083) is used to transform colea. except on the L-phosphinothricin of 10 μ M rather than kantlex, selecting the transgenosis stem; flax transforms basically as Jordan and McHughen (1988), and Plant Cell Rep.7 volume: the 281-284 page or leaf is described to carry out.Except the transgenic plant of selecting to infer on the agarose plate of the L-phosphinothricin that contains 80 μ M, it is as " Arabidopsis scheme basically that Arabidopsis transforms; Method in the molecular biology " 82 volumes, carry out described in Martinez-Zapater JM and the Salinas J.ISBN 0-89603-391-0pg 259-266 (1988).Colea transforms basically as people such as Moloney, and (1989) Plant Cell Rep.8 volume: the 238-242 page or leaf is described to carry out.

Figure 10 has represented the tissue specific expression of GUS in the transgenosis line that transforms with karyophan-gus gene construct (pSBS2089) at root (R), and stem (S) detects GUS and expresses in the leaf (L), bud (B) and embryo (E).More visible expression in bud, and maximum expression is in the embryo tissue.In any unconverted (WT) tissue, do not see detectable expression.

Figure 11 has represented the temporary transient expression of GUS in the transgenosis line that transforms with karyophan-gus gene construct (pSBS2089).Just as can be seen, maximum expression is arranged in sophisticated (pre-dry) flax embryo.

Figure 12 has represented the absolute expression of the GUS in the transgenosis colea plant (L1 is to L9) that transforms with karyophan-gus gene construct (pSBS2083).As being seen, high-caliber expression is arranged in the colea plant.When comparing each transgenic plant, also can see because the typical change in the expression that position effect produces.

Figure 13 has represented in the seed development process that transgenic arabidopsis belongs to the expression of the GUS in the silique (transforming with karyophan-gus gene construct (pSBS2089)).Just as can be seen, in the Arabidopsis seed tissue, also can obtain high-caliber expression.Reach maximum expression in period 4 of seed development (ripe but do not have complete drying).At non-seed tissue, as leaf, stem is not observed detectable expression (result does not represent) in root and the silique wall.

Although reference is thought preferred embodiment at present and has been narrated the present invention, should should be understood that the present invention is not limited to disclosed embodiment.On the contrary, the present invention will cover various variations that comprise in the spirit and scope of additional claim and the modification arrangement that is equal to.

The degree that all publications, patent and patent application are incorporated herein by reference with their integral body and point out every piece of independent publication particularly and individually, patent or patent application are identical with the degree that its integral body is incorporated herein by reference.

Sequence table

<110>Chaudhary，Sarita

van?Rooijen，Gijs

Moloney，Maurice

Singh，Surinder

SemBioSys?Genetics?Inc.

Commonwealth?Scientific?and?Industrial?Research?Organisation

＜120〉flex seed specific promoters

<130>9369-147

<140>

<141>

<150>60/151044

<151>1999-08-27

<150>60/161,722

<151>1999-10-27

<160>25

<170>PatentIn?Ver.2.0

<210>1

<211>4305

<212>DNA

＜213〉flax

<400>1

ttcaaaaccc?gattcccgag?gcggccctat?tgaagatatg?ggggaagttc?gacgagatcg?60

atgtcgggtc?gagtgctatg?gtgatggtgc?cgtttggggg?gaggatgagc?gagatagcca?120

agactagcat?tccgttccca?cacagagttg?ggaatttgta?ccaaatccaa?cacttgtcgt?180

attggagcga?cgatagggac?gcggaaaaac?acatccgttg?gatcagggag?ttgtacgatg?240

atctcgagcc?ttatgtgtcg?aagaatccga?ggtatgctta?cgtgaactac?agggatctcg?300

acatcgggat?gaatggagga?ggtgaagggg?atgagaaggg?tacttatggt?gaggctaagg?360

tgtgggggga?gaagtacttt?ggggtcaact?ttgatcggtt?ggttcgggtg?aagacgattg?420

ttgatcccaa?taatgtgttt?cgaaacgagc?agagcattcc?ctcaattcca?actcggttat?480

aaggatcaat?gatcaatgag?aattttcctt?tccaatgtga?ttacaagttc?tattgggtca?540

gctttctcaa?ctgctcctat?tcatttagat?taattcataa?caactattaa?tttaccagcc?600

ttttatccgg?cccgttggcc?gatttatttt?cttaagtttt?agatgaaatg?aaaccgattt?660

agtttttatt?gagatgagat?taatcttaat?ttgcttgaaa?tttactcacg?gttgatgtga?720

tatttggaat?taactaaaat?gataaatatc?ggataaaaat?aaaaatattt?aaaataaata?780

acataaacat?aagaacaata?aaataaataa?atttaatttt?aatttatttc?cttgttttct?840

ttctgtatca?tacatctctt?ctcttacttc?ttaaaggctt?ttcaattatc?acttaattaa?900

atacaataga?taaatcgtta?attctataac?attaacctat?acacttgcac?ggtgaacaat?960

caatatgata?atataataat?aatataataa?ttcaattatt?aatctacaat?tttttaatta?1020

taaagtttat?gcggtcagtt?tctgcaagct?ccgagctcct?tgtcatcgtt?agtttctgcg?1080

gtctcaaggt?ataacgactc?ggagcgacga?gccctttgct?tccaatggac?gggttgcatt?1140

tctgccgtcg?ttgagctcga?ttggcgtgtc?atgctggagt?cagagttcct?acaaaaaaac?1200

cctaaactag?agggtgatta?gggtgaaatt?agggtgttgg?cctgggttcc?attgtccaaa?1260

gttttagtca?acttaaaaac?agacttaaat?tttatgcttc?aaaatagttt?atctgttatt?1320

atattagcgt?gtaattagtc?ttgacaatgg?ggccggacgg?gtacggattc?gggaccccga?1380

tccccgccca?tagtgtaatg?gctcaactgc?caagtcagca?ttggaccgaa?attattggac?1440

acgaagtact?aatgtgaaaa?actttacatt?tgttattttc?tactttaata?ctatgctatt?1500

ttcaaaattt?gaactttaat?actatgtttt?tatatagttt?agtatatctt?aatttttatg?1560

caaattcatc?taattgtatt?aaactatttt?cgatccgtag?ctaattattt?cgaaggcaag?1620

tcaaagtgtt?attgtggact?atgtgagcta?atattgaacc?tttatctctc?ccaaccactc?1680

aagttaattg?aaccaaactc?gatcggttgg?gtttcgagct?atttcgagcc?attgttgtta?1740

tatgcacgtg?agatatcaag?attgacccga?acactttatt?atgataatgt?agaaaaagaa?1800

aacatattct?aagactacat?gcatgcaaag?tgcaacccct?gcatggaaag?ctgctcaaca?1860

cgtggcatag?actcccgcca?cgtgtccatt?ccacctcatc?acctcacccc?caccgttcac?1920

ctcttattat?atcacaacaa?tcaatcaatc?ctactcctcc?atactcgaac?aaatccgacc?1980

aacttatacc?aatattccca?aacttgatta?atttctcagc?aatatggatc?agacgcacca?2040

gacatacgcc?ggaaccacgc?agaacccgag?ctatggcggc?gggggcacaa?tgtaccagca?2100

gcagcagccg?aggtcttacc?aggcggtgaa?ggcggccact?gcagccaccg?cgggtggatc?2160

cctcatcgtt?ctgtccggtc?tcatccttac?ggccaccgtc?atttcactca?tcatagccac?2220

ccctctcctt?gtcatcttca?gccctgttct?tgtcccggct?ctcatcaccg?tcgggctctt?2280

gatcaccggg?tttcttgctt?ccggtgggtt?cggagtcgcc?gccgtcaccg?tcttgtcctg?2340

gatctatagg?tatgtataag?ctttggactt?tagtattgtt?ataaaataca?taagctgatt?2400

tatgaacatg?gatctcccaa?caagagttat?ttaaatgcat?tctcggtctg?actcgatcgg?2460

ttgggttttg?agctactcgg?tcacaatggt?cgggtcggct?ctggatctgt?tatactaata?2520

tttggaagcc?tgaagtttca?ttgttctgcc?ccaacttccc?actacctttt?gagggtgtta?2580

agaagccata?caaactaatt?atgaatccct?cccaacaact?cagaactcga?gtcagtgggt?2640

tgtgacggtt?ctctataaac?atttcgaaaa?tctttgttca?atgaacgtag?aaatgaccat?2700

gcttgatgat?tgtgggtctt?ataaggtacg?tgaccggcgg?gcacccggcg?ggaggggatt?2760

cgctggacca?ggctaggtcg?aagctggccg?gaaaggccag?ggaggtgaag?gacagggcgt?2820

cggagttcgc?acagcagcat?gtcacaggtg?gtcaacagac?ctcttaaaga?gagtcctcta?2880

gttaaattgg?tcttcgtttc?tgtttcgtgg?cggcttgtaa?actctctttt?aagtgtgctg?2940

ttttcctttt?gtctcgtgtg?ttgtaagtga?aagtgtaatc?gaagttccaa?gttggagatg?3000

tttgtaacga?tgatgttttc?taataatcag?agatattaaa?agggttgcta?atttagtatt?3060

gcgtctgatc?tcggaccaaa?ctcgcaagta?aaattgcaga?ggatgagttg?tacagaacaa?3120

gcgtgcattg?ttctggaagt?tcatctcctt?ggagccgacc?ttgttgcttg?cagtttcgcc?3180

aagtccacta?gacaatgtta?cgagttaagc?ctctgtcaaa?cagatcgctc?tagcgtccca?3240

gaaaacacca?gatttttcga?aaaccatcgg?ggatcaattt?tcgattcaat?tccgatcttg?3300

gaagtacttg?aacagaagca?tgatgctaaa?agataataga?aaatcgaagc?ctagaaaagt?3360

tgtacagaaa?gcaacaagtc?aaaaatatag?atcaacttca?aaggttcaaa?ttacatctta?3420

cagaccccaa?aaaatgacag?ttaacagaag?tcgactaaac?agaaaccagc?cagcttcacc?3480

tggaatgaag?gagctttgat?caatccatcc?tagcttcatt?cccctttgaa?attgcagaca?3540

gagctctcat?cctgctaaag?ctggtggctt?attcttaacc?ctgcaatcaa?taagcatgaa?3600

ctaacattgg?acaccttcat?cggcggattg?ctcgaaaatc?agtgagcgag?ggatttacct?3660

gtgtgtgtag?taacctctct?ccttgtacat?aaaatctgga?aattccggca?tcaactactg?3720

ccacctttct?gcttaaggtg?attttatcac?caaggctgag?cgtgattcct?tgcgtcttgc?3780

tccgaatcct?gatgtatcca?ctgagctttc?catctccttc?cttctccagg?cttatgttca?3840

ccaatgcgtc?ctcgccgaac?acactcttgg?cgtacaagtt?cgcagccagg?aatccacact?3900

ctccatcaag?tgcagacctg?caaaccccaa?ataagaacac?aaactccaaa?gtcaacgatc?3960

aattctccgc?cttttatgaa?gaaaaggaaa?cttctgggta?cttacggtgc?cgtcagacac?4020

ttcatatttg?tagacttgat?gatatggtcc?aggaattcct?tctcgttctg?aattgttgtg?4080

ttaacagcaa?cctgacagac?agaaagatat?cgcaaattta?agatactggg?atgactaggc?4140

acagagaaat?gaaatctaat?tctagaagta?aaaccttatt?ttcccattca?aattctgccc?4200

acatagtccg?gaacgcagca?tccgagcaag?aagcaggaga?gatgtaatcc?atgatatcga?4260

tgtggatatc?gttgaggacg?acaactgaac?gttccatcac?attgg 4305

<210>2

<211>109

<212>PRT

＜213〉flax

<400>2

Met?Asp?Gln?Thr?His?Gln?Thr?Tyr?Ala?Gly?Thr?Thr?Gln?Asn?Pro?Ser

1 5 10 15

Tyr?Gly?Gly?Gly?Gly?Thr?Met?Tyr?Gln?Gln?Gln?Gln?Pro?Arg?Ser?Tyr

20 25 30

Gln?Ala?Val?Lys?Ala?Ala?Thr?Ala?Ala?Thr?Ala?Gly?Gly?Ser?Leu?Ile

35 40 45

Val?Leu?Ser?Gly?LeuIle?Leu?Thr?Ala?Thr?Val?Ile?Ser?Leu?Ile?Ile

50 55 60

Ala?Thr?Pro?Leu?Leu?Val?Ile?Phe?Ser?Pro?Val?Leu?Val?Pro?Ala?Leu

65 70 75 80

Ile?Thr?Val?Gly?Leu?Leu?Ile?Thr?Gly?Phe?Leu?Ala?Ser?Gly?Gly?Phe

85 90 95

Gly?Val?Ala?Ala?Val?Thr?Val?Leu?Ser?Trp?Ile?Tyr?Arg

100 105

<210>3

<211>46

<212>PRT

＜213〉flax

<400>3

Tyr?Val?Thr?Gly?Gly?His?Pro?Ala?Gly?Gly?Asp?Ser?Leu?Asp?Gln?Ala

1 5 10 15

Arg?Ser?Lys?Leu?Ala?Gly?Lys?Ala?Arg?Glu?Val?Lys?Asp?Arg?Ala?Ser

20 25 30

Glu?Phe?Ala?Gln?Gln?His?Val?Thr?Gly?Gly?Gln?Gln?Thr?Ser

35 40 45

<210>4

<211>3501

<212>DMA

＜213〉flax

<400>4

tctagacatt?tgacataaac?cgaattcaaa?gaacacaaca?ttgactaaca?ccaaaaagaa?60

atagagtagt?gaaatttgga?agattaaaaa?atagaaacaa?actgattctt?agaaagaaga?120

gatgattagg?tgctttcagt?tcggtctgtc?aggaaatcga?gatgttcact?tatttacatt?180

gtcgattcat?ctcccaattg?tcctggttcc?tttactgtcc?gacgcttttt?tgaatcccag?240

ttaattccca?tcaagtcttc?cttcagctgc?gtagcactgc?tagctccaac?atggagcgtg?300

gagtctactc?gttcatgggg?catcgcaaag?gtttgccttc?atgttctgct?accagccagc?360

gcccaccgcc?tcttggttgt?gtggacaatt?gcggtgaagc?gcgcaagttg?acatcccata?420

gtctcgacac?ttcaccatat?ggatgtttaa?aacgtatatc?acgagtgcga?tctacatgtc?480

ccatcacacc?acatataaag?caatagtttg?ggagcttttc?atatttgaaa?cgggcattga?540

cgacttgccc?tctcgataat?ttaatctttt?tttctcttca?gctgattgtg?tgcatccatt?600

cgggctcaga?agcacatcaa?agggatctct?ccatcgtagt?attgggtcgt?gtcgtatgat?660

acgaagcagt?cgatgaagtt?tcctaatgtg?cgagctacag?gctccgcaaa?gaacccgcga?720

ggtagatcgt?atgctagtac?ccaaaaatca?gtttgtcgta?gcggaatcaa?cactagagac?780

tcaccctaat?gcatctcatg?tgtgatgaac?agtttatcat?ttgtgagtct?aggggtcatt?840

gtcgatgacc?caatgcacat?tgagcttatg?atagaatttg?aataggaagc?gttttccacc?900

cagatcacga?atagctaccc?ctttttcggg?cgccaaattt?ccggcatcct?atcttccacc?960

acaacttaaa?gatgcgatcg?gtaaggaact?caccgaccac?acacatcgaa?taatcttcgg?1020

tgaccggttc?ctgttgatca?agtccctcaa?tttcctcaac?ctagtcttca?atcgccgcta?1080

gcgttatccc?ccgcatatgg?actttcatag?cgcggagcgt?agccggagac?gacgagcaag?1140

aaggatgagc?ggcggcagat?tgcggctaaa?gaaacgagct?tcctgccttg?ctctatggag?1200

gcagatttct?gagttgatgg?tgatggattt?gtgatgtgga?cacttttaat?ttaagttgat?1260

tttttagcac?ttcattcacg?taattaaata?aataatttcc?agtattttat?atttatttcc?1320

ttacgttatc?taattttttg?aaagattaaa?actttgatat?aggcaagatc?atgacacgtc?1380

gaagttaagt?gaatgagact?cctaacaagg?taataacaaa?gcagttcata?aaccgaatga?1440

ccttgatctt?tactaagctt?gagatcattg?aacatataat?taaatacgtt?aatgaaagat?1500

aagaacttta?atataaaaat?cattcaaaac?gagaaactga?taacaaaaac?aaagcaaacg?1560

gccaacaaaa?taatagacgg?tggaaggatg?atgcagagcc?atccaccctt?ttttcccagt?1620

ttccttactg?cttacttctc?tatgcatatc?acaagacgcc?cttgaaactt?gttagtcatg?1680

cagagccctt?actcgccagg?tcaccgcacc?acgtgttact?ctatcacttc?tcctcccttt?1740

cctttaaaga?accaccacgc?cacctccctc?tcacaaacac?tcataaaaaa?accacctctt?1800

gcatttctcc?caagttcaaa?ttagttcaca?gctaagcaag?aactcaacaa?caatggcgga?1860

tcgtacaaca?cagccacacc?aagtccaggt?ccacacccag?caccactatc?ccaccggcgg?1920

ggctttcggc?cgttatgaag?gtggactcaa?aggcggtcca?catcaccagc?aaggatcagg?1980

cagcggccca?tcagcttcca?aggtgttagc?agtcatgacc?gcgctcccca?tcggcgggac?2040

cctccttgcc?ttggccggga?taaccttggc?tgggacgatg?atcgggctgg?cgatcaccac?2100

cccgattttt?gtcatctgca?gccctgttct?agtcccggcc?gctctgctca?tcgggtttgc?2160

cgtgagcgcg?tttctggcct?cggggatggc?cgggctgaca?gggctgacct?cgctgtcgtg?2220

gtttgcgagg?tatctgcagc?aggctgggca?gggagttgga?gtgggggtgc?cggatagttt?2280

cgagcaggcg?aagaggcgca?tgcaggatgc?tgctgggtat?atggggcaga?agaccaagga?2340

agttgggcag?gagatccaga?ggaagtctca?ggatgtgaaa?gcatcagaca?aataaggtga?2400

taataagggg?ttttgggttc?gtgtgtaaac?tggtaaaatg?gaaattctgg?gttttactgt?2460

acttttgcat?gtagtggaat?gaatgagttc?ttgttctctt?ttgtctttta?atcataaagt?2520

aagaagcagc?atttcatgtt?ctggttgaat?attgtcaaga?attcgcaaca?aatttagcta?2580

aaccagttca?atcttaccgg?ttagacgact?tcccagtaag?aaacattcca?ggtccatccc?2640

ggtataagag?tctggacttc?tgaaaccttt?agaccttgga?tttggaaaaa?agatgaaacc?2700

tttagaataa?attacaacga?tggcagattg?tacaaaactg?gagtcgagat?catgtaaatt?2760

agcccataac?taagaaccgg?cgatgacaac?aattactagg?aatatggttg?ttgggctggt?2820

cggcggctag?cggtgatgat?ttggaagaat?cggggatcca?gaatgtgaga?accgaatcat?2880

cgacgaacat?tacccggcga?ggagcccatt?tcaagcaact?ttggaactcc?tatatggctg?2940

ttccagcagg?ccacctgctc?aagaaagaaa?gaagccatgt?cagaaatcct?tacgaaatct?3000

aactggatgc?tgatatgaat?ccgccaggtg?tgcggagttc?tttacaggca?ggatctataa?3060

agaagaaaca?tgttttgtat?tggcattgtt?gatgttccaa?gcacgcagcg?atctatctcc?3120

ggatcctaac?aacaaaaata?cggattctgt?aagaaacaag?cgcagaaaac?ttctgcaacg?3180

aaaccactcg?tatatttggt?tctgagttgg?agaaagatga?ccatactact?gtatttggtt?3240

gaacttggat?tggaaccgaa?attttgagtt?gaaaagcgag?tgatcgtata?taaatttcag?3300

attcagatta?ggatatccta?tgagagaagg?tagagttacc?tgatactaca?tactgcccat?3360

caggggtaaa?agttgcctcg?atggttgtgt?ttggagatgg?ttccaggcta?aatccacaac?3420

gctgaacaaa?ttaaaagatg?aatggatcaa?tcttcaaccc?ttacttctgc?atttatgagg?3480

attggctcaa?ggctctctag?a 3501

<210>5

<211>180

<212>PRT

＜213〉flax

<400>5

Met?Ala?Asp?Arg?Thr?Thr?Gln?Pro?His?Gln?Val?Gln?Val?His?Thr?Gln

1 5 10 15

His?His?Tyr?Pro?Thr?Gly?Gly?Ala?Phe?Gly?Arg?Tyr?Glu?Gly?Gly?Leu

20 25 30

Lys?Gly?Gly?Pro?His?His?Gln?Gln?Gly?Ser?Gly?Ser?Gly?Pro?Ser?Ala

35 40 45

Ser?Lys?Val?Leu?Ala?Val?Met?Thr?Ala?Leu?Pro?Ile?Gly?Gly?Thr?Leu

50 55 60

Leu?Ala?Leu?Ala?Gly?Ile?Thr?Leu?Ala?Gly?Thr?Met?Ile?Gly?Leu?Ala

65 70 75 80

Ile?Thr?Thr?Pro?Ile?Phe?Val?Ile?Cys?Ser?Pro?Val?Leu?Val?Pro?Ala

85 90 95

Ala?Leu?Leu?Ile?Gly?Phe?Ala?Val?Ser?Ala?Phe?Leu?Ala?Ser?Gly?Met

100 105 110

Ala?Gly?Leu?Thr?Gly?Leu?Thr?Ser?Leu?Ser?Trp?Phe?Ala?Arg?Tyr?Leu

115 120 125

Gln?Gln?Ala?Gly?Gln?Gly?Val?Gly?Val?Gly?Val?Pro?Asp?Ser?Phe?Glu

130 135 140

Gln?Ala?Lys?Arg?Arg?Met?Gln?Asp?Ala?Ala?Gly?Tyr?Met?Gly?Gln?Lys

145 150 155 160

Thr?Lys?Glu?Val?Gly?Gln?Glu?Ile?Gln?Arg?Lys?Ser?Gln?Asp?Val?Lys

165 170 175

Ala?Ser?Asp?Lys

180

<210>6

<211>1676

<212>DNA

＜213〉flax

<400>6

tccactatgt?aggtcatatc?catcatttta?atttttgggc?accattcaat?tccatcttgc?60

ctttagggat?gtgaatatga?acggccaagg?taagagaata?aaaataatcc?aaattaaagc?120

aagagaggcc?aagtaagata?atccaaatgt?acacttgtca?tcgccgaaat?tagtaaaata?180

cgcggcatat?tgtattccca?cacattatta?aaataccgta?tatgtattgg?ctgcatttgc?240

atgaataata?ctacgtgtaa?gcccaaaaga?acccacgtgt?agcccatgca?aagttaacac?300

tcacgacccc?attcctcagt?ctccactata?taaacccacc?atccccaatc?ttaccaaacc?360

caccacacga?ctcacaactc?gactctcaca?ccttaaagaa?ccaatcacca?ccaaaaaatg?420

gcaaagctga?tgagcctagc?agccgtagca?acgcagttcc?tcttcctgat?cgtggtggac?480

gcatccgtcc?gaaccacagt?gattatcgac?gaggagacca?accaaggccg?cggtggaggc?540

aaggtggcag?ggacagcagc?agtctgcgag?cagcagatcc?agcagcgaga?cttcctgagg?600

agctgccagc?agttcatgtg?ggagaaagtc?cagaggggcg?gccacagcca?ctattacaac?660

cagggccgtg?gaggaggcga?acagagccag?tacttcgaac?agctgtttgt?gacgacctta?720

agcaattgcg?caccgcggtg?caccatgcca?ggggacttga?agcgtgccat?cggccaaatg?780

aggcaggaaa?tccagcagca?gggacagcag?cagggacagc?agcaggaagt?tcagaggtgg?840

atccagcaag?ctaaacaaat?cgctaaggac?ctccccggac?agtgccgcac?ccagcctagc?900

caatgccagt?tccagggcca?gcagcaatct?gcatggtttt?gaaggggtga?tcgattatga?960

gatcgtacaa?agacactgct?aggtgttaag?gatggataat?aataataata?atgagatgaa?1020

tgtgttttaa?gttagtgtaa?cagctgtaat?aaagagagag?agagagagag?agagagagag?1080

agagagagag?agagagagag?agaggctgat?gaaatgttat?gtatgtttct?tggtttttaa?1140

aataaatgaa?agcacatgct?cgtgtggttc?tatcgaatta?ttcggcggtt?cctgtgggaa?1200

aaagtccaga?agggcggccg?cagctactac?tacaaccaag?gccgtggagg?agggcaacag?1260

agccagcact?tcgatagctg?ctgcgatgat?cttaagcaat?tgaggagcga?gtgcacatgc?1320

aggggactgg?agcgtgcaat?cggccagatg?aggcaggaca?tccagcagca?gggacagcag?1380

caggaagttg?agaggtggtc?ccatcaatct?aaacaagtcg?ctagggacct?tccgggacag?1440

tgcggcaccc?agcctagccg?atgccagctc?caggggcagc?agcagtctgc?atggttttga?1500

agtggtgatc?gatgagatcg?tataaagaca?ctgctaggtg?ttaaggatgg?gataataaga?1560

tgtgttttaa?gtcattaacc?gtaataaaaa?gagagagagg?ctgatggaat?gttatgtatg?1620

tatgtttctt?ggtttttaaa?attaaatgga?aagcacatgc?tcgtgtgggt?tctatc 1676

<210>7

<211>174

<212>PRT

＜213〉flax

<400>7

Met?Ala?Lys?Leu?Met?Ser?Leu?Ala?Ala?Val?Ala?Thr?Gln?Phe?Leu?Phe

1 5 10 15

Leu?Ile?Val?Val?Asp?Ala?Ser?Val?Arg?Thr?Thr?Val?Ile?Ile?Asp?Glu

20 25 30

Glu?Thr?Asn?Gln?Gly?Arg?Gly?Gly?Gly?Lys?Val?Ala?Gly?Thr?Ala?Ala

35 40 45

Val?Cys?Glu?Gln?Gln?Ile?Gln?Gln?Arg?Asp?Phe?Leu?Arg?Ser?Cys?Gln

50 55 60

Gln?Phe?Met?Trp?Glu?Lys?Val?Gln?Arg?Gly?Gly?His?Ser?His?Tyr?Tyr

65 70 75 80

Asn?Gln?Gly?Arg?Gly?Gly?Gly?Glu?Gln?Ser?Gln?Tyr?Phe?Glu?Gln?Leu

85 90 95

Phe?Val?Thr?Thr?Leu?Ser?Asn?Cys?Ala?Pro?Arg?Cys?Thr?Met?Pro?Gly

100 105 110

Asp?Leu?Lys?Arg?Ala?Ile?Gly?Gln?Met?Arg?Gln?Glu?Ile?Gln?Gln?Gln

115 120 125

Gly?Gln?Gln?Gln?Gly?Gln?Gln?Gln?Glu?Val?Gln?Arg?Trp?Ile?Gln?Gln

130 135 140

Ala?Lys?Gln?Ile?Ala?Lys?Asp?Leu?Pro?Gly?Gln?Cys?Arg?Thr?Gln?Pro

145 150 155 160

Ser?Gln?Cys?Gln?Phe?Gln?Gly?Gln?Gln?Gln?Ser?Ala?Trp?Phe

165 170

<210>8

<211>4999

<212>DMA

＜213〉flax

<400>8

ctcaagcata?cggacaaggg?taaataacat?agtcaccaga?acataataaa?caaaaagtgc?60

agaagcaaga?taaaaaaatt?agctatggac?attcaggttc?atattggaaa?catcattatc?120

ctagtcttgt?gaccatcctt?cctcctgctc?tagttgagag?gccttgggac?taacgagagg?180

tcagttggga?tagcagatcc?ttatcctgga?ctagcctttc?tggtgtttca?gagtcttcgt?240

gccgccgtct?acatctatct?ccattaggtc?tgaagatgac?tcttcacacc?aacgacgttt?300

aaggtctcta?tcctactcct?agcttgcaat?acctggcttg?caatacctgg?agcatcgtgc?360

acgatgattg?gatactgtgg?aggaggagtg?tttgctgatt?tagagctccc?ggttgggtga?420

tttgacttcg?atttcagttt?aggcttgttg?aaatttttca?ggttccattg?tgaagccttt?480

agagcttgag?cttccttcca?tgttaatgcc?ttgatcgaat?tctcctagag?aaaagggaag?540

tcgatctctg?agtattgaaa?tcgaagtgca?catttttttt?caacgtgtcc?aatcaatcca?600

caaacaaagc?agaagacagg?taatctttca?tacttatact?gacaagtaat?agtcttaccg?660

tcatgcataa?taacgtctcg?ttccttcaag?aggggttttc?cgacatccat?aacgacccga?720

agcctcatga?aagcattagg?gaagaacttt?tggttcttct?tgtcatggcc?tttataggtg?780

tcagccgagc?tcgccaattc?ccgtccgact?ggctccgcaa?aatattcgaa?cggcaagtta?840

tggacttgca?accataactc?cacggtattg?agcaggacct?attgtgaaga?ctcatctcat?900

ggagcttcag?aatgtggttg?tcagcaaacc?aatgaccgaa?atccatcaca?tgacggacgt?960

ccagtgggtg?agcgaaacga?aacaggaagc?gcctatcttt?cagagtcgtg?agctccacac?1020

cggattccgg?caactacgtg?ttgggcaggc?ttcgccgtat?tagagatatg?ttgaggcaag?1080

acccatctgt?gccactcgta?caattacgag?agttgttttt?tttgtgattt?tcctaagttt?1140

ctcgttgatg?gtgagctcat?attctacatc?gtatggtctc?tcaacgtcgt?ttcctgtcat?1200

ctgatatccc?gtcatttgca?tccacgtgcg?ccgcctcccg?tgccaagtcc?ctaggtgtca?1260

tgcacgccaa?attggtggtg?gtgcgggctg?ccctgtgctt?cttaccgatg?ggtggaggtt?1320

gagtttgggg?gtctccgcgg?cgatggtagt?gggttgacgg?tttggtgtgg?gttgacggca?1380

ttgatcaatt?tacttcttgc?ttcaaattct?ttggcagaaa?acaattcatt?agattagaac?1440

tggaaaccag?agtgatgaga?cggattaagt?cagattccaa?cagagttaca?tctcttaaga?1500

aataatgtaa?cccctttaga?ctttatatat?ttgcaattaa?aaaaataatt?taacttttag?1560

actttatata?tagttttaat?aactaagttt?aaccactcta?ttatttatat?cgaaactatt?1620

tgtatgtctc?ccctctaaat?aaacttggta?ttgtgtttac?agaacctata?atcaaataat?1680

caatactcaa?ctgaagtttg?tgcagttaat?tgaagggatt?aacggccaaa?atgcactagt?1740

attatcaacc?gaatagattc?acactagatg?gccatttcca?tcaatatcat?cgccgttctt?1800

cttctgtcca?catatcccct?ctgaaacttg?agagacacct?gcacttcatt?gtccttatta?1860

cgtgttacaa?aatgaaaccc?atgcatccat?gcaaactgaa?gaatggcgca?agaacccttc?1920

ccctccattt?cttatgtggc?gaccatccat?ttcaccatct?cccgctataa?aacaccccca?1980

tcacttcacc?tagaacatca?tcactacttg?cttatccatc?caaaagatac?ccaccatggc?2040

tagatcatca?agccctttgc?ttctctcact?ctgcattttc?gccattctct?tccactcttc?2100

tctgggtagg?cagcaattcc?agcaggggaa?cgagtgccag?atcgacagga?tcgacgcatc?2160

cgagccggac?aaaaccatcc?aggcagaagc?tggcaccatc?gaggtatggg?accagaaccg?2220

ccagcaattc?cagtgcgctg?gtgttgccgt?tgtaaggcgc?accattgagc?ccaaaggtct?2280

tctcttgcct?ttctacagca?acacccctca?gctcatctac?atcgttcaag?gtataaatta?2340

aatcagttca?tacaatgata?accaccactt?cgaatgtatt?tatcaaatat?caatgatcga?2400

tgcacctgta?tgtgttgtgt?atattcaggt?aggggagtta?caggaatcat?gttcccakga?2460

tgtccagaga?cattcgagga?atcccagcag?caaggacaac?agggccaaca?gggtagttcc?2520

caagaccagc?accagaagat?ccgccgcttc?cgtgaaggtg?acgtcattgc?cgtccctgcc?2580

ggtgtagccc?actggtccta?caacgatggc?aacgaaccag?tcatggccat?tgttgtccat?2640

gacacttcca?gccacctcaa?ccaactggac?aacaacccca?gggtatataa?gcattgccgt?2700

agttgctaat?aaattgcaca?caattggaac?tctattttca?gtatctaata?actttttcct?2760

tttttggcag?aacttctact?tggcaggaaa?cccgagagac?gagttcgaac?aatcgcagca?2820

aggaggcagg?ctgagccgtg?gggagagtga?aggtggacga?ggacgcaggg?aacctcttca?2880

acctgcaaca?acctcttctt?gcggaatcga?ctccaagctc?atcgcggagg?cgttcaatgt?2940

cgacgagaac?gtggcaagga?ggctacagag?cgagaacgac?aacagaggcc?agatcgtccg?3000

agtcgaaggc?gagctcgaca?tcgtcagacc?tccgaccagt?atccaggagg?agtcacagga?3060

gcagggaggt?cgtggtggtg?gccgctacta?ctccaatgga?gtggaggaga?ccttctgctc?3120

catgagacta?attgagaaca?tcggcgatcc?ttctcgggca?gacattttca?ctccagaagc?3180

cggccgcgtt?agatccctca?acagccacaa?cctccccgtc?ctgcaatgga?tccagcttag?3240

cgccgagaga?ggcgttctct?acaatgtata?gatctcactc?acgcaccaac?tctaaattga?3300

atccctaatt?atttaattca?ccgatatctg?accgaccggt?ttgaattttg?taggaagcga?3360

tcaggctgcc?gcactggaac?atcaacgcac?acagcatagt?gtacgcgatc?agaggacaag?3420

ccagagtcca?gatcgtgaac?gaggaaggga?attcggtgtt?cgatggagtg?ctgcaggaag?3480

gacaggtggt?gacggtgccg?cagaacttcg?cggtggtaaa?gagatcccag?agcgagaggt?3540

ttgagtgggt?ggcgttcaag?accaacgaca?acgcgatggt?gaactcgcta?gccgggagga?3600

catcggcagt?aagggcgatc?cccgcggatg?tactggctaa?cgcctggagg?gtgtcgccgg?3660

aggaggcgag?gagggtgaag?ttcaacaggc?aggagactca?cttggctagc?accaggggcc?3720

agtccaggtc?gcccgggagg?ttgaatgtcg?tcaaggaggt?gatcaacttg?cttatgtaaa?3780

atgtgacggt?gaaataataa?cggtaaaata?tatgtaataa?taataataat?aaagccacaa?3840

agtgagaatg?aggggaaggg?gaaatgtgta?atgagccagt?agccggtggt?gctaattttg?3900

tatcgtattg?tcaataaatc?atgaattttg?tggtttttat?gtgttttttt?aaatcatgaa?3960

ttttaaattt?tataaaataa?tctccaatcg?gaagaacaac?attccatatc?catggatgtt?4020

tctttaccca?aatctagttc?ttgagaggat?gaagcatcac?cgaacagttc?tgcaactatc?4080

cctcaaaagc?tttaaaatga?acaacaagga?acagagcaac?gttccaaaga?tcccaaacga?4140

aacatattat?ctatactaat?actatattat?taattactac?tgcccggaat?cacaatccct?4200

gaatgattcc?tattaactac?aagccttgtt?ggcggcggag?aagtgatcgg?cgcggcgaga?4260

agcagcggac?tcggagacga?ggccttggat?gagcagagtc?tttacctgcc?agggcgtgaa?4320

ggggaagagc?ggccttctgg?agtaggagtt?cagcaagcgg?cggttccttg?gcggagtaag?4380

cggacgtaag?ggtggntgtc?gacgtcntcg?tttcnggagg?cgnattcatg?aagggttaaa?4440

gtcanatctg?tagctctcga?gtgctcaggg?agccnaaaga?cgttgggaaa?ccgtcgncgt?4500

ttggggcatc?agtcngcggg?gcacgcttcc?ctcctgctgc?tccanaancn?angtanattt?4560

aaaaganatg?ggaaattaan?taatggnaat?nannaggagg?attgnaacgg?tcnganccgn?4620

angaanagtt?tttannggtt?taaatactgg?gggagtngna?gccngccnct?ggttccngtg?4680

tagangaaac?caagnnccgg?gaggnttnca?nnngnnaggg?agaaaaagga?nncatttnan?4740

nangcngagg?gacatgaanc?ggtacngagc?tgnggttcan?nnancggcgn?nnggnagtcc?4800

cnngggaccn?ggntggggtn?anaagggaan?ggaacattng?gtngnangga?naanaccntt?4860

ttacnattgc?ctttgcaggn?nngtntnggc?ncntncgggt?nacatnccgc?tgcatgggct?4920

ttggggngcc?nanaggnagc?cncangggna?nncngccncc?ttgtncangn?cgctnaagtt?4980

cnattgtana?tggncgttg 4999

<210>9

<211>96

<212>pRT

＜213〉flax

<400>9

Met?Ala?Arg?Ser?Ser?Ser?Pro?Leu?Leu?Leu?Ser?Leu?Cys?Ile?Phe?Ala

1 5 10 15

Ile?Leu?Phe?His?Ser?Ser?Leu?Gly?Arg?Gln?Gln?Phe?Gln?Gln?Gly?Asn

20 25 30

Glu?Cys?Gln?Ile?Asp?Arg?Ile?Asp?Ala?Ser?Glu?Pro?Asp?Lys?Thr?Ile

35 40 45

Gln?Ala?Glu?Ala?Gly?Glu?Val?Trp?Asp?Gln?Asn?Arg?Gln?Gln?Phe?Gln

50 55 60

Cys?Ala?Gly?Val?Ala?Val?Val?Arg?Arg?Thr?Ile?Glu?Pro?Lys?Gly?Leu

65 70 75 80

Leu?Leu?Pro?Phe?Tyr?Ser?Asn?Thr?Pro?Gln?LeuIle?Tyr?Ile?Val?Gln

85 90 95

<210>10

<211>85

<212>PRT

＜213〉flax

<400>10

Gly?Arg?Gly?Val?Thr?Gly?Ile?Met?Phe?Pro?Xaa?Cys?Pro?Glu?Thr?Phe

1 5 10 15

Glu?Glu?Ser?Gln?Gln?Gln?Gly?Gln?Gln?Gly?Gln?Gln?Gly?Ser?Ser?Gln

20 25 30

Asp?Gln?His?Gln?Lys?Ile?Arg?Arg?Phe?Arg?Glu?Gly?Asp?Val?Ile?Ala

35 40 45

Val?Pro?Ala?Gly?Val?Ala?His?Trp?Ser?Tyr?Asn?Asp?Gly?Asn?Glu?Pro

50 55 60

Val?Met?Ala?Ile?Val?Val?His?Asp?Thr?Ser?Ser?His?Leu?Asn?Gln?Leu

65 70 75 80

Asp?Asn?Asn?Pro?Arg

85

<210>11

<211>165

<212>PRT

＜213〉flax

<400>11

Asn?Phe?Tyr?Leu?Ala?Gly?Asn?Pro?Arg?Asp?Glu?Phe?Glu?Gln?Ser?Gln

1 5 10 15

Gln?Gly?Gly?Arg?Leu?Ser?Arg?Gly?Glu?Ser?Glu?Gly?Gly?Arg?Gly?Arg

20 25 30

Arg?Glu?Pro?Leu?Gln?Pro?Ala?Thr?Thr?Ser?Ser?Cys?Gly?Ile?Asp?Ser

35 40 45

Lys?Leu?Ile?Ala?Glu?Ala?Phe?Asn?Val?Asp?Glu?Asn?Val?Ala?Arg?Arg

50 55 60

Leu?Gln?Ser?Glu?Asn?Asp?Asn?Arg?Gly?Gln?Ile?Val?Arg?Val?Glu?Gly

65 70 75 80

Glu?Leu?Asp?Ile?Val?Arg?Pro?Pro?Thr?Ser?Ile?Gln?Glu?Glu?Ser?Gln

85 90 95

Glu?Gln?Gly?Gly?Arg?Gly?Gly?Gly?Arg?Tyr?Tyr?Ser?Asn?Gly?Val?Glu

100 105 110

Glu?Thr?Phe?Cys?Ser?Met?Arg?Leu?Ile?Glu?Asn?Ile?Gly?Asp?Pro?Ser

115 120 125

Arg?Ala?Asp?Ile?Phe?Thr?Pro?Glu?Ala?Gly?Arg?Val?Arg?Ser?Leu?Asn

130 135 140

Ser?His?Asn?Leu?Pro?Val?Leu?Gln?Trp?Ile?Gln?Leu?Ser?Ala?Glu?Arg

145 150 155 160

Gly?Val?Leu?Tyr?Asn

165

<210>12

<211>141

<212>PRT

＜213〉flax

<400>12

Glu?AlaIle?Arg?Leu?Pro?His?Trp?Asn?Ile?Asn?Ala?His?Ser?Ile?Val

1 5 10 15

Tyr?Ala?Ile?Arg?Gly?Gln?Ala?Arg?Val?Gln?Ile?Val?Asn?Glu?Glu?Gly

20 25 30

Asn?Ser?Val?Phe?Asp?Gly?Val?Leu?Gln?Glu?Gly?Gln?Val?Val?Thr?Val

35 40 45

Pro?Gln?Asn?Phe?Ala?Val?Va1?Lys?Arg?Ser?Gln?Ser?Glu?Arg?Phe?Glu

50 55 60

Trp?Val?Ala?Phe?Lys?Thr?Asn?Asp?Asn?Ala?Met?Val?Asn?Ser?Leu?Ala

65 70 75 80

Gly?Arg?Thr?Ser?Ala?Val?Arg?Ala?Ile?Pro?Ala?Asp?Val?Leu?Ala?Asn

85 90 95

Ala?Trp?Arg?Val?Ser?Pro?Glu?Glu?Ala?Arg?Arg?Val?Lys?Phe?Asn?Arg

100 105 110

Gln?Glu?Thr?His?Leu?Ala?Ser?Thr?Arg?Gly?Gln?Ser?Arg?Ser?Pro?Gly

115 120 125

Arg?Leu?Asn?Val?Val?Lys?Glu?Val?Ile?Asn?Leu?Leu?Met

130 135 140

<210>13

<211>11

<212>PRT

＜213〉flax

<400>13

Gln?Gln?Gln?Gly?Gln?Gln?Gln?Gly?Gln?Gln?Gln

1 5 10

<210>14

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉explanation of artificial sequence: primer

<400>14

tccactatgt?aggtcata 18

<210>15

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉explanation of artificial sequence: primer

<400>15

ctttaaggtg?tgagagtc 18

<210>16

<211>15

<212>DNA

＜213〉artificial sequence

<220>

＜223〉explanation of artificial sequence: primer

<400>16

aggggtgatc?gatta 15

<210>17

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉explanation of artificial sequence: primer

<400>17

gatagaaccc?acacgagc 18

<210>18

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉explanation of artificial sequence: primer

<400>18

tatctagact?caagcatacg?gacaagggt 29

<210>19

<211>6

<212>DNA

＜213〉artificial sequence

<220>

＜223〉explanation of artificial sequence: XbaI site

<400>19

tctaga 6

<210>20

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉explanation of artificial sequence: primer

<400>20

ggttatcatt?gtatgaactg?a 21

<210>21

<211>6

<212>DNA

＜213〉artificial sequence

<220>

＜223〉explanation of artificial sequence: NcoI site

<400>21

ccatgg 6

<210>22

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉explanation of artificial sequence: primer

<400>22

gcaagcttaa?tgtgacggtg?aaataataac?gg 32

<210>23

<211>6

<212>DNA

＜213〉artificial sequence

<220>

＜223〉explanation of artificial sequence: HindIII site

<400>23

aagctt 6

<210>24

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉explanation of artificial sequence: primer

<400>24

taggtacctg?gcaggtaaag?actctgctc 29

<210>25

<211>6

<212>DNA

＜213〉artificial sequence

<220>

＜223〉explanation of artificial sequence: KpnI site

<400>25

ggtacc 6

Claims (18)

1. express the method for the nucleotide sequence that needs in flex seed, this method comprises:

(a) preparation 5 ' contain the chimeric nucleic acid construct of the following composition that is operably connected to 3 ' transcriptional orientation:

(1) seed specific promoters that obtains from flax; With

(2) nucleotide sequence of described needs, the nucleic acid that wherein needs is non-natural to described seed specific promoters;

(b) described chimeric nucleic acid construct is imported the line cell; With

(c) described line cell being grown into can seed bearing sophisticated line, the nucleotide sequence of wherein said needs is under the control of described seed specific promoters, in seed, express, and wherein said flex seed specific promoters is selected from:

(a) nucleotide sequence shown in the Nucleotide 1 to 2037 of the Nucleotide 1 to 417 of the Nucleotide 1 to 1852 of the Nucleotide 1 to 2023 of SEQ.ID.NO.:1, SEQ.ID.NO.:4, SEQ.ID.NO.:6 or SEQ.ID.NO.:8, wherein T also can be U; Or

(b) with the nucleotide sequence of (a) nucleic acid array complementation.

2. at least one expression characteristic that method according to claim 1, wherein said seed specific promoters give its natural acid sequence is given described non-natural nucleotide sequence.

3. method according to claim 2, wherein said expression characteristic are the timing of expressing, and expression level is to the reaction of illumination condition variation, to the reaction of temperature variation, to the reaction of chemical agent concentration variation.

4. the change that method according to claim 1, the expression of the nucleotide sequence of wherein said needs cause protein in the described seed or lipid acid to be formed.

5. can in plant, instruct the isolated nucleic acid sequences of seed-specific expression, be selected from:

(a) nucleotide sequence of forming by the Nucleotide shown in Fig. 1 (SEQ.ID.NO.:1) 1 to 2023, wherein T also can be U; Or

(b) with the nucleotide sequence of (a) nucleic acid array complementation.

6. can in plant, instruct the isolated nucleic acid sequences of seed-specific expression, be selected from:

(a) nucleotide sequence of forming by the Nucleotide shown in Fig. 2 (SEQ.ID.NO.:4) 1 to 1852, wherein T also can be U; Or

(b) with the nucleotide sequence of (a) nucleic acid array complementation.

7. in plant, can instruct the isolated nucleic acid sequences of seed-specific expression, be selected from:

(a) nucleotide sequence of forming by the Nucleotide 1 to 417 as shown in Fig. 3 (SEQ.ID.NO.:6), wherein T also can be U; Or

(b) with the nucleotide sequence of (a) nucleic acid array complementation.

8. can in plant, instruct the isolated nucleic acid sequences of seed-specific expression, be selected from:

(a) nucleotide sequence of forming by the Nucleotide shown in Fig. 4 (SEQ.ID.NO.:8) 1 to 2037, wherein T also can be U; Or

(b) with the nucleotide sequence of (a) nucleic acid array complementation.

9. the isolating chimeric nucleic acid sequence of forming by following nucleotide sequence:

(a) first nucleotide sequence of being made up of the seed specific promoters that obtains from flax is selected from:

(1) nucleotide sequence of forming by the Nucleotide 1-2023 shown in Fig. 1 (SEQ.ID.NO.:1), wherein T also can be U; Or

(2) with the nucleotide sequence of the nucleic acid array complementation of (1); With

(b) to described flex seed specific promoters be second nucleotide sequence of non-natural.

10. the isolating chimeric nucleic acid sequence of forming by following nucleotide sequence:

(a) first nucleotide sequence of being made up of the seed specific promoters that obtains from flax is selected from:

(1) nucleotide sequence of forming by the Nucleotide 1-1852 shown in Fig. 2 (SEQ.ID.NO.:4), wherein T also can be U; Or

(2) with the nucleotide sequence of the nucleic acid array complementation of (1); With

(b) to described flex seed specific promoters be second nucleotide sequence of non-natural.

11. the isolating chimeric nucleic acid sequence of forming by following nucleotide sequence:

(a) first nucleotide sequence of being made up of the seed specific promoters that obtains from flax is selected from:

(1) nucleotide sequence of forming by the Nucleotide 1-417 shown in Fig. 3 (SEQ.ID.NO.:6), wherein T also can be U; Or

(2) with the nucleotide sequence of the nucleic acid array complementation of (1); With

(b) to described flex seed specific promoters be second nucleotide sequence of non-natural.

12. the isolating chimeric nucleic acid sequence of forming by following nucleotide sequence:

(a) first nucleotide sequence of being made up of the seed specific promoters that obtains from flax is selected from:

(1) nucleotide sequence of forming by the Nucleotide 1-2037 shown in Fig. 4 (SEQ.ID.NO.:8), wherein T also can be U; Or

(2) with the nucleotide sequence of the nucleic acid array complementation of (1); With

(b) to described flex seed specific promoters be second nucleotide sequence of non-natural.

13. in plant seed, express the method for the nucleotide sequence that needs, comprising:

(a) will according to each described chimeric nucleic acid sequence of claim 9-12 import vegetable cell and

(b) described plant cell growth being become can seed bearing maturation plant, and wherein second nucleotide sequence is under the control of seed specific promoters, expresses in seed.

14. method according to claim 13, wherein said vegetable cell is selected from the group that comprises following plants: soybean (Glycine max), rape (Brassia napus, BrassicaCampestris), Sunflower Receptacle (Helianthus annuus), cotton (Gossypium hirsutum), corn (Zea mays), tobacco (Nicotiana tobacum), clover (Medicago Sativa), wheat (Triticum sp.), barley (Hordeum vulgare), oat (Avena Sativa L.), Chinese sorghum (Sorgham bicolor), Arabidopis thaliana (Arabidopsis thaliana), potato (Solanum sp.), flax/Semen Lini (Linum usitatissimum), safflower (Carthamus tinctorius), oil palm (Eleais guineeis), Semen arachidis hypogaeae (Arachis hypogaea), Brazil's nut (Bertholletiaexcelsa), coconut (Cocus nucifera), castor-oil plant (Ricinus communis), coriander (Coriandrum sativum), pumpkin (Cucurbita maxima), shrub (Simmondsiachinensis) and paddy rice (Oryza Sativa).

15. contain the vegetable cell of each described chimeric nucleic acid sequence of claim 9-12.

16. contain the recombinant expression vector of with good grounds each described nucleotide sequence of claim 5-8.

17. contain the recombinant expression vector of with good grounds each described chimeric nucleic acid sequence of claim 9-12.

18. isolated nucleic acid sequences is selected from:

(a) as Fig. 1 (SEQ.ID.NO.:1), Fig. 2 (SEQ.ID.NO.:4), the nucleotide sequence shown in Fig. 3 (SEQ.ID.NO.:6) or Fig. 4 (SEQ.ID.NO.:8), wherein T also can be U; Or

(b) with the nucleotide sequence of (a) nucleic acid array complementation.

Images