CN1319676A - Use of wheat leaf blade in polymerase chain reaction and random amplification length pleiomorphy reaction - Google Patents

Use of wheat leaf blade in polymerase chain reaction and random amplification length pleiomorphy reaction Download PDF

Info

Publication number
CN1319676A
CN1319676A CN 01108040 CN01108040A CN1319676A CN 1319676 A CN1319676 A CN 1319676A CN 01108040 CN01108040 CN 01108040 CN 01108040 A CN01108040 A CN 01108040A CN 1319676 A CN1319676 A CN 1319676A
Authority
CN
China
Prior art keywords
reaction
rapd
wheat leaf
template
leaf blade
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN 01108040
Other languages
Chinese (zh)
Other versions
CN1143897C (en
Inventor
杨剑波
汪秀峰
李莉
向太和
吴丽芳
皮桃花
倪大虎
吴家道
张盘娣
张毅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Anhui Academy of Agricultural Sciences
Original Assignee
Anhui Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Anhui Academy of Agricultural Sciences filed Critical Anhui Academy of Agricultural Sciences
Priority to CNB01108040XA priority Critical patent/CN1143897C/en
Publication of CN1319676A publication Critical patent/CN1319676A/en
Application granted granted Critical
Publication of CN1143897C publication Critical patent/CN1143897C/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

In invented method, 1-2 cm of wheat leaf, through alkali treatment, directly is used as template for PCR reaction and RAPD reaction, and combined with specific amplification reaction component and reaction program so as to obtain clear reaction result. Said method possesses the advantages of quick reaction speed, simple and conveneint application, good keproducibility and less damage to tested plant.

Description

Wheat leaf blade is directly used in polymerase chain and the reaction of random amplification length polymorphism
The present invention relates to a kind of wheat leaf blade directly is used for polymerase chain reaction and random primer polymorphism amplified reaction as template after alkaline purification method.
Continuous development along with Protocols in Molecular Biology, produced multiple molecular marking technique, analyzed as random amplification length polymorphism (RAPD), amplified fragment length polymorphism (AFLP) and simple repeated sequence (SSR) etc. based on polymerase chain reaction (PCR).These labeling techniques can be used for the aspects such as tracking, the assignment of genes gene mapping, genetic mapping and gene isolation of species specificity evaluation, external source quiding gene.The first step of these labeling techniques promptly need be extracted the genomic dna of sample to be checked, with the definite DNA concentration of extracting of nucleic acid quantification analysis, gets an amount of DNA as template, carries out corresponding polymerase chain reaction again.Expensive plant and instrument such as biochemical reagents that conventional plant leaf extraction DNA need be correlated with and high-speed refrigerated centrifuge, and the time of extracting a duplicate samples is longer, workload is bigger, when especially carrying out the tracking detection of specific gene and polymorphism analysis, sample size is many during because of detection, and more seeming with ordinary method extraction genomic dna wastes time and energy and the cost height.
The present invention uses the alkaline purification wheat leaf blade directly as PCR and RAPD reaction template, and in conjunction with improving reaction conditions and response procedures, its purpose is to found a kind of novel method of carrying out the DNA of plants amplification fast, effectively, easily.
Particular content of the present invention is:
1. the alkaline purification of blade
Some wheat leaf blades of clip (back claims blade), every length of a film 1~2cm.The blade input is filled in the centrifuge tube of 0.2~0.3mol/LNaOH, in boiling water, boiled 20~35 seconds; Take out centrifuge tube and in centrifuge tube, add HCl and a certain amount of 0.5mol/LTris HCl solution (pH8.0) of equivalent, in boiling water, hatched again 1~3 minute after shaking up.Take out blade, just can be used as template and be directly used in PCR reaction and RAPD reaction.
2. directly react with the alkaline purification blade as the PCR reaction and the RAPD of template
This PCR reaction and RAPD react sex change, the annealing that need be provided with equally, extend several circulations on the DNA cloning instrument, reaction product is through agarose gel electrophoresis, dyeing, observation and Taking Pictures recording.Different is different in view of template, and employed reaction buffer is different from the conventional damping fluid that uses during reaction.Reaction buffer used in the present invention is: 10~20mmol/L (NH 4) 2SO 4, 1.5~3.0mmol/L MgCl 2, 50~80mmol/L Tris-HCl (pH8.8).
3. directly react with the alkaline purification blade as the PCR reaction and the RAPD of template
1. PCR reaction.Per 20 μ l add the above-mentioned reaction buffer of 2 μ l, and add 200mmol/L dNTP, the forward and reverse primer of the PCR of each 10pmol, the Taq archaeal dna polymerase of 2U and about 2mm 2The alkaline purification blade is used aseptic bi-distilled water fixation to 20 μ l at last.On PE9600 type DNA cloning instrument (U.S.'s product), increase.Response procedures is: after 95 ℃ of sex change in 1 minute, carry out 40 circulations by 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ settings in 1 minute.
2. RAPD reaction.Add the above-mentioned reaction buffer of 3.5 μ l in per 35 μ l reaction, and add 100mmol/LdNTP, the 10 aggressiveness random primers of 200 pmol, the Taq archaeal dna polymerase of 2U and about 2mm 2The alkaline purification blade uses aseptic bi-distilled water quantitatively to 35 μ l at last.On PE9600 type DNA cloning instrument (U.S.'s product), increase.Response procedures is: after 94 ℃ of sex change in 5 minutes, carry out 35 circulations by 94 ℃ 1 minute, 36 ℃ 1 minute, 72 ℃ settings of 2 minutes, extended 5 minutes down at 72 ℃ after the loop ends.
Electrophoresis 1.5 hours (5v/cm) on PCR reaction and RAPD reaction product 1.4% sepharose is the DNA standard molecular weight with λ DNA+EcoR I+Hind III, ethidium bromide staining, observation, Taking Pictures recording under the UV-light.
The present invention substitutes with the alkaline purification blade and extracts the template of plant leaf genomic dna to be measured as PCR reaction and RAPD reaction, identify and assist in the seed selection of field breeding material in crop varieties kind and purity, make detect the required time shorten greatly, experimental cost reduces significantly.For example, technician of the testing of 300 parts of testing samples can finish in one day.Present method is not only quick, easy, and the result is clear, good reproducibility, accurately and reliably, less to the damage of plant to be measured, the person is desirable to be the breeding work, also is the analysis system of a kind of molecule marker of acceptable.
The present invention is applied to aspects such as the trace detection, polymorphism analysis of wheat goal gene, is shortened, experimental cost reduces significantly the time of detection greatly.
Fig. 1, Fig. 2 are PCR reaction amplifications.
Fig. 3 is a RAPD reaction amplification.
Non-limiting examples:
One, the alkaline purification of wheat leaf blade
1. clip wheat leaf blade (3 leaf phase the best) 1~2cm, put into the centrifuge tube that contains 200 μ l 0.2mol/L NaOH, to boil 35 seconds in this centrifuge tube insertion boiling water, take out and add 200 μ l 0.2mol/L HCl and 100 μ l0.5mol/L Tris-HCl (pH8.0, contain 0.25% (v/v) Nonidet P40), once more this pipe is put into boiling water and hatched 3 minutes, last picking a slice (about 2mm 2) template of directly reacting as PCR reaction and RAPD through the blade of above-mentioned alkaline purification.
2. clip wheat leaf blade (3 leaf phase the best) 1~2cm, put into the centrifuge tube that contains 200 μ l 0.25mol/L NaOH, to boil 30 seconds in this centrifuge tube insertion boiling water, take out and add 200 μ l 0.25mol/L HCl and 100 μ l 0.5mol/L Tris-HCl (pH8.0, contain 0.25% (v/v) Nonidet P40), once more this pipe is put into boiling water and hatched 2 minutes, last picking a slice (about 2mm 2) template of directly reacting as PCR reaction and RAPD through the blade of above-mentioned alkaline purification.
3. clip wheat leaf blade (3 leaf phase the best) 1~2cm, put into the centrifuge tube that contains 200 μ l 0.3mol/L NaOH, to boil 35 seconds in this centrifuge tube insertion boiling water, take out and add 200 μ l0.3mol/LHCl and 100 μ l0.5mol/L Tris-HCl (pH8.0, contain 0.25% (v/v) Nonidet P40), once more this pipe is put into boiling water and hatched 1 minute, last picking a slice (about 2mm 2) template of directly reacting as PCR reaction and RAPD through the blade of above-mentioned alkaline purification.
Two, the wheat leaf blade with alkaline purification directly reacts as the PCR reaction and the RAPD of template
4. preparation reaction buffer.The composition and the concentration of reaction buffer are as follows: 10~20mmol/L (NH 4) 2SO 4, 1.5~3.0mmol/L MgCl 2With 50~80mmol/L Tris-HCl (pH8.8).
5. utilize the alkaline purification blade directly to carry out the Analysis and Identification of PCR reactive applications in transgenic line as template.
Select for use wheat to change the regeneration plant F of chitinase gene and Gus gene 2In generation, carries out pcr analysis as material and identifies.Get F 1The Dai Suojie seed (is F 2Generation) 20-25 ℃, water planting is about 20 days, after the long aforesaid alkaline purification of vanes of clip 1-2cm directly as the template of PCR reaction.Simultaneously, in contrast, extract wheat cdna group DNA according to a conventional method accordingly, get the template of 50ng after quantitatively as the PCR reaction.
The primer that the PCR reaction is used sees Table 1.Other conditions of PCR reaction as described above.
Table 1 PCR reaction and RAPD react employed primer and sequence
The primer code name Primer sequence (5 ' → 3 ') Detect gene
????1 # Forward: GGGATCCATCGCAGCGTAATG is reverse: GCCGACAGCAGC AGTTTC ATC Detect the Gus gene
????2 # Forward: GTAACATAGATGACACCG CG is reverse: GCCTCTGCTGCAGCCAGTACG Detect chitinase gene
????3 # ????????????GGACTGGAGT The RAPD polymorphism analysis
Pcr amplification the results are shown in Figure 1 and Fig. 2.Fig. 1 is for detecting the result of chitinase gene, and Fig. 2 is for detecting the result of Gus gene.In Fig. 1 and Fig. 2, M is DNA standard molecular weight (a λ DNA+EcoR I+Hind III), 1-7 is the result that the inventive method is carried out the PCR reaction, 8-14 is the result that ordinary method is carried out the PCR reaction, wherein, 1 and 8,2 and 9,3 and 10,4 and 11,5 and 12,6 and 13,7 and 14 is respectively that same individual plant different methods carries out the PCR reaction result.PCR check and analysis result shows, it is in full accord that the inventive method and ordinary method are carried out the result of PCR reaction, and individual plant 1 and 8,2 and 9 chitinase gene and Gus gene are all lost, and all the other individual plants all contain this two kinds of genes.Chitinase gene and Gus gene amplification fragment all indicate with "  ".
6 utilize the alkaline purification blade directly to carry out the RAPD polymorphism analysis as template
Select 4 kinds of different wheat genotypes for use, mature seed 20-25 ℃, water planting were sprouted about 20 days, after the long aforesaid alkaline purification of vanes of clip 1-2cm directly as the template of RAPD reaction.Simultaneously, in contrast, the corresponding according to a conventional method wheat cdna group DNA that extracts gets the 50ng template that reaction is used as RAPD after quantitatively.The primer of RAPD reaction sees Table 1, and other condition of RAPD reaction as described above.
The RAPD amplification is seen Fig. 3.In Fig. 3, M is DNA standard molecular weight (a λ DNA+EcoR I+Hind III), 1-4 is the result that the inventive method is carried out the PCR reaction, 5-8 is the result that ordinary method is carried out the RAPD reaction, and wherein 1 and 5,2 and 6,3 and 7,4 and 8 is respectively that same genotype different methods carries out the result that RAPD analyzes.The RAPD analytical results shows that the result who carries out the RAPD reaction with the inventive method and ordinary method is in full accord.4 kinds of different wheat varieties being analyzed use 3 #Primer all amplifies 3 master tapes clearly, does not see polymorphism difference.

Claims (2)

1. a wheat leaf blade directly is used for the alkali treatment method that PCR reacts and RAPD reacts as template, it is characterized in that: clip is for examination wheat leaf blade 1-2cm, put into the centrifuge tube that contains 200 μ l 0.2-0.3mol/L NaOH, to boil 20-35 second in this centrifuge tube insertion boiling water, take out the HCl and the 100 μ l 0.5mol/L Tris-HCl (pH8.0) that add equivalent, again this pipe is put into boiling water and hatched 1-3 minute, take out blade.
2. directly react with the alkaline purification wheat leaf blade as the PCR reaction and the RAPD of template, be included in the some circulations of sex change, annealing, extension that are provided with on the DNA cloning instrument and agarose gel electrophoresis, dyeing and the observation of reaction product, it is characterized in that: the reaction buffer of following composition of adding and concentration in PCR reaction and the RAPD reaction: 10-20 mmol/L (NH 4) 2SO 4, 1.5-3.0mmol/LMgCl 2, 50-80 mmol/LTris-HCl (pH8.8).
CNB01108040XA 2001-01-09 2001-01-09 Use of wheat leaf blade in polymerase chain reaction and random amplification length pleiomorphy reaction Expired - Fee Related CN1143897C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CNB01108040XA CN1143897C (en) 2001-01-09 2001-01-09 Use of wheat leaf blade in polymerase chain reaction and random amplification length pleiomorphy reaction

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNB01108040XA CN1143897C (en) 2001-01-09 2001-01-09 Use of wheat leaf blade in polymerase chain reaction and random amplification length pleiomorphy reaction

Publications (2)

Publication Number Publication Date
CN1319676A true CN1319676A (en) 2001-10-31
CN1143897C CN1143897C (en) 2004-03-31

Family

ID=4656930

Family Applications (1)

Application Number Title Priority Date Filing Date
CNB01108040XA Expired - Fee Related CN1143897C (en) 2001-01-09 2001-01-09 Use of wheat leaf blade in polymerase chain reaction and random amplification length pleiomorphy reaction

Country Status (1)

Country Link
CN (1) CN1143897C (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103773869A (en) * 2014-01-17 2014-05-07 兰州大学 Preparation method and kit for directly utilizing medicago sativa radicles to PCR (Polymerase Chain Reaction) and kit
CN103773870A (en) * 2014-01-17 2014-05-07 兰州大学 Preparation method for directly applying gramineous forage grass radicle to RAPD (Random amplification polymorphism DNA) reaction and kit thereof
CN105002163A (en) * 2015-08-03 2015-10-28 湖南省农业生物技术研究中心 Kit used for extracting rice DNA and rice DNA extraction method

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103773869A (en) * 2014-01-17 2014-05-07 兰州大学 Preparation method and kit for directly utilizing medicago sativa radicles to PCR (Polymerase Chain Reaction) and kit
CN103773870A (en) * 2014-01-17 2014-05-07 兰州大学 Preparation method for directly applying gramineous forage grass radicle to RAPD (Random amplification polymorphism DNA) reaction and kit thereof
CN105002163A (en) * 2015-08-03 2015-10-28 湖南省农业生物技术研究中心 Kit used for extracting rice DNA and rice DNA extraction method

Also Published As

Publication number Publication date
CN1143897C (en) 2004-03-31

Similar Documents

Publication Publication Date Title
KR102286871B1 (en) Molecular marker for discriminating branchless watermelon cultivar and uses thereof
CN110777216A (en) Method for identifying purity of Jingke waxy 2000 corn hybrid based on SNP marker
CN102304587A (en) Method for rapidly identifying erect panicle of rice
CN112695124B (en) Phalaenopsis SSR molecular marker primer composition and application thereof
KR102298751B1 (en) Molecular marker based on chloroplast genome sequence for discriminating Codonopsis sp. and uses thereof
CN1143897C (en) Use of wheat leaf blade in polymerase chain reaction and random amplification length pleiomorphy reaction
Karaca et al. Minisatellites as DNA markers to classify bermudagrasses (Cynodon spp.): confirmation of minisatellite in amplified products
CN1143896C (en) Application of rice leaf in polymerase chain reaction
CN107988334B (en) Method for SNP typing by direct PCR of oral swab
KR101678851B1 (en) Primer set for diagnosing or detecting Plantain mottle virus and uses thereof
CN111088369A (en) Detection method, primer pair and application of sheep RORA gene insertion/deletion polymorphism
CN114703313B (en) Wild rice black powder fungus typing identification method and application thereof
KR102286875B1 (en) Molecular marker for discriminating branchless watermelon cultivar and uses thereof
KR102335806B1 (en) Molecular marker based on chloroplast genome sequence for discriminating Zizyphus jujuba 'SanJo' cultivar and uses thereof
CN112680542B (en) Universal SSR molecular marker primer composition for orchidaceae plants and application of universal SSR molecular marker primer composition
CN110093436B (en) SNP locus multicolor fluorescence detection primer, kit and detection method for identifying eucalyptus clone and application of SNP locus multicolor fluorescence detection primer
CN105631245A (en) Dedicated primer used for identifying superior clones of Populus deltoides Marsh. and identification method for superior clone of Populus deltoides Marsh.
CN104789558A (en) Molecular marker for rice gelatinization temperature control gene and application thereof
KR102174019B1 (en) Molecular marker based on chloroplast sequence for discriminating Codonopsis lanceolata and Codonopsis pilosula and uses thereof
CN103589797A (en) SNP (single nucleotide polymorphism) genotyping method and application thereof
CN113604590A (en) Fluorescent quantitative PCR detection method and kit for plant pathogenic bacteria Pantoea ananatis
CN107868846B (en) SSR molecular marker primer of quercus, method for identifying closely related quercus varieties and application of SSR molecular marker primer
CN108300796B (en) RAPD primer for distinguishing towel gourd varieties and application thereof
KR102451456B1 (en) Primer set for discriminating genetic polymorphism of Codonopsis lanceolata and uses thereof
RU2826148C1 (en) METHOD FOR DNA IDENTIFICATION AND GENETIC CERTIFICATION OF PERENNIAL AND ANNUAL RYEGRASS VARIETIES BASED ON SSR- AND SCoT-MARKING SYSTEMS

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20040331

Termination date: 20190109

CF01 Termination of patent right due to non-payment of annual fee