CN103773869A - Preparation method and kit for directly utilizing medicago sativa radicles to PCR (Polymerase Chain Reaction) and kit - Google Patents

Preparation method and kit for directly utilizing medicago sativa radicles to PCR (Polymerase Chain Reaction) and kit Download PDF

Info

Publication number
CN103773869A
CN103773869A CN201410023097.8A CN201410023097A CN103773869A CN 103773869 A CN103773869 A CN 103773869A CN 201410023097 A CN201410023097 A CN 201410023097A CN 103773869 A CN103773869 A CN 103773869A
Authority
CN
China
Prior art keywords
alfalfa
pcr
root
radicle
reaction
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201410023097.8A
Other languages
Chinese (zh)
Inventor
刘志鹏
马利超
罗栋
王彦荣
陈天龙
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Lanzhou University
Original Assignee
Lanzhou University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Lanzhou University filed Critical Lanzhou University
Priority to CN201410023097.8A priority Critical patent/CN103773869A/en
Publication of CN103773869A publication Critical patent/CN103773869A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention mainly relates to a method and a kit for directly utilizing medicago sativa radicles to a PCR (Polymerase Chain Reaction) and particularly relates to a method for directly utilizing root tips of the medicago sativa radicles as a PCR template to carry out an SSR (Simple Sequence Repeat) reaction after the root tips are treated by alkali. The method for directly utilizing the root tips of the medicago sativa radicles as the PCR template to carry out the SSR reaction has the following main characteristics that the root tips of the medicago sativa radicles are treated by a 0.25M NaOH water solution in a water bath of 100 DEG C for 40 seconds and then adding 400 microliters of 0.25M HCl and 200 microliters of 0.5M Tris-HCl (with the pH of 8.0); incubating in boiled water of 100 DEG C for 3 minutes; and directly utilizing the treated root tips as the PCR template to carry out the SSR reaction. A detection result shows that the technology has the characteristics of strong sensitivity, high accuracy, strong repeatability, rapidness and convenience and the like; particularly, the method is economical and effective when a tested group is large.

Description

Alfalfa radicle is directly used in preparation method and the test kit thereof of PCR reaction
Technical field
The present invention relates generally to the method for alfalfa PCR reaction.Be specifically related to the preparation method of alfalfa radicle for PCR reaction.
Background technology
Along with the development of Protocols in Molecular Biology, produce the multiple molecular marking technique based on polymerase chain reaction (Polymerase Chain Reaction, PCR), as simple repeated sequence (Simple Sequence Repeat, SSR) analysis waits (Vos etc., 2003; Akkaya etc., 1992; Charters etc., 1996).At present, molecular marking technique has been widely used in the aspects such as species specificity is identified, tracking, the assignment of genes gene mapping and the genetic map drafting of target gene.The first step of applying these labeling techniques must be extracted the genomic dna of testing sample, determines after concentration, gets in right amount as template, carries out corresponding pcr amplification.Method program complexity and workload that routine is prepared testing sample genomic dna are large, use molecule marker plant in when polymorphism analysis, often need to detect a large amount of colonies and individual plant, more seem waste time and energy and cost higher.Therefore, find a kind of fast, effectively, the novel method of carrying out easily DNA of plants amplification is very necessary, micro-satellite analysis system (Virk etc. fast and effectively in the plants such as Arabidopis thaliana, are set up although there is bibliographical information abroad, 1999), but have no report Dominant Species of Forage Grass crop as quick, easy, the effective DNA analysis system in alfalfa.
Summary of the invention
Object one of the present invention is to avoid the deficiencies in the prior art, proposes a kind of alfalfa radicle and is directly used in the preparation method that PCR reacts.
Object two of the present invention is to provide a kind of alfalfa radicle and is directly used in the test kit that PCR reacts.
To fast and efficiently a large amount of alfalfa colonies and individual plant are carried out to SSR detection analysis.This method is time saving and energy saving, easy and simple to handle, and can complete a large amount of work within a short period of time.Research shows, this method is all applicable for 15 parts of alfalfa individual plant samples choosing at random.
For achieving the above object, the technical scheme that the present invention takes is: a kind of alfalfa radicle is directly used in the preparation method of PCR reaction, it is characterized in that comprising the steps:
A. alfalfa seed adopts double-deck filter paper to sprout method, sprouts 72h at 25 ℃, cuts the long radicle tip of a root of 1-3mm for subsequent use;
B. the radicle tip of a root cutting in A step is put into the Eppendorf pipe containing 400 μ l0.25M NaOH, this centrifuge tube is inserted in 100 ℃ of boiling water and boils 40s, take out and add 400 μ l0.25M HCl and 200 μ l0.5M Tris-HCl pH8.0, again this pipe is put into 100 ℃ of boiling water and hatched 3min, directly carry out SSR reaction as pcr template through the alfalfa radicle tip of a root of above-mentioned alkaline purification.
Alfalfa radicle is directly used in a test kit for PCR reaction, it is characterized in that including:
PCR cumulative volume is 20 μ l, the alfalfa radicle tip of a root 1-3mm processing through steps A, B, 2 × PCR Master10 μ l, forward primer SSSR-F1 μ l, reverse primer SSR-R1 μ l, ddH 2o8 μ l.
Beneficial effect of the present invention: this method is time saving and energy saving, easy and simple to handle, can complete a large amount of work within a short period of time.Detected result shows, the present invention has that susceptibility is strong, accuracy rate is high, repeatability is strong and the feature such as rapid and convenient, when especially larger in tested colony, and this kind of method economical and effective that more seems.
Accompanying drawing explanation
Fig. 1 alfalfa radicle tip of a root.In figure: the about 2mm of alfalfa radicle tip of a root length;
Fig. 2 a shows the SSR response imaging design sketch take 15 parts of alfalfa individual plant genomic dnas as template;
The alfalfa radicle tip of a root that 15 parts of alfalfas of Fig. 2 b demonstration are prepared take the present invention is the SSR response imaging design sketch of template;
In figure: Fig. 2 a and Fig. 2 b primer are forward primer SSR1-F and reverse primer SSR1-R;
Fig. 3 a shows the SSR response imaging design sketch take 15 parts of alfalfa individual plant genomic dnas as template;
The alfalfa radicle tip of a root that 15 parts of alfalfas of Fig. 3 b demonstration are prepared take the present invention is the SSR response imaging design sketch of template;
In figure: Fig. 3 a and Fig. 3 b primer are forward primer SSR2-F and reverse primer SSR2-R,
Fig. 4 a be under light field condition the alfalfa radicle tip of a root through the EB imaging effect that dyes;
Fig. 4 b be under ultraviolet light conditions the alfalfa radicle tip of a root through the EB imaging effect that dyes.
In figure: CK represents without the alkaline purification alfalfa radicle tip of a root.
Embodiment
Below in conjunction with embodiment, principle of the present invention and feature are described, example, only for explaining the present invention, is not intended to limit scope of the present invention.
Embodiment 1: a kind of alfalfa radicle is directly used in the preparation method of PCR reaction, it is characterized in that comprising the steps:
A. alfalfa seed adopts double-deck filter paper to sprout method, sprouts 72h at 25 ℃, cuts the long radicle tip of a root of 1-3mm for subsequent use;
B. the radicle tip of a root cutting in A step is put into the Eppendorf pipe containing 400 μ l0.25M NaOH, this centrifuge tube is inserted in 100 ℃ of boiling water and boils 40s, take out and add 400 μ l0.25M HCl and 200 μ l0.5M Tris-HCl pH8.0, again this pipe is put into 100 ℃ of boiling water and hatched 3min, directly carry out SSR reaction as pcr template through the alfalfa radicle tip of a root of above-mentioned alkaline purification.
Embodiment 2: a kind of alfalfa radicle is directly used in the test kit of PCR reaction, it is characterized in that including:
PCR cumulative volume is 20 μ l, the alfalfa radicle tip of a root 1-3mm processing through steps A, B, 2 × PCR Master10 μ l, forward primer SSSR-F1 μ l, reverse primer SSR-R1 μ l, ddH 2o8 μ l.
Embodiment 3: a kind of alfalfa (" U.S. gold queen " kind, is stored in Lanzhou University's ley farming technical college seed bank) radicle tip of a root is directly used in the method for SSR reaction as pcr template, it comprises the steps:
A. alfalfa seed adopts double-deck filter paper to sprout method, sprouts 72h for 25 ℃, cuts the long radicle tip of a root of about 2mm for subsequent use, sees Fig. 1;
B. the radicle tip of a root cutting in A step is put into the Eppendorf pipe containing 400 μ l0.25M NaOH, this centrifuge tube is inserted in boiling water and boils 40s, take out and add 400 μ l0.25M HCl and 200 μ l0.5M Tris-HCl(pH8.0), again this pipe is put into boiling water and hatch 3min, directly carry out SSR reaction as pcr template through the alfalfa radicle tip of a root of above-mentioned alkaline purification.
The system of C.PCR reaction, PCR cumulative volume is 20 μ l, template is the alfalfa radicle tip of a root of step B alkaline purification, the raw chemical product numbering in 2 × PCR Master(Shanghai: SK2082) 10 μ l, forward primer SSSR-F1 μ l, reverse primer SSR-R1 μ l, ddH2O8 μ l.PCR method is: (1) 95 ℃ of denaturation 2min; (2) 95 ℃ of sex change 30s; (3) 55 ℃ of annealing 30s; (4) 72 ℃ are extended 30s; (5) 2~4 step cycle 38 times; (6) 72 ℃ are extended 7min.
D.PCR product detects effect through polyacrylamide gel electrophoresis, sees Fig. 2 and Fig. 3.
The SSR reaction of experimental example 1:15 part alfalfa take individual plant genomic dna as template and the SSR reaction effect contrast of the alfalfa radicle tip of a root of preparing take the present invention as template:
Using forward primer SSR1-F and reverse primer SSR1-R to carry out SSR reaction to 15 parts of alfalfa individual plants comprises the steps:
Forward primer SSR1-F is: GTCGTAGTAAACGTAAACAAAGAA
Reverse primer SSR1-R is: ACGGCAGGAACAGATCCTTGAA
This is preferred embodiment primer of the present invention to primer, in order to limit the present invention, within the spirit and principles in the present invention not all, any modification of doing, is equal to replacement, improvement etc., within all should being included in protection scope of the present invention.
(1). the SSR reaction that is template with 15 parts of alfalfas (" U.S. gold queen " kind, is stored in Lanzhou University's ley farming technical college seed bank) individual plant genomic dna
The genomic dna that extracts 15 parts of alfalfa individual plants, is 200ng/ μ l by its concentration dilution, as template, adopts forward primer SSR1-F and reverse primer SSR1-R to carry out SSR reaction.
PCR system is: the raw chemical product numbering in 2 × PCR Master(Shanghai: SK2082) 10 μ l, alfalfa genomic dna template 1 μ l, forward primer SSR1-F1 μ l, reverse primer SSR1-R1 μ l, ddH 2o7 μ l.PCR method is: (1) 95 ℃ of denaturation 2min; (2) 95 ℃ of sex change 30s; (3) 55 ℃ of annealing 30s; (4) 72 ℃ are extended 30s; (5) 2~4 step cycle 38 times; (6) 72 ℃ are extended 7min.
PCR product detects its effect through polyacrylamide gel electrophoresis:
Fig. 2 a shows that the electrophoretic band take 15 parts of alfalfa individual plant genomic dnas as template is clear bright.
(2) the alfalfa radicle tip of a root that .15 part alfalfa (" U.S. gold queen " kind, is stored in Lanzhou University's ley farming technical college seed bank) is prepared take the present invention is the SSR reaction effect of template
Adopt double-deck filter paper to sprout method 15 parts of alfalfa seeds, sprout 72h, cut the long radicle tip of a root of about 2mm for 25 ℃.
The radicle tip of a root cutting is put into the Eppendorf pipe containing 400 μ l0.25M NaOH, this centrifuge tube is inserted in boiling water and boils 40s, take out and add 400 μ l0.25M HCl and 200 μ l0.5M Tris-HCl(pH8.0), again this pipe is put into boiling water and hatch 3min, directly carry out SSR reaction as pcr template through the alfalfa radicle tip of a root of above-mentioned alkaline purification.
PCR system is: the raw chemical product numbering in 2 × PCR Master(Shanghai: SK2082) 10 μ l, the alfalfa radicle tip of a root of alkaline purification is as template, forward primer SSR1-F1 μ l, reverse primer SSR1-R1 μ l, ddH 2o8 μ l.PCR method is: (1) 95 ℃ of denaturation 2min; (2) 95 ℃ of sex change 30s; (3) 55 ℃ of annealing 30s; (4) 72 ℃ are extended 30s; (5) 2~4 step cycle 38 times; (6) 72 ℃ are extended 7min.
PCR product detects its effect through polyacrylamide gel electrophoresis:
Fig. 2 b shows using the alfalfa radicle tip of a root of 15 parts of alkaline purifications clear bright as the electrophoretic band of template, consistent with electrophoretic band effect in Fig. 2 a.
The SSR reaction of experimental example 2:15 part alfalfa take individual plant genomic dna as template and the SSR reaction effect contrast of the alfalfa radicle tip of a root of preparing take the present invention as template:
Using forward primer SSR2-F and reverse primer SSR2-R to carry out SSR reaction to 15 parts of alfalfa individual plants comprises the steps:
Forward primer SSR2-F is: CCAAACTCAGAACCCTAACCCAA
Reverse primer SSR2-R is: GAACTTGTCAAGACCCATGAAGA
This is preferred embodiment primer of the present invention to primer, in order to limit the present invention, within the spirit and principles in the present invention not all, any modification of doing, is equal to replacement, improvement etc., within all should being included in protection scope of the present invention.
(1). the SSR reaction that is template with 15 parts of alfalfas (" U.S. gold queen " kind, is stored in Lanzhou University's ley farming technical college seed bank) individual plant genomic dna:
The genomic dna that extracts 15 parts of alfalfa individual plants, is 200ng/ μ l by its concentration dilution, as template, adopts forward primer SSR2-F and reverse primer SSR2-R to carry out SSR reaction.
PCR system is: the raw chemical product numbering in 2 × PCR Master(Shanghai: SK2082) 10 μ l, alfalfa genomic dna template 1 μ l, forward primer primer SSR2-F1 μ l, reverse primer SSR2-R1 μ l, ddH 2o7 μ l.PCR method is with experimental example 1.
PCR product detects its effect through polyacrylamide gel electrophoresis:
Fig. 3 a shows that the electrophoretic band take 15 parts of alfalfa individual plant genomic dnas as template is clear bright.
(2). the SSR reaction effect that alfalfa (" U.S. gold queen " kind, is stored in Lanzhou University's ley farming technical college seed bank) the radicle tip of a root of preparing with 15 parts of the present invention is template
Adopt double-deck filter paper to sprout method 15 parts of alfalfa seeds, sprout 72h, cut the long radicle tip of a root of about 2mm for 25 ℃.
Alfalfa radicle tip of a root treatment process is with experimental example 1.
PCR system is: the raw chemical product numbering in 2 × PCR Master(Shanghai: SK2082) 10 μ l, the alfalfa radicle tip of a root of alkaline purification is as template, forward primer SSR2-F1 μ l, reverse primer SSR2-R1 μ l, ddH 2o8 μ l.PCR method is with (1).
PCR product detects its effect through polyacrylamide gel electrophoresis:
Fig. 3 b shows using the alfalfa radicle tip of a root of 15 parts of alkaline purifications clear bright as the electrophoretic band of template, consistent with electrophoretic band effect in Fig. 3 a.
Experimental example 3: the Fluirescence observation of the alfalfa radicle tip of a root prepared by the present invention, comprises the steps:
By the alfalfa radicle tip of a root of preparing through the present invention and ethidium bromide (EB) solution of putting into respectively 0.05mg/ml without the contrast tip of a root of alkaline purification, after reaction 30s, suck unnecessary liquid with thieving paper, under ultraviolet lamp, observe and take pictures.
Fig. 4 a shows, the alfalfa radicle tip of a root of preparing through the present invention under light field condition and all energy imagings of the contrast tip of a root without alkaline purification.
Fig. 4 b shows, the alfalfa radicle tip of a root through preparing through the present invention under UV-irradiation condition can imaging, and can not imaging without the tip of a root of alkaline purification.DNA in the alfalfa radicle root-tip cells that shows to prepare through the present invention has separated out and has been combined with EB, emitting fluorescence under the irradiation of UV-light, and then imaging.And without the alfalfa radicle tip of a root of alkaline purification, do not have DNA to separate out, and can not be combined with EB, can not produce fluorescence through UV-irradiation, then can not imaging.
The foregoing is only preferred embodiment of the present invention, in order to limit the present invention, within the spirit and principles in the present invention not all, any modification of doing, be equal to replacement, improvement etc., within all should being included in protection scope of the present invention.

Claims (2)

1. alfalfa radicle is directly used in a preparation method for PCR reaction, it is characterized in that comprising the steps:
A. alfalfa seed adopts double-deck filter paper to sprout method, sprouts 72h at 25 ℃, cuts the long radicle tip of a root of 1-3mm for subsequent use;
B. the radicle tip of a root cutting in A step is put into the Eppendorf pipe containing 400 μ l0.25M NaOH, this centrifuge tube is inserted in 100 ℃ of boiling water and boils 40s, take out and add 400 μ l0.25M HCl and 200 μ l0.5M Tris-HCl pH8.0, again this pipe is put into 100 ℃ of boiling water and hatched 3min, directly carry out SSR reaction as pcr template through the alfalfa radicle tip of a root of above-mentioned alkaline purification.
2. alfalfa radicle is directly used in a test kit for PCR reaction, it is characterized in that including:
PCR cumulative volume is 20 μ l, the alfalfa radicle tip of a root 1-3mm processing through steps A, B, 2 × PCR Master10 μ l, forward primer SSSR-F1 μ l, reverse primer SSR-R1 μ l, ddH 2o8 μ l.
CN201410023097.8A 2014-01-17 2014-01-17 Preparation method and kit for directly utilizing medicago sativa radicles to PCR (Polymerase Chain Reaction) and kit Pending CN103773869A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410023097.8A CN103773869A (en) 2014-01-17 2014-01-17 Preparation method and kit for directly utilizing medicago sativa radicles to PCR (Polymerase Chain Reaction) and kit

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410023097.8A CN103773869A (en) 2014-01-17 2014-01-17 Preparation method and kit for directly utilizing medicago sativa radicles to PCR (Polymerase Chain Reaction) and kit

Publications (1)

Publication Number Publication Date
CN103773869A true CN103773869A (en) 2014-05-07

Family

ID=50566625

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410023097.8A Pending CN103773869A (en) 2014-01-17 2014-01-17 Preparation method and kit for directly utilizing medicago sativa radicles to PCR (Polymerase Chain Reaction) and kit

Country Status (1)

Country Link
CN (1) CN103773869A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1288957A (en) * 2000-08-24 2001-03-28 安徽省农业科学院 Application of rice leaf in polymerase chain reaction
CN1319676A (en) * 2001-01-09 2001-10-31 安徽省农业科学院 Use of wheat leaf blade in polymerase chain reaction and random amplification length pleiomorphy reaction
CN101429561A (en) * 2008-12-18 2009-05-13 温州市农业科学研究院 Method for detecting rice gene with PCR and PCR buffer solution employing the method
CN102220428A (en) * 2011-05-11 2011-10-19 合肥丰乐种业股份有限公司 Method for inspecting purity of two-line hybrid rice seeds by utilizing SSR (Simple Sequence Repeat) method

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1288957A (en) * 2000-08-24 2001-03-28 安徽省农业科学院 Application of rice leaf in polymerase chain reaction
CN1319676A (en) * 2001-01-09 2001-10-31 安徽省农业科学院 Use of wheat leaf blade in polymerase chain reaction and random amplification length pleiomorphy reaction
CN101429561A (en) * 2008-12-18 2009-05-13 温州市农业科学研究院 Method for detecting rice gene with PCR and PCR buffer solution employing the method
CN102220428A (en) * 2011-05-11 2011-10-19 合肥丰乐种业股份有限公司 Method for inspecting purity of two-line hybrid rice seeds by utilizing SSR (Simple Sequence Repeat) method

Similar Documents

Publication Publication Date Title
CN106222263B (en) LAMP primer composition for detecting pythium ultimum, kit and detection method thereof
CN105177135A (en) Detection method of karlodinium micrum
CN111876477B (en) Molecular marker primer combination for identifying sex characters of holly plants and application thereof
CN104561344A (en) Primer pairs and kit capable of detecting and distinguishing different breeding sheep babesia
Li et al. Qualitative and quantitative detection using eDNA technology: A case study of Fenneropenaeus chinensis in the Bohai Sea
CN103555847B (en) A kind of method of Tilapia mossambica paternity test
CN103060311A (en) High-flux quick extraction method of single rapeseed genome DNA (Deoxyribonucleic Acid)
CN107502678A (en) A kind of method and device for detecting blue algae producing microcystic toxins
CN104152582A (en) Lumpy skin disease virus (LSDV) Taqman-MGB (minor groove binder) probe real-time fluorescence quantitative PCR (polymerase chain reaction) detection primer, kit and detection method
CN103468806A (en) Quick detection method for scallop pathogenic vibrio splendidus
CN102827933B (en) Kit for qualitative detection of pinewood nematode and detection method thereof
CN105755116B (en) Primer and its application with microsatellite marker mutually chain whether Eriocheir sinensis sex premature
CN103525933B (en) A kind of PCR-RFLP method distinguishing grass carp and black carp
CN103773869A (en) Preparation method and kit for directly utilizing medicago sativa radicles to PCR (Polymerase Chain Reaction) and kit
CN104962660A (en) Ruditapes philippinarum species real-time fluorescent PCR (polymerase chain reaction) specific detection system and application thereof
CN106119384A (en) A kind of Aeromonas hydrophila method for nucleic acid analysis and the application in legal medical expert detects
CN106957915B (en) Primer and kit for detecting apple tree/pear tree rot pathogen and quantitative detection method
CN102312016A (en) Real-time fluorescence quantitative PCR method for detecting sugarcane ratoon stunning disease
CN105039510A (en) Polymerase chain reaction method for Haliscomenobacter hydrossis filamentous flora in bulking sludge
CN104531688A (en) Spider mitochondria genome complete sequence amplification primer and amplification method
CN103290107A (en) Construction method of SSR fingerprint suitable for identification of rice hybrid authenticity
CN110819734B (en) Apple tree rot fungus LAMP amplification primer and apple tree rot disease detection kit
CN113234840A (en) Kit for rapidly diagnosing peach bacterial perforation disease
CN102533731A (en) Extraction kit and extraction method for tomato genome total DNA (Deoxyribonucleic Acid)
CN101892308A (en) Specific amplification primer for detecting marssonina coronaria and detection method

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20140507