CN1354186A - Preparation method of recombinant human vascular endothelial cytopoiesis suppressor factor with human LgG1Fc fragment molecular structure and application of its product - Google Patents
Preparation method of recombinant human vascular endothelial cytopoiesis suppressor factor with human LgG1Fc fragment molecular structure and application of its product Download PDFInfo
- Publication number
- CN1354186A CN1354186A CN 00123347 CN00123347A CN1354186A CN 1354186 A CN1354186 A CN 1354186A CN 00123347 CN00123347 CN 00123347 CN 00123347 A CN00123347 A CN 00123347A CN 1354186 A CN1354186 A CN 1354186A
- Authority
- CN
- China
- Prior art keywords
- gene
- human
- endothelial cell
- recombinant human
- endostatin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The present invention belongs to the field of gene enigneeirng technology, and relates to a preparation method of recombinant human vascular endothelial cytopoiesis inhibiting factor with human IgG1Fc fragment molecular structure and its product application. It is new gene segment formed from Endostatin obtained by using PCR method to make screening from human foetal kidney cell cDNA library and human IgG1Fc gene segment by means of T4 joining enzyme, and utilizes gene clon method to make it implement fermentation in microzyme, expression and purification so as to obtain the invented pure product which possesses high-effective expression and solubility and has no need of renaturation, decoration and glycosylation. It can specially inhibite tumor vasculr endothelial proliferation, and can be used for curing several tumors.
Description
The invention belongs to the genetically engineered field, particularly have human IgG
1The recombinant human endothelial cell of Fc fragment molecular structure generates the preparation method of supressor and the purposes of goods thereof.
Cancer has become the human second largest killer of the cerebrovascular disease that is only second in the whole world, be present one of the most difficult disease of conquering in the world.The current entity clinical tumor therapy overwhelming majority is carried out at tumour cell, fundamentally block with inhibitor or blocker or the therapy that suppresses noumenal tumour revascularization and blood supply aspect but seldom, with having human IgG
1Supressor--Endostatin albumen carries out the antineoplastic vascular regenerative therapy and does not at home and abroad appear in the newspapers as yet in the recombinant human endothelial cell generation of Fc fragment molecular structure.The vascular endothelial cell of recombinant human generation supressor is to express in colibacillus mostly in addition, and its expression amount only rises bacterium liquid for 15-20mg/, and poorly soluble, and biological activity is low.
The object of the present invention is to provide a kind of that in yeast, efficiently express, solubility, need not renaturation, modification and glycosylated, high reactivity has human IgG
1The recombinant human endothelial cell of Fc fragment molecular structure generates supressor, is used for antineoplaston.
The inventive method step is as follows:
A. screen from human fetal kidney cell cDNA library by PCR method and obtain human collagen 18--human typeXVIII collagen gene 1503 to 2055cDNA active fragmentss, at first synthetic two kinds of primers are respectively CCGCTCTCGAGAAAAGAGAGGCTCACAGC and CGCGGATCCACCACCTCCCTTGGAGGCAGTCATGAAGCT, with human fetal kidney cell cDNA storehouse is template, does 30 circulations in 2 minutes altogether with 94 ℃ 2 minutes, 55 ℃ of PCR conditions 2 minutes and 72 ℃ and obtains the recombinant human endothelial cell and generate supressor-Endostatin gene fragment;
B. the gained gene fragment clone is gone in the TA Vectohk plasmid,, obtain the 576bp gene fragment through the electrophoresis purifying by two kinds of endonuclease digestions;
C. and then synthetic two kinds of primers: GGT GGA TCC GGT GGA GGA GGA AGCGGA GGT GGA GGG TCC GTC GAC AAA ACT CAC and CCG CGG CCGCCG CAC TCA TTT ACC CGG AGA CAG, with human fetal kidney cell cDNA storehouse is template, does 30 circulations altogether in 2 minutes with 94 ℃ 2 minutes, 55 ℃ of PCR conditions 2 minutes and 72 ℃ and obtains human IgG
1The Fc gene fragment;
D. the gene fragment clone of gained is gone in the TA Vectohk plasmid, by two kinds of endonuclease digestions, the 729bp gene fragment that obtains through the electrophoresis purifying;
E. two gene fragments that the clone obtained are cloned in two kinds of restriction enzyme sites of pPICZ α A plasmid after connecting with ligase enzyme again, constitute the PLW205 genophore;
F. the genophore PLW205 that obtains is changed in the X--33 yeast, constitute engineering strain, obtain resistant strain, the gene engineering microzyme strain that obtains efficiently expressing through screening with dull and stereotyped cultivation;
G. the means purifying such as bacterium liquid employing bioseparation technology of expressing through fermentation inducement obtain having human IgG
1The recombinant human endothelial cell of Fc fragment molecular structure generates supressor protein;
What h. purifying is obtained has a human IgG
1The recombinant human endothelial cell of Fc fragment molecular structure generates supressor Endostatin albumen and joins in the bovine adrenal capillary endothelial cell nutrient solution that contains bFGF, cultivate after 3 days by cell counting and cell dyeing method, measure the activity that suppresses capillary endothelial cell propagation.
The above-mentioned goods that obtain have following characteristic:
A. its genophore is the PLW205 plasmid, and its plasmid expression promotor is alcohol oxidase AOX1, replaces the natural alcohol oxidase gene of yeast;
Make up α-factor in the b.PLW205 and have the secretion signal peptide sequence, target protein is secreted in the extracellular;
C. its genetically engineered host yeast is methanol evoked;
D. its goods are solubility, need not the protein of the biologically active of renaturation and modification.
Have human IgG
1The recombinant human endothelial cell of Fc fragment molecular structure generates supressor-Endostatin albumen, and its goods become biological products to be used for antineoplaston as single formulation preparation.
The present invention has following advantage compared with prior art:
(1) employing has human IgG
1The gene product of the recombinant human endothelial cell generation supressor-Endostatin of Fc fragment molecular structure is used for the treatment of people's noumenal tumour and belongs to homology, and is difficult for being repelled by human body, and its effect is better than the albumen with mouse reorganization Endsotatin.
(2) have human IgG
1It is to express in yeast that the recombinant human endothelial cell of Fc fragment molecular structure generates supressor-Endostatin gene, belong to methanol evoked, expression amount rises bacterium liquid up to 60-80mg/, its protein product belongs to secretor type, need not the high-activity natural state protein of renaturation and modification for solubility.
(3) have human IgG
1The recombinant human endothelial cell of Fc fragment molecular structure generates supressor--and Endostatin albumen specificity suppresses the capillary endothelial cell of propagation, tumor vessel can not be regenerated, cause tumor tissues not having blood vessel to supply with constantly death and atrophy under the state of blood and nutritive substance, and to other cell unrestraint effect of human body, experiment has confirmed this conclusion.
(4) be not with human IgG
1The recombinant human endothelial tube generation supressor Endostatin of Fc fragment molecular structure compares and can increase the Endostatin transformation period, reduce the Endostatin consumption 10 times, make it have more meanings such as pharmacology, pharmacodynamics, pharmacokinetics, kinds of tumors is had therapeutic action.
Fig. 1: mouse S180 sarcoma control group, treatment group result of treatment graphic representation.
Embodiment: preparation method of the present invention mainly is the goods that obtain through gene clone, saccharomycetes to make fermentation, purge process, and its step is as follows:
A. screen from human fetal kidney cell cDNA library by PCR method and obtain human collagen 18--human type XVIII collagen gene 1503 to 2055cDNA active fragmentss, at first synthetic two kinds of primers are respectively CCGCTCTCGAGAAAAGAGAGGCTCACAGC and CGCGGATCCACCACCTCCCTTGGAGGCAGTCATGAAGCT, with 1 microlitre human fetal kidney cell cDNA is template, add each 2 microlitre (concentration is every microlitre 0.1 microgram) of above-mentioned two kinds of primers, add 5 microlitre 2.5MdNTP, 5 microlitres, 10 * PCR damping fluid, each 1 microlitre Taq or PwoDNA polysaccharase, on the PCR instrument 94 ℃ 2 minutes, 55 ℃ of 2 minutes and 72 ℃ amounted to 30 circulations in 2 minutes, separated obtaining recombinant human endothelial cell generation supressor--Endostatin gene fragment then with 15% agarose gel electrophoresis:
B. above-mentioned gained gene fragment clone is gone in the TA Vectobk plasmid, by xhol, two kinds of endonuclease digestions of BamHl obtain the 576bp gene fragment through the electrophoresis purifying:
C. and then synthetic two kinds of primers: GGT GGA TCC GGT GGA GGA GGA AGCGGA GGT GGA GGG TCC GTC GAC AAA ACT CAC and CCG CGG CCGCCG CAC TCA TTT ACC CGG AGA CAG each 1 microlitre Taq or PwoDNA polysaccharase, 94 ℃ 2 minutes, 55 ℃ 2 minutes and 72 ℃ amounted to 30 circulations in 2 minutes on the PCR instrument, and obtained human IgG
1The Fc gene fragment;
D. above-mentioned gained gene fragment clone is gone in the TA Vectohk plasmid, by BamHl, two kinds of endonuclease digestions of NotI separate obtaining the 729bp gene fragment then with 15% agarose gel electrophoresis;
E. two gene fragments that the clone obtained connect the back with the T4 ligase enzyme and form a new gene fragment, and this gene fragment clone is gone into to form the new genophore of PLW205 in two restriction enzyme sites of pPICZ α A plasmid;
F. genophore PLW205 is changed in the X-33 yeast, use dull and stereotyped cultivation of YPD to obtain resistant strain, the gene engineering microzyme strain-LW205 that obtains efficiently expressing through screening;
G. the bacterium liquid of expressing through fermentation inducement adopts means purifying such as bioseparation technology and obtains having human IgG
1The recombinant human endothelial cell of Fc fragment molecular structure generates supressor protein, and (protein amino acid sequence and gene fragment are seen attached list and one are had human IgG
1The 5: PN: WO03080648 SEQID: 5 claimed protein of Fc fragment molecular structure-Endostatin gene, the amino acid complete sequence).
H. adopt bovine adrenal capillary endothelial cell (BCE) to be cultured on 24 well culture plates, cell concn is 12500 cells/well, and every hole adds the human IgG that has of 1 nanogram bFGF and different concns
1The recombinant human endothelial cell of Fc fragment molecular structure generates supressor--Endostatin albumen, cultivates after 3 days and measures the activity that suppresses capillary endothelial cell propagation by cell counting and cell dyeing method.
Above-mentioned resulting product has following characteristic:
A. its genophore is PLW205, and it is alcohol oxidase (AOX1) that its genophore is expressed promotor, replaces the natural alcohol oxidase gene of yeast;
Make up α-factor in the b.PLW205 genophore and have the secretion signal peptide sequence, target protein is secreted in the extracellular;
C. its genetically engineered host yeast is methanol evoked;
D. its goods are protein solubility, that need not the biologically active of renaturation and modification;
Said products being used for antineoplastic vascular generating treatment, is example with the experimentation on animals: with the mouse hypodermic inoculation tumour cell, make tumour grow to 100mm
3During the left and right sides, with the mouse random packet, the high, medium and low three kinds of various dose of subcutaneous injection has a human IgG respectively
1The recombinant human endothelial cell of Fc fragment molecular structure generates supressor--Endostatin albumen and physiological saline (control group), injects continuously 20 days, and experimental result shows and has human IgG
1The recombinant human endothelial cell of Fc fragment molecular structure generates supressor-Endostatin kinds of tumor cells is had tangible tumor-inhibiting action, and the obvious atrophy of tumor tissues and is not with human IgG
1Supressor--Endostatin compares can increase the Endostatin transformation period in the recombinant human endothelial cell generation of Fc fragment molecular structure, 10 times that reduce the Endostatin consumption make it have more meanings such as pharmacology, pharmacodynamics, pharmacokinetics, kinds of tumors are had treatment than obvious effects.The result is as follows:
The Mice Bearing Lewis Lung Cancer result of treatment
Have human IgG
1The 5: PN: WO03080648 SEQID: 5 claimed protein Endostatin gene of Fc fragment molecular structure, the amino acid complete sequence
ATG AGA TTT CCT TCA ATT TTT ACT GCT GTT TTA TTC GCA GCA TCC TCC GCA TTA GCT CGT CCA
TAC?TCT?AAA?GGA?AGT?TAA?AAA?TGA?CGA?CAA?AAT?AAG?CGT?CGT?AGG?AGG?CGT?AAT?CGA?CGA?GGT
Met?Arg?Pho?Pro?Ser?Ile?Phe?Thr?Ala?Val?Leu?Phe?Ala?Ala?Ser?Ser?Ala?Leu?Ala?Ala?Pro
GTC?AAC?ACT?ACA?ACA?GAA?GAT?GAA?ACG?GCA?CAA?ATT?CCG?GCT?GAA?GCT?GTC?ATC?GGT?TAC?TCA
CAG?TTG?TGA?TGT?TGT?CTT?CTA?CTT?TGC?CGT?GTT?TAA?GGC?CGA?CTT?CGA?CAG?TAG?CCA?ATG?AGT
Val?Asn?Thr?Thr?Thr?Glu?Asp?Glu?Thr?Ala?Gln?He Pro?Ala?Glu?Ala?Val?Ile?Gly?Tyr?Ser
GAT?TTA?GAA?GGG?GAT?TTC?GAT?GTT?GCT?GTT?TTG?CCA?TTT?TCC?AAC?AGC?ACA?AAT?AAC?GGG?TTA
CTA?AAT?CTT?CCC?CTA?AAG?CTA?CAA?CGA?CAA?AAC?GGT?AAA?AGG?TTG?TCG?TGT?TTA?TTG?CCC?AAT
Asp?Leu?Glu?Gly?Asp?Phe?Asp?Val?Ala?Val?Leu?Pro?Phe?Ser?Asn?Ser?Thr?Asn?Asn?Gly?Leu
TTG?TTT?ATA?AAT?ACT?ACT?ATT?GCC?AGC?ATT?GCT?GCT?AAA?GAA?GAA?GGG?GTA?TCT?CTC?GAG?AAA
AAC?AAA?TAT?TTA?TGA?TGA?TAA?CGG?TCG?TAA?CGA?CGA?TTT?CTT?CTT?CCC?CAT?AGA?GAG?CTC?TTT
Leu?Phe?Ile?Asn?Thr?Thr?Ile?Ala?Ser?Ile?Ala?Ala?Lys?Glu?Glu?Gly?Val?Ser?Leu?Glu?Lys
AGA?GAG?GCT?CAC?AGC?CAC?CGC?GAC?TTC?CAG?CCG?GTG?CTC?CAC?CTG?GTT?GCG?CTC?AAC?AGC?CCC
TCT?CTC?CGA?GTG?TCG?GTG?GCG?CTG?AAG?GTC?GGC?CAC?GAG?GTG?GAC?CAA?CGC?GAG?TTG?TCG?GGG
Arg?Glu?Ala?His?Ser?His?Arg?Asp?Phe?Gln?Pro?Val?Leu?His?Leu?Val?Ala?Leu?Asn?Ser?Pro
CTG?TCA?GGC?GGC?ATG?CGG?GGC?ATC?CGC?GGG?GCC?GAC?TTC?CAG?TGC?TTC?CAG?CAG?GCG?CGG?GCC
GAC?AGT?CCG?CCG?TAC?GCC?CCG?TAG?GCG?CCC?CGG?CTG?AAG?GTC?ACG?AAG?GTC?GTC?CGC?GCC?CGG
Leu?Ser?Gly?Gly?Met?Arg?Gly?He Arg?Gly?Ala?Asp?Phe?Gln?Cys?Phe?Gln?Gln?Ala?Arg?Ala
GTG?GGG?CTG?GCG?GGC?ACC?TTC?CGC?GCC?TTC?CTG?TCC?TCG?CGC?CTG?CAG?GAC?CTG?TAC?AGC?ATC
CAC?CCC?GAC?CGC?CCG?TGG?AAG?GCG?CGG?AAG?GAC?AGG?AGC?GCG?GAC?GTC?CTG?GAC?ATG?TCG?TAG
Val?Gly?Leu?Ala?Gly?Thr?Phe?Arg?Ala?Phe?Leu?Ser?Ser?Arg?Leu?Gln?Asp?Leu?Tyr?Ser?Ile
GTG?CGC?CGT?GCC?GAC?CGC?GCA?GCC?GTG?CCC?ATC?GTC?AAC?CTC?AAG?GAC?GAG?CTG?CTG?TTT?CCC
CAC?GCG?GCA?CGG?CTG?GCG?CGT?CGG?CAC?GGG?TAG?CAG?TTG?GAG?TTC?CTG?CTC?GAC?GAC?AAA?GGG
Val?Arg?Arg?Ala?Asp?Arg?Ala?Ala?Val?Pro?Ile?Val?Asn?Leu?Lys?Asp?Glu?Leu?Leu?Phe?Pro
AGC?TGG?GAG?GCT?CTG?TTC?TCA?GGC?TCT?GAG?GGT?CCG?CTG?AAG?CCC?GGG?GCA?CGC?ATC?TTC?TCC
TCG?ACC?CTC?CGA?GAC?AAG?AGT?CCG?AGA?CTC?CCA?GGC?GAC?TTC?GGG?CCC?CGT?GCG?TAG?AAG?AGG
Ser?Trp?Glu?Ala?Leu?Phe?Ser?Gly?Ser?Glu?Gly?Pro?Leu?Lys?Pro?Gly?Aal?Arg?Ile?Phe?Ser
TTT?GAC?GGC?AAG?GAC?GTC?CTG?AGG?CAC?CCC?ACC?TGG?CCC?CAG?AAG?AGC?GTG?TGG?CAT?GGC?TCG
AAA?CTG?CCG?TTC?CTG?CAG?GAC?TCC?GTG?GGG?TGG?ACC?GGG?GTC?TTC?TCG?CAC?ACC?GTA?CCG?AGC
Phe?Asp?Gly?Lys?Asp?Val?Leu?Arg?His?Pro?Thr?Trp?Pro?Gln?Lys?Ser?Val?Trp?His?Gly?Ser
GAC?CCC?AAC?GGG?CGC?AGG?CTG?ACC?GAG?AGC?TAC?TGT?GAG?ACG?TGG?CGG?ACG?GAG?GCT?CCC?TCG
CTG?GGG?TTG?CCC?GCG?TCC?GAC?TGG?CTC?TCG?ATG?ACA?CTC?TGC?ACC?GCC?TGC?CTC?CGA?GGG?AGC
Asp?Pro?Asn?Gly?Arg?Arg?Leu?Thr?Gln?Ser?Tyr?Cys?Glu?Thr?Trp?Arg?Thr?Glu?Ala?Pro?Ser
GCC?ACG?GGC?CAG?GCC?TCC?TCG?CTG?CTG?GGG?GGC?AGG?CTC?CTG?GGG?CAG?AGT?GCC?GCG?AGC?TGC
CGG?TGC?CCG?GTC?CGG?AGG?AGC?GAC?GAC?CCC?CCG?TCC?GAG?GAC?CCC?GTC?TCA?CGG?CGC?TCG?ACG
Ala?Thr?Gly?Gln?Ala?Ser?Ser?Leu?Leu?Gly?Gly?Arg?Leu?Leu?Gly?Gln?Ser?Ala?Ala?Ser?Cys
CAT?CAC?GCC?TAC?ATC?GTG?CTC?TGC?ATT?GAG?AAC?AGC?TTC?ATG?ACT?GCC?TCC?AAG?TAG?TAA
GTA?GTG?CGG?ATG?TAG?CAC?GAG?ACG?TAA?CTC?TTG?TCG?AAG?TAC?TGA?CGG?AGG?TTC?ATC?ATT
His?His?Ala?Tyr?Ile?Val?Leu?Cys?Ile?Glu?Asa?Ser?Phe?Met?Thr?Ala?Ser?Lys?Gly?Gly?Gly?Gly?Ser?Gly?Gly gga?gga?agc?gga?ggt?gga?ggg?tcc?GTC?GAC?AAA?ACT?CAC?ACA?TGC?CCA?CCG?TGC?CCA cct?cct?tcg?cct?cca?cct?ccc?agg?CAG?CTG?TTT?TGA?GTG?TGT?ACG?GGT?GGC?ACG?GGT
Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Val?Asp?Lys?Thr?His?Thr?Cys?Pro?Pro?Cys?Pro GCA?CCT?GAA?CTC?CTG?GGG?GGA?CCG?TCA?GTC?TTC?CTC?TTC?CCC?CCA?AAA?CCC?AAG?GAC CGT?GGA?CTT?GAG?GAC?CCC?CCT?GGC?AGT?CAG?AAG?GAG?AAG?GGG?GGT?TTT?GGG?TTC?CTG
Ala?Pro?Glu?Leu?Leu?Gly?Gly?Pro?Ser?Val?Phe?Leu?Phe?Pro?Pro?Lys?Pro?Lys?Asp ACC?CTC?ATG?ATC?TCC?CGG?ACC?CCT?GAG?GTC?ACA?TGC?GTG?GTG?GTG?GAC?GTG?AGC?CAC TGG?GAG?TAC?TAG?AGG?GCC?TGG?GGA?CTC?CAG?TGT?ACG?CAC?CAC?CAC?CTG?CAC?TCG?GTG
Thr?Leu?Met?Iie?Ser?Arg?Thr?Pro?Glu?Val?Thr?Cys?Val?Val?Val?Asp?Val?Ser?His GAA?GAC?CCT?GAG?GTC?AAG?TTC?AAC?TGG?TAC?GTG?GAC?GGC?GTG?GAG?GTC?CAT?AAT?GCC CTT?CTG?GGA?CTC?CAG?TTC?AAG?TTG?ACC?ATG?CAC?CTG?CCG?CAC?CTC?CAC?GTA?TTA?CGG
Glu?Asp?Pro?Gln?Val?Lys?Phe?Asn?Trp?Tyr?Val?Asp?Gly?Val?Glu?Val?His?Asn?Ala AAG?ACA?AAG?CCG?CGG?GAG?GAG?CAG?TAC?AAC?AGC?ACG?TAC?CGT?GTG?GTC?AGC?GTC?CTC TTC?TGT?TTC?GGC?GCC?CTC?CTC?GTC?ATG?TTG?TCG?TGC?ATG?GCA?CAC?CAG?TCG?CAG?GAG
Lys?Thr?Lys?Pro?Arg?Glu?Glu?Gla?Tyr?Asn?Ser?Thr?Tyr?Arg?Val?Val?Ser?Val?Leu ACC?GTC?CTG?CAC?CAG?GAC?TGG?CTG?AAT?GGC?AAG?GAG?TAC?AAG?TGC?AAG?GTC?TCC?AAC TGG?CAG?GAC?GTG?GTC?CTG?ACC?GAC?TTA?CCG?TTC?CTC?ATG?TTC?ACG?TTC?CAG?AGG?TTG
Thr?Val?Leu?His?Gln?Asp?Trp?Leu?Asn?Gly?Lys?Glu?Tyr?Lys?Cys?Lys?Val?Ser?Asn AAA?GCC?CTC?CCA?GCC?CCC?ATC?GAG?AAA?ACC?ATC?TCC?AAA?GCC?AAA?GGG?CAG?CCC?CGA TTT?CGG?GAG?GGT?CGG?GGG?TAG?CTC?TTT?TGG?TAG?AGG?TTT?CGG?TTT?CCC?GTC?GGG?GCT
Lys?Ala?Leu?Pro?Ala?Pro?IIe?Glu?Lys?Thr?IIE?Ser?Lys?Ala?Lys?Gly?Gln?Pro?Arg GAA?CCA?CAG?GTG?TAC?ACC?CTG?CCC?CCA?TCC?CGG?GAT?GAG?CTG?ACC?AAG?AAC?CAG?GTC CTT?GGT?GTC?CAC?ATG?TGG?GAC?GGG?GGT?AGG?GCC?CTA?CTC?GAC?TGG?TTC?TTG?GTC?CAG
Glu?Pro?Gln?Val?Tyr?Thr?Leu?Pro?Pro?Ser?Arg?Asp?Glu?Leu?Thr?Lys?Asn?Gln?Val AGC?CTG?ACC?TGC?CTG?GTC?AAA?GGC?TTC?TAT?CCC?AGC?GAC?ATC?GCC?GTG?GAG?TGG?GAG TCG?GAC?TGG?ACG?GAC?CAG?TTT?CCG?AAG?ATA?GGG?TCG?CTG?TAG?CGG?CAC?CTC?ACC?CTC
Ser?Leu?Thr?Cys?Leu?Val?Lys?Gly?Phe?Tyr?Pro?Ser?Asp?Ile?Ala?Val?Glu?Trp?Glu AGC?AAT?GGG?CAG?CCG?GAG?AAC?AAC?TAC?AAG?ACC?ACG?CCT?CCC?GTG?TTG?GAC?TCC?GAC TCG?TTA?CCC?GTC?GGC?CTC?TTG?TTG?ATG?TTC?TGG?TGC?GGA?GGG?CAC?AAC?CTG?AGG?CTG
Ser?Asn?Gly?Gln?Pro?Glu?Asn?Asn?Tyr?Lys?Thr?Thr?Pro?Pro?Val?Leu?Asp?Ser?Asp GGC?TCC?TTC?TTC?CTC?TAC?AGC?AAG?CTC?ACC?GTG?GAC?AAG?AGC?AGG?TGG?CAG?CAG?GGG CCG?AGG?AAG?AAG?GAG?ATG?TCG?TTC?GAG?TGG?CAC?CTG?TTC?TCG?TCC?ACC?GTC?GTC?CCC
Gly?Ser?Phe?Phe?Leu?Tyr?Ser?Lys?Leu?Thr?Val?Asp?Lys?Ser?Arg?Trp?Gln?Gln?Gly AAC?GTC?TTC?TCA?TGC?TCC?GTG?ATG?CAT?GAG?GCT?CTG?CAC?AAC?CAC?TAC?ACG?CAG?AAG TTG?CAG?AAG?AGT?ACG?AGG?CAC?TAC?GTA?CTC?CGA?GAC?GTG?TTG?GTG?ATG?TGC?GTC?TTC
Asn?Val?Phe?Ser?Cys?Ser?Val?Met?His?Glu?Ala?Leu?His?Asn?His?Tyr?Thr?Gln?Lys AGC?CTC?TCC?CTG?TCT?CCC?GGG?AAA?TGA?GTGCGGC?GGCCGCCAGC?TTTCTAGAAC?AAAAACTCAT TCG?GAG?AGG?GAC?AGA?GGG?CCC?TTT?ACT?CACGCCG?CCGGCGGTCG?AAAGATCTTG?TTTTTGAGTA
Ser?Leu?Ser?Leu?Ser?Pro?Gly?Lys…
Claims (3)
1. one kind has human IgG
1The preparation method that the recombinant human endothelial cell of Fc fragment molecular structure generates supressor-Endostatin gets through gene clone, saccharomycetes to make fermentation and purge process preparation, and its step is as follows:
A. screen from human fetal kidney cell cDNA library by PCR method and obtain human collagen 18--human typeXVIII collagen gene 1503 to 2055cDNA active fragmentss, at first synthetic two kinds of primers are respectively CCGCTCTCGAGAAAAGAGAGGCTCACAGC and CGCGGATCCACCACCTCCCTTGGAGGCAGTCATGAAGCT, with human fetal kidney cell cDNA storehouse is template, does 30 circulations in 2 minutes altogether with 94 ℃ 2 minutes, 55 ℃ of PCR conditions 2 minutes and 72 ℃ and obtains the recombinant human endothelial cell and generate supressor-Endostatin gene fragment;
B. new gene fragment clone is gone in the TA Vectohk plasmid, by two kinds of endonuclease digestions, the 576bp gene fragment that obtains through the electrophoresis purifying;
C. and then synthetic two kinds of primers: GGT GGA TCC GGT GGA GGA GGA AGCGGA GGT GGA GGG TCC GTC GAC AAA ACT CAC and CCG CGG CCGCCG CAC TCA TTT ACC CGG AGA CAG, with human fetal kidney cell cDNA storehouse is template, does the human IgG that 30 circulations obtain in 2 minutes altogether with 94 ℃ 2 minutes, 55 ℃ of PCR conditions 2 minutes and 72 ℃
1The Fc gene fragment;
D. the said gene fragment cloning is gone in the TA Vectohk plasmid, by two kinds of endonuclease digestions, the 729bp gene fragment that obtains through the electrophoresis purifying;
E. two gene fragments that the clone obtained are cloned in two kinds of restriction enzyme sites of pPICZ α A plasmid after connecting with ligase enzyme again, constitute the PLW205 genophore;
F. said gene carrier PLW205 is changed in the X--33 yeast, use dull and stereotyped cultivate obtain resistant strain after, the gene engineering microzyme strain-LW205 that obtains efficiently expressing through screening;
G. the bacterium liquid of expressing through fermentation inducement adopts the IgG that has that means purifying such as bioseparation technology obtains
1Fc recombinant human endothelial cell generates supressor Endostatin protein;
What h. purifying is obtained has an IgG
1Fc recombinant human endothelial cell generates supressor Endostatin albumen and joins in the bovine adrenal capillary endothelial cell nutrient solution that contains bFGF, cultivate after 3 days by cell counting and cell dyeing method, measure the activity that suppresses capillary endothelial cell propagation.
2. have following characteristic according to the described goods that obtain of claim 1:
A. its genophore is the PLW205 plasmid, and its plasmid expression promotor is alcohol oxidase AOX1, replaces the natural alcohol oxidase gene of yeast;
Make up α-factor in the b.PLW205 plasmid and have the secretion signal peptide sequence, target protein is secreted in the extracellular;
C. its genetically engineered host yeast is methanol evoked;
D. its goods are solubility, need not the protein of the biologically active of renaturation and modification.
3. one kind has human IgG
1Supressor--its goods of Endostatin become biological products to be used for the treatment of noumenal tumour as single formulation preparation to the segmental recombinant human endothelial cell generation of Fc molecular structure.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 00123347 CN1354186A (en) | 2000-11-30 | 2000-11-30 | Preparation method of recombinant human vascular endothelial cytopoiesis suppressor factor with human LgG1Fc fragment molecular structure and application of its product |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 00123347 CN1354186A (en) | 2000-11-30 | 2000-11-30 | Preparation method of recombinant human vascular endothelial cytopoiesis suppressor factor with human LgG1Fc fragment molecular structure and application of its product |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1354186A true CN1354186A (en) | 2002-06-19 |
Family
ID=4589798
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 00123347 Pending CN1354186A (en) | 2000-11-30 | 2000-11-30 | Preparation method of recombinant human vascular endothelial cytopoiesis suppressor factor with human LgG1Fc fragment molecular structure and application of its product |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1354186A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105037538A (en) * | 2015-08-31 | 2015-11-11 | 武汉班科生物技术有限责任公司 | Optimized Fc fragment and optimizing method and application thereof |
| CN106674352A (en) * | 2015-11-10 | 2017-05-17 | 孙嘉琳 | Derivative of anti-tumor protein endostatin and application |
-
2000
- 2000-11-30 CN CN 00123347 patent/CN1354186A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105037538A (en) * | 2015-08-31 | 2015-11-11 | 武汉班科生物技术有限责任公司 | Optimized Fc fragment and optimizing method and application thereof |
| CN106674352A (en) * | 2015-11-10 | 2017-05-17 | 孙嘉琳 | Derivative of anti-tumor protein endostatin and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1279059C (en) | Fc fusion protein of human granulocyte colony stimulin with enhanced bioactivity | |
| JPH0536031B2 (en) | ||
| CN1031465C (en) | The peptide cDNA clone that existing human granulocyte meloschisis phagocyte of coding schedule and eosinophie cellular growth activity are many | |
| CN1106846C (en) | Carcinostatic agents | |
| CN113735959B (en) | FGF analogue for treating NASH | |
| CN1354186A (en) | Preparation method of recombinant human vascular endothelial cytopoiesis suppressor factor with human LgG1Fc fragment molecular structure and application of its product | |
| CN1339973A (en) | Gene therapy for diabetic ischemic disease | |
| CN1204145C (en) | Preparation of human vasal endothelial cell growth inhibitor and its application in tumor angiogenesis resisting treatment | |
| EP1549675A2 (en) | Glycosylated human interferon alpha isoform | |
| CN1065875C (en) | Fibrillating cell growth factor-2 analogue and its production method and use | |
| CN104558148A (en) | Ciliary neurotrophic factor mutant, and modified mutant and application thereof | |
| CN100335633C (en) | Method for preparing N-end acetylation modified thymosin alpha with recombined E. coli | |
| CN1232532C (en) | Fibroblast growth factor-2 analogue, producing process and application thereof | |
| CN107253994A (en) | A kind of fusion protein being made up of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha and preparation method thereof | |
| CN1227361C (en) | Method of expressing thymys peptide alpha by yeast and use thereof | |
| CN1199993C (en) | N-terminal deletion lipocyte complement related protein and its preparation method | |
| CN1057564C (en) | Microbe capable of producing active recombinant phycobiliprotein and its preparing method | |
| CN1916023A (en) | Polypeptide in small molecule of endothelium inhibin, nucleotide sequence for encoding the polypeptide and complementary strand | |
| CN1024350C (en) | Nucleic acid derivatives | |
| CN1654647A (en) | Method for producing recombinant human lactoferrin in silkworm body by gene engineering technology | |
| CN1100464A (en) | Human tumor necrosin & derivative and its preparing method | |
| WO1985004186A2 (en) | A modified gamma interferon, dna sequences encoding it and processes for producing it | |
| CN1654071A (en) | Biological fluid film of recombined human keratinized cell growth factor-2 and its preparing process | |
| CN1401387A (en) | Tumor suppressing polypeptide TSF and gene therapy vector composition | |
| KR20120057416A (en) | Polynucleotide for preparing human G-CSF and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |