CN103773869A - Preparation method and kit for directly utilizing medicago sativa radicles to PCR (Polymerase Chain Reaction) and kit - Google Patents
Preparation method and kit for directly utilizing medicago sativa radicles to PCR (Polymerase Chain Reaction) and kit Download PDFInfo
- Publication number
- CN103773869A CN103773869A CN201410023097.8A CN201410023097A CN103773869A CN 103773869 A CN103773869 A CN 103773869A CN 201410023097 A CN201410023097 A CN 201410023097A CN 103773869 A CN103773869 A CN 103773869A
- Authority
- CN
- China
- Prior art keywords
- alfalfa
- pcr
- root
- radicle
- reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention mainly relates to a method and a kit for directly utilizing medicago sativa radicles to a PCR (Polymerase Chain Reaction) and particularly relates to a method for directly utilizing root tips of the medicago sativa radicles as a PCR template to carry out an SSR (Simple Sequence Repeat) reaction after the root tips are treated by alkali. The method for directly utilizing the root tips of the medicago sativa radicles as the PCR template to carry out the SSR reaction has the following main characteristics that the root tips of the medicago sativa radicles are treated by a 0.25M NaOH water solution in a water bath of 100 DEG C for 40 seconds and then adding 400 microliters of 0.25M HCl and 200 microliters of 0.5M Tris-HCl (with the pH of 8.0); incubating in boiled water of 100 DEG C for 3 minutes; and directly utilizing the treated root tips as the PCR template to carry out the SSR reaction. A detection result shows that the technology has the characteristics of strong sensitivity, high accuracy, strong repeatability, rapidness and convenience and the like; particularly, the method is economical and effective when a tested group is large.
Description
Technical field
The present invention relates generally to the method for alfalfa PCR reaction.Be specifically related to the preparation method of alfalfa radicle for PCR reaction.
Background technology
Along with the development of Protocols in Molecular Biology, produce the multiple molecular marking technique based on polymerase chain reaction (Polymerase Chain Reaction, PCR), as simple repeated sequence (Simple Sequence Repeat, SSR) analysis waits (Vos etc., 2003; Akkaya etc., 1992; Charters etc., 1996).At present, molecular marking technique has been widely used in the aspects such as species specificity is identified, tracking, the assignment of genes gene mapping and the genetic map drafting of target gene.The first step of applying these labeling techniques must be extracted the genomic dna of testing sample, determines after concentration, gets in right amount as template, carries out corresponding pcr amplification.Method program complexity and workload that routine is prepared testing sample genomic dna are large, use molecule marker plant in when polymorphism analysis, often need to detect a large amount of colonies and individual plant, more seem waste time and energy and cost higher.Therefore, find a kind of fast, effectively, the novel method of carrying out easily DNA of plants amplification is very necessary, micro-satellite analysis system (Virk etc. fast and effectively in the plants such as Arabidopis thaliana, are set up although there is bibliographical information abroad, 1999), but have no report Dominant Species of Forage Grass crop as quick, easy, the effective DNA analysis system in alfalfa.
Summary of the invention
Object one of the present invention is to avoid the deficiencies in the prior art, proposes a kind of alfalfa radicle and is directly used in the preparation method that PCR reacts.
Object two of the present invention is to provide a kind of alfalfa radicle and is directly used in the test kit that PCR reacts.
To fast and efficiently a large amount of alfalfa colonies and individual plant are carried out to SSR detection analysis.This method is time saving and energy saving, easy and simple to handle, and can complete a large amount of work within a short period of time.Research shows, this method is all applicable for 15 parts of alfalfa individual plant samples choosing at random.
For achieving the above object, the technical scheme that the present invention takes is: a kind of alfalfa radicle is directly used in the preparation method of PCR reaction, it is characterized in that comprising the steps:
A. alfalfa seed adopts double-deck filter paper to sprout method, sprouts 72h at 25 ℃, cuts the long radicle tip of a root of 1-3mm for subsequent use;
B. the radicle tip of a root cutting in A step is put into the Eppendorf pipe containing 400 μ l0.25M NaOH, this centrifuge tube is inserted in 100 ℃ of boiling water and boils 40s, take out and add 400 μ l0.25M HCl and 200 μ l0.5M Tris-HCl pH8.0, again this pipe is put into 100 ℃ of boiling water and hatched 3min, directly carry out SSR reaction as pcr template through the alfalfa radicle tip of a root of above-mentioned alkaline purification.
Alfalfa radicle is directly used in a test kit for PCR reaction, it is characterized in that including:
PCR cumulative volume is 20 μ l, the alfalfa radicle tip of a root 1-3mm processing through steps A, B, 2 × PCR Master10 μ l, forward primer SSSR-F1 μ l, reverse primer SSR-R1 μ l, ddH
2o8 μ l.
Beneficial effect of the present invention: this method is time saving and energy saving, easy and simple to handle, can complete a large amount of work within a short period of time.Detected result shows, the present invention has that susceptibility is strong, accuracy rate is high, repeatability is strong and the feature such as rapid and convenient, when especially larger in tested colony, and this kind of method economical and effective that more seems.
Accompanying drawing explanation
Fig. 1 alfalfa radicle tip of a root.In figure: the about 2mm of alfalfa radicle tip of a root length;
Fig. 2 a shows the SSR response imaging design sketch take 15 parts of alfalfa individual plant genomic dnas as template;
The alfalfa radicle tip of a root that 15 parts of alfalfas of Fig. 2 b demonstration are prepared take the present invention is the SSR response imaging design sketch of template;
In figure: Fig. 2 a and Fig. 2 b primer are forward primer SSR1-F and reverse primer SSR1-R;
Fig. 3 a shows the SSR response imaging design sketch take 15 parts of alfalfa individual plant genomic dnas as template;
The alfalfa radicle tip of a root that 15 parts of alfalfas of Fig. 3 b demonstration are prepared take the present invention is the SSR response imaging design sketch of template;
In figure: Fig. 3 a and Fig. 3 b primer are forward primer SSR2-F and reverse primer SSR2-R,
Fig. 4 a be under light field condition the alfalfa radicle tip of a root through the EB imaging effect that dyes;
Fig. 4 b be under ultraviolet light conditions the alfalfa radicle tip of a root through the EB imaging effect that dyes.
In figure: CK represents without the alkaline purification alfalfa radicle tip of a root.
Embodiment
Below in conjunction with embodiment, principle of the present invention and feature are described, example, only for explaining the present invention, is not intended to limit scope of the present invention.
Embodiment 1: a kind of alfalfa radicle is directly used in the preparation method of PCR reaction, it is characterized in that comprising the steps:
A. alfalfa seed adopts double-deck filter paper to sprout method, sprouts 72h at 25 ℃, cuts the long radicle tip of a root of 1-3mm for subsequent use;
B. the radicle tip of a root cutting in A step is put into the Eppendorf pipe containing 400 μ l0.25M NaOH, this centrifuge tube is inserted in 100 ℃ of boiling water and boils 40s, take out and add 400 μ l0.25M HCl and 200 μ l0.5M Tris-HCl pH8.0, again this pipe is put into 100 ℃ of boiling water and hatched 3min, directly carry out SSR reaction as pcr template through the alfalfa radicle tip of a root of above-mentioned alkaline purification.
Embodiment 2: a kind of alfalfa radicle is directly used in the test kit of PCR reaction, it is characterized in that including:
PCR cumulative volume is 20 μ l, the alfalfa radicle tip of a root 1-3mm processing through steps A, B, 2 × PCR Master10 μ l, forward primer SSSR-F1 μ l, reverse primer SSR-R1 μ l, ddH
2o8 μ l.
Embodiment 3: a kind of alfalfa (" U.S. gold queen " kind, is stored in Lanzhou University's ley farming technical college seed bank) radicle tip of a root is directly used in the method for SSR reaction as pcr template, it comprises the steps:
A. alfalfa seed adopts double-deck filter paper to sprout method, sprouts 72h for 25 ℃, cuts the long radicle tip of a root of about 2mm for subsequent use, sees Fig. 1;
B. the radicle tip of a root cutting in A step is put into the Eppendorf pipe containing 400 μ l0.25M NaOH, this centrifuge tube is inserted in boiling water and boils 40s, take out and add 400 μ l0.25M HCl and 200 μ l0.5M Tris-HCl(pH8.0), again this pipe is put into boiling water and hatch 3min, directly carry out SSR reaction as pcr template through the alfalfa radicle tip of a root of above-mentioned alkaline purification.
The system of C.PCR reaction, PCR cumulative volume is 20 μ l, template is the alfalfa radicle tip of a root of step B alkaline purification, the raw chemical product numbering in 2 × PCR Master(Shanghai: SK2082) 10 μ l, forward primer SSSR-F1 μ l, reverse primer SSR-R1 μ l, ddH2O8 μ l.PCR method is: (1) 95 ℃ of denaturation 2min; (2) 95 ℃ of sex change 30s; (3) 55 ℃ of annealing 30s; (4) 72 ℃ are extended 30s; (5) 2~4 step cycle 38 times; (6) 72 ℃ are extended 7min.
D.PCR product detects effect through polyacrylamide gel electrophoresis, sees Fig. 2 and Fig. 3.
The SSR reaction of experimental example 1:15 part alfalfa take individual plant genomic dna as template and the SSR reaction effect contrast of the alfalfa radicle tip of a root of preparing take the present invention as template:
Using forward primer SSR1-F and reverse primer SSR1-R to carry out SSR reaction to 15 parts of alfalfa individual plants comprises the steps:
Forward primer SSR1-F is: GTCGTAGTAAACGTAAACAAAGAA
Reverse primer SSR1-R is: ACGGCAGGAACAGATCCTTGAA
This is preferred embodiment primer of the present invention to primer, in order to limit the present invention, within the spirit and principles in the present invention not all, any modification of doing, is equal to replacement, improvement etc., within all should being included in protection scope of the present invention.
(1). the SSR reaction that is template with 15 parts of alfalfas (" U.S. gold queen " kind, is stored in Lanzhou University's ley farming technical college seed bank) individual plant genomic dna
The genomic dna that extracts 15 parts of alfalfa individual plants, is 200ng/ μ l by its concentration dilution, as template, adopts forward primer SSR1-F and reverse primer SSR1-R to carry out SSR reaction.
PCR system is: the raw chemical product numbering in 2 × PCR Master(Shanghai: SK2082) 10 μ l, alfalfa genomic dna template 1 μ l, forward primer SSR1-F1 μ l, reverse primer SSR1-R1 μ l, ddH
2o7 μ l.PCR method is: (1) 95 ℃ of denaturation 2min; (2) 95 ℃ of sex change 30s; (3) 55 ℃ of annealing 30s; (4) 72 ℃ are extended 30s; (5) 2~4 step cycle 38 times; (6) 72 ℃ are extended 7min.
PCR product detects its effect through polyacrylamide gel electrophoresis:
Fig. 2 a shows that the electrophoretic band take 15 parts of alfalfa individual plant genomic dnas as template is clear bright.
(2) the alfalfa radicle tip of a root that .15 part alfalfa (" U.S. gold queen " kind, is stored in Lanzhou University's ley farming technical college seed bank) is prepared take the present invention is the SSR reaction effect of template
Adopt double-deck filter paper to sprout method 15 parts of alfalfa seeds, sprout 72h, cut the long radicle tip of a root of about 2mm for 25 ℃.
The radicle tip of a root cutting is put into the Eppendorf pipe containing 400 μ l0.25M NaOH, this centrifuge tube is inserted in boiling water and boils 40s, take out and add 400 μ l0.25M HCl and 200 μ l0.5M Tris-HCl(pH8.0), again this pipe is put into boiling water and hatch 3min, directly carry out SSR reaction as pcr template through the alfalfa radicle tip of a root of above-mentioned alkaline purification.
PCR system is: the raw chemical product numbering in 2 × PCR Master(Shanghai: SK2082) 10 μ l, the alfalfa radicle tip of a root of alkaline purification is as template, forward primer SSR1-F1 μ l, reverse primer SSR1-R1 μ l, ddH
2o8 μ l.PCR method is: (1) 95 ℃ of denaturation 2min; (2) 95 ℃ of sex change 30s; (3) 55 ℃ of annealing 30s; (4) 72 ℃ are extended 30s; (5) 2~4 step cycle 38 times; (6) 72 ℃ are extended 7min.
PCR product detects its effect through polyacrylamide gel electrophoresis:
Fig. 2 b shows using the alfalfa radicle tip of a root of 15 parts of alkaline purifications clear bright as the electrophoretic band of template, consistent with electrophoretic band effect in Fig. 2 a.
The SSR reaction of experimental example 2:15 part alfalfa take individual plant genomic dna as template and the SSR reaction effect contrast of the alfalfa radicle tip of a root of preparing take the present invention as template:
Using forward primer SSR2-F and reverse primer SSR2-R to carry out SSR reaction to 15 parts of alfalfa individual plants comprises the steps:
Forward primer SSR2-F is: CCAAACTCAGAACCCTAACCCAA
Reverse primer SSR2-R is: GAACTTGTCAAGACCCATGAAGA
This is preferred embodiment primer of the present invention to primer, in order to limit the present invention, within the spirit and principles in the present invention not all, any modification of doing, is equal to replacement, improvement etc., within all should being included in protection scope of the present invention.
(1). the SSR reaction that is template with 15 parts of alfalfas (" U.S. gold queen " kind, is stored in Lanzhou University's ley farming technical college seed bank) individual plant genomic dna:
The genomic dna that extracts 15 parts of alfalfa individual plants, is 200ng/ μ l by its concentration dilution, as template, adopts forward primer SSR2-F and reverse primer SSR2-R to carry out SSR reaction.
PCR system is: the raw chemical product numbering in 2 × PCR Master(Shanghai: SK2082) 10 μ l, alfalfa genomic dna template 1 μ l, forward primer primer SSR2-F1 μ l, reverse primer SSR2-R1 μ l, ddH
2o7 μ l.PCR method is with experimental example 1.
PCR product detects its effect through polyacrylamide gel electrophoresis:
Fig. 3 a shows that the electrophoretic band take 15 parts of alfalfa individual plant genomic dnas as template is clear bright.
(2). the SSR reaction effect that alfalfa (" U.S. gold queen " kind, is stored in Lanzhou University's ley farming technical college seed bank) the radicle tip of a root of preparing with 15 parts of the present invention is template
Adopt double-deck filter paper to sprout method 15 parts of alfalfa seeds, sprout 72h, cut the long radicle tip of a root of about 2mm for 25 ℃.
Alfalfa radicle tip of a root treatment process is with experimental example 1.
PCR system is: the raw chemical product numbering in 2 × PCR Master(Shanghai: SK2082) 10 μ l, the alfalfa radicle tip of a root of alkaline purification is as template, forward primer SSR2-F1 μ l, reverse primer SSR2-R1 μ l, ddH
2o8 μ l.PCR method is with (1).
PCR product detects its effect through polyacrylamide gel electrophoresis:
Fig. 3 b shows using the alfalfa radicle tip of a root of 15 parts of alkaline purifications clear bright as the electrophoretic band of template, consistent with electrophoretic band effect in Fig. 3 a.
Experimental example 3: the Fluirescence observation of the alfalfa radicle tip of a root prepared by the present invention, comprises the steps:
By the alfalfa radicle tip of a root of preparing through the present invention and ethidium bromide (EB) solution of putting into respectively 0.05mg/ml without the contrast tip of a root of alkaline purification, after reaction 30s, suck unnecessary liquid with thieving paper, under ultraviolet lamp, observe and take pictures.
Fig. 4 a shows, the alfalfa radicle tip of a root of preparing through the present invention under light field condition and all energy imagings of the contrast tip of a root without alkaline purification.
Fig. 4 b shows, the alfalfa radicle tip of a root through preparing through the present invention under UV-irradiation condition can imaging, and can not imaging without the tip of a root of alkaline purification.DNA in the alfalfa radicle root-tip cells that shows to prepare through the present invention has separated out and has been combined with EB, emitting fluorescence under the irradiation of UV-light, and then imaging.And without the alfalfa radicle tip of a root of alkaline purification, do not have DNA to separate out, and can not be combined with EB, can not produce fluorescence through UV-irradiation, then can not imaging.
The foregoing is only preferred embodiment of the present invention, in order to limit the present invention, within the spirit and principles in the present invention not all, any modification of doing, be equal to replacement, improvement etc., within all should being included in protection scope of the present invention.
Claims (2)
1. alfalfa radicle is directly used in a preparation method for PCR reaction, it is characterized in that comprising the steps:
A. alfalfa seed adopts double-deck filter paper to sprout method, sprouts 72h at 25 ℃, cuts the long radicle tip of a root of 1-3mm for subsequent use;
B. the radicle tip of a root cutting in A step is put into the Eppendorf pipe containing 400 μ l0.25M NaOH, this centrifuge tube is inserted in 100 ℃ of boiling water and boils 40s, take out and add 400 μ l0.25M HCl and 200 μ l0.5M Tris-HCl pH8.0, again this pipe is put into 100 ℃ of boiling water and hatched 3min, directly carry out SSR reaction as pcr template through the alfalfa radicle tip of a root of above-mentioned alkaline purification.
2. alfalfa radicle is directly used in a test kit for PCR reaction, it is characterized in that including:
PCR cumulative volume is 20 μ l, the alfalfa radicle tip of a root 1-3mm processing through steps A, B, 2 × PCR Master10 μ l, forward primer SSSR-F1 μ l, reverse primer SSR-R1 μ l, ddH
2o8 μ l.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410023097.8A CN103773869A (en) | 2014-01-17 | 2014-01-17 | Preparation method and kit for directly utilizing medicago sativa radicles to PCR (Polymerase Chain Reaction) and kit |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410023097.8A CN103773869A (en) | 2014-01-17 | 2014-01-17 | Preparation method and kit for directly utilizing medicago sativa radicles to PCR (Polymerase Chain Reaction) and kit |
Publications (1)
Publication Number | Publication Date |
---|---|
CN103773869A true CN103773869A (en) | 2014-05-07 |
Family
ID=50566625
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410023097.8A Pending CN103773869A (en) | 2014-01-17 | 2014-01-17 | Preparation method and kit for directly utilizing medicago sativa radicles to PCR (Polymerase Chain Reaction) and kit |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103773869A (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1288957A (en) * | 2000-08-24 | 2001-03-28 | 安徽省农业科学院 | Application of rice leaf in polymerase chain reaction |
CN1319676A (en) * | 2001-01-09 | 2001-10-31 | 安徽省农业科学院 | Use of wheat leaf blade in polymerase chain reaction and random amplification length pleiomorphy reaction |
CN101429561A (en) * | 2008-12-18 | 2009-05-13 | 温州市农业科学研究院 | Method for detecting rice gene with PCR and PCR buffer solution employing the method |
CN102220428A (en) * | 2011-05-11 | 2011-10-19 | 合肥丰乐种业股份有限公司 | Method for inspecting purity of two-line hybrid rice seeds by utilizing SSR (Simple Sequence Repeat) method |
-
2014
- 2014-01-17 CN CN201410023097.8A patent/CN103773869A/en active Pending
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1288957A (en) * | 2000-08-24 | 2001-03-28 | 安徽省农业科学院 | Application of rice leaf in polymerase chain reaction |
CN1319676A (en) * | 2001-01-09 | 2001-10-31 | 安徽省农业科学院 | Use of wheat leaf blade in polymerase chain reaction and random amplification length pleiomorphy reaction |
CN101429561A (en) * | 2008-12-18 | 2009-05-13 | 温州市农业科学研究院 | Method for detecting rice gene with PCR and PCR buffer solution employing the method |
CN102220428A (en) * | 2011-05-11 | 2011-10-19 | 合肥丰乐种业股份有限公司 | Method for inspecting purity of two-line hybrid rice seeds by utilizing SSR (Simple Sequence Repeat) method |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106222263B (en) | LAMP primer composition for detecting pythium ultimum, kit and detection method thereof | |
CN105177135A (en) | Detection method of karlodinium micrum | |
CN104561344A (en) | Primer pairs and kit capable of detecting and distinguishing different breeding sheep babesia | |
Li et al. | Qualitative and quantitative detection using eDNA technology: A case study of Fenneropenaeus chinensis in the Bohai Sea | |
CN103555847B (en) | A kind of method of Tilapia mossambica paternity test | |
CN103060311A (en) | High-flux quick extraction method of single rapeseed genome DNA (Deoxyribonucleic Acid) | |
CN107502678A (en) | A kind of method and device for detecting blue algae producing microcystic toxins | |
CN102827933B (en) | Kit for qualitative detection of pinewood nematode and detection method thereof | |
CN104152582A (en) | Lumpy skin disease virus (LSDV) Taqman-MGB (minor groove binder) probe real-time fluorescence quantitative PCR (polymerase chain reaction) detection primer, kit and detection method | |
CN105755116B (en) | Primer and its application with microsatellite marker mutually chain whether Eriocheir sinensis sex premature | |
CN103525933B (en) | A kind of PCR-RFLP method distinguishing grass carp and black carp | |
CN104962660B (en) | A kind of mottle clam species real-time fluorescence PCR specific detection system and application | |
CN103773869A (en) | Preparation method and kit for directly utilizing medicago sativa radicles to PCR (Polymerase Chain Reaction) and kit | |
CN106119384A (en) | A kind of Aeromonas hydrophila method for nucleic acid analysis and the application in legal medical expert detects | |
CN106957915B (en) | Primer and kit for detecting apple tree/pear tree rot pathogen and quantitative detection method | |
CN102312016A (en) | Real-time fluorescence quantitative PCR method for detecting sugarcane ratoon stunning disease | |
CN105039510A (en) | Polymerase chain reaction method for Haliscomenobacter hydrossis filamentous flora in bulking sludge | |
CN111876477B (en) | Molecular marker primer combination for identifying sex characters of holly plants and application thereof | |
CN103290107A (en) | Construction method of SSR fingerprint suitable for identification of rice hybrid authenticity | |
CN110819734B (en) | Apple tree rot fungus LAMP amplification primer and apple tree rot disease detection kit | |
CN104789693B (en) | A kind of method that prawn sex identification is carried out based on high-resolution solubility curve technology | |
CN105420383A (en) | Marine bacterium drug-resistant gene detection chip and application thereof | |
CN105296643A (en) | Isothermal amplification detection kit and detection method for duck meat derived component nucleic acid | |
AU2021100290A4 (en) | A new method for monitoring Fenneropenaeus chinensis | |
CN105385759A (en) | Primer for nile tilapia germ plasm purity identification and PCR identification method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C12 | Rejection of a patent application after its publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140507 |