CN1303209C - Synthetase-1b for human cholesterol ester and coded sequence - Google Patents
Synthetase-1b for human cholesterol ester and coded sequence Download PDFInfo
- Publication number
- CN1303209C CN1303209C CNB2003101093683A CN200310109368A CN1303209C CN 1303209 C CN1303209 C CN 1303209C CN B2003101093683 A CNB2003101093683 A CN B2003101093683A CN 200310109368 A CN200310109368 A CN 200310109368A CN 1303209 C CN1303209 C CN 1303209C
- Authority
- CN
- China
- Prior art keywords
- leu
- people
- phe
- polynucleotide
- cholesteryl ester
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The present invention provides human cholesterol ester synthetase-1b and a coded sequence thereof, and also provides a construction object and a carrier containing the sequence and an application of the construction object and the carrier. The length of a nucleotide sequence of human ACAT1b cDNA is about 1.9 kb, and 591 amino acid sequences are coded. The human ACAT1b cDNA and the human cholesterol ester synthetase coded by the human ACAT1b cDNA of the present invention can be used for researching medicine for screening treatment or auxiliary treatment of high cholesterol ester disease, atherosclerosis, Creutzfeldt-Jacob disease, etc.
Description
Technical field
The present invention relates to biological chemistry, molecular biology, genetically engineered and DNA recombinant technology field.More specifically, relating to people's cholesteryl ester synthesizes-1b (ACAT1b) and encoding sequence and their application.
Background technology
People's cholesteryl ester synthetic enzyme is a human acyl coenzyme A: cholesterol acyltransferase (ACAT; Acyl-coenzyme A:cholesterol acyltransferase; EC2.3.1.26), be the enzyme that interior unique catalysis longer chain fatty acid of people's cell and free cholesterol form cholesteryl ester.ACAT brings into play the important physical function in vivo, mainly participates in organism cholesterol and processes such as the absorption of ester class, transportation and storage thereof, is one of key enzyme of keeping body inner cholesterol and ester class metabolic balance thereof.Studies show that in a large number that both at home and abroad it is high reactivity ground synthetic cholesterol ester in scavenger cell, cause the excessive accumulation of cell inner cholesterol ester and form foam cell, cause atherosclerosis (AS) early lesion; Its activity cholesterol amount in the cytolemma that can affect the nerves, and directly regulate the generation a, relevant with senile dementia lesion (AD); Its activity change in liver, intestinal cells can directly influence the absorption of synthetic cholesterol ester, cholesterol, the assembling of lipoprotein, and is until blood levels that influences cholesterol and blood transhipment, directly related with hypercholesterolemia ester disease; And the absorption of chronic dietary source cholesterol lacks, and causes serious disease equally, as child, the dementia in old age etc.Therefore, it is epochmaking cholesterol metabolic relative disease drug target protein, in the world the main attack target protein of ACAT as development atherosclerosis pathology medicine.But ACAT is again the extremely low a kind of endoplasmic reticulum membranin of content, even the long-term a large amount of human and material resources etc. of dropping into of many in the world laboratories or company are studied, fails its natural type zymoprotein of purifying so far.So, carry out the work of gene level, to mechanism of action and the structure function of further investigation ACAT and with the relation of relative disease, seem very important, be present unique practicable approach.
In Mammals, find to have two kinds of different ACAT genes of coding ACAT1 and ACAT2 at present.1993, the people ACAT1 cDNA (4011bp) with active function was cloned in U.S. Dartmouth medical college Chang TY laboratory first, 550 aminoacid sequence (Chang TY et al. of its open reading frame coding, 1993, J.Biol.Chem., 268:20747-20755).1996, the experiment of mouse ACAT1 gene knockout was successfully carried out in the R.V.Farese laboratory of Univ California-San Francisco USA, and analyzed and find in liver and small intestine, still had strong ACAT enzymic activity, inferred the ACAT that has another kind of form thus.From Computer Analysis ACAT conserved sequence, 1998, three tame laboratories were cloned cercopithecus aethiops (Anderson RA et al., 1998 respectively, J.Biol.Chem., 273:26747-26754), mouse (Cases S et al., 1998, J.Biol.Chem., 273:26755-26764) and people (Oelkers P et al., 1998, J.Biol.Chem., ACAT2 cDNA 273:26765-26771).People ACAT2 cDNA is about 2040bp, 522 amino acid of its open reading frame coding.ACAT1 almost expresses in a organized way in institute, and ACAT2 have high expression level in liver and small intestine.
1999, the structure organization of people ACAT1 genomic dna is cooperated to have delivered with Chang TY laboratory in the contriver laboratory, and finder ACAT1 4.3knt mRNA sequence comes from two different karyomit(e)s (Li Bo-Liang et al., J.Biol.Chem., 1999,274:11060-11071), by a kind of chromosomal trans-splicing mode (interchromosomal trans-splicing) maturation of striding.On this basis, the contriver carries out deep research to this trans-splicing ACAT1mRNA in the regulation and control of translation skill.The contriver finds, except identical with the 50kDa ACAT1 albumen of the ACAT1 ORF coding that is about 1650bp delivered of abroad going together, also there is the translation initiation of another upstream in the ACAT1 mRNA of this trans-splicing, its translation produces 56kDa ACAT1 large protein (systematic naming method is ACAT1b, and corresponding 50kDa ACAT1 albumen is named as ACAT1s).It is very rare in Mammals that trans-splicing mRNA codified produces activated protein, so the existence of multiple ACAT1 albumen form, shows the importance and the complicacy of this gene function.
Change along with Chinese people's growth in the living standard and dietary structure, cardiovascular disorder and neural transformation disease more and more become the important killer who threatens people's life and health, and the research of massive epidemiology and molecular level has proved that these diseases and organism inner cholesterol level are closely related.Because ACAT has played keying action in cholesterol balance, incidence of atherosclerosis and the neural transformation lysis in vivo, the special inhibitor that therefore screens ACAT becomes the focus that some drugmakers are competitively studied.Because the ACAT albumen of natural form does not also have the purifying success, it is also very difficult therefore to seek the special effective inhibitors of ACAT.Increasing scientist and medical major company have participated in the research in this field both at home and abroad.Especially study the scientific research brainstrust of cardiovascular and cerebrovascular diseases, special hope can be screened the active drug of invention at atherosclerosis and anti-neural transformation disease ACAT.
The ACAT1b that the contriver finds, molecule mechanism for the critical function of illustrating ACAT and announcement hypercholesterolemia ester disease, atherosclerosis and neural transformation disease etc. is significant, this basic research breaks through, will very fast its action oriented research of initiation, and promote the invention of cholesterol related diseases medicine rapidly.Yet, at present, also do not obtain people ACAT1b and encoding sequence thereof.
Therefore, this area presses for exploit person ACAT1b and encoding sequence thereof.
Summary of the invention
Purpose of the present invention just provides a kind of new people's cholesteryl ester synthetase 1 b and encoding sequence thereof.
Another object of the present invention provides produces these people's cholesteryl ester synthetic enzyme and the method for encoding sequence and their purposes.
A first aspect of the present invention provides a kind of people's cholesteryl ester synthetic enzyme-1b, and described albumen is selected from down group:
(a) have albumen or its conservative property variant protein or its active fragments or its reactive derivative of SEQ ID NO:2 aminoacid sequence.
(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have people's cholesteryl ester synthetic enzyme-1b function by (a) deutero-albumen.
In a preference, described people's cholesteryl ester synthetic enzyme-1b (ACAT1b) has the aminoacid sequence shown in the SEQ ID NO:2.
A second aspect of the present invention provides a kind of isolating polynucleotide, and described polynucleotide comprise one and are selected from down the nucleotide sequence of organizing:
(a) the above-mentioned proteic polynucleotide of coding;
(b) with polynucleotide (a) complementary polynucleotide.
Preferably, described polynucleotide encoding has the albumen of aminoacid sequence shown in the SEQ ID NO:2.
Preferable, the sequence of described polynucleotide comprises and is selected from down a kind of of group:
(a) sequence of 32-1807 position among the SEQ ID NO:1;
(b) sequence of 1-1873 position among the SEQ ID NO:1.
Better, the sequence of described polynucleotide has a kind of of the group of being selected from down:
(a) sequence of 32-1807 position among the SEQ ID NO:1;
(b) sequence of 1-1873 position among the SEQ ID NO:1.
A third aspect of the present invention provides a kind of carrier, and described carrier contains above-mentioned polynucleotide.Preferable, described polynucleotide comprise 32-1807 bit sequence among the SEQ ID NO:1.
A fourth aspect of the present invention provides a kind of host cell, and described host cell comprises above-mentioned carrier.Preferably, described host cell is a mammalian cell.Better, described host cell is mouse, rat, monkey or people's a cell.
A fifth aspect of the present invention provides a kind of people's of having cholesteryl ester synthetic enzyme-1b active proteic preparation method, it is characterized in that this method comprises:
(a) under the condition that is fit to expressing human cholesteryl ester synthetic enzyme-1b, cultivate above-mentioned host cell;
(b) from culture, isolate and have the active albumen of people's cholesteryl ester synthetic enzyme-1b.
A sixth aspect of the present invention, provide a kind of can with above-mentioned people's cholesteryl ester synthetic enzyme-1b specificity bonded antibody.Preferable, described antibody is monoclonal antibody.
A seventh aspect of the present invention provides a kind of pharmaceutical composition, and described pharmaceutical composition contains the above-mentioned people's cholesteryl ester synthetic enzyme-1b or the above-mentioned polynucleotide of safe and effective amount, and at least a pharmaceutically acceptable carrier.
A eighth aspect of the present invention provides described people's cholesteryl ester synthetic enzyme-1b application in the medicine of screening or preparation treatment cholesterol related diseases or neural transformation relative disease.Described cholesterol related diseases is atherosclerosis or Alzheimer's disease.Described neural transformation relative disease is a presenile dementia.
A ninth aspect of the present invention provides the application of above-mentioned polynucleotide in the medicine of screening or preparation treatment cholesterol related diseases or neural transformation relative disease.Described cholesterol related diseases is atherosclerosis or Alzheimer's disease.Described neural transformation relative disease is a presenile dementia.
A tenth aspect of the present invention provides a kind of method of screening the medicine of treatment cholesterol related diseases or neural transformation relative disease, and described method comprises step:
(a) under the condition that is fit to growth, cultivate host cell, described host cell contains above-mentioned expression vector, described expression vector contains above-mentioned polynucleotide and the exogenous promoter that links to each other with this polynucleotide operability, wherein in the substratum of first group of host cell or lysate or preparation albumen, add candidate substances, in the substratum of second group of host cell or lysate or preparation albumen, do not add candidate substances;
(b) measure cholesteryl ester synthetic enzyme-1b activity in first group and second group of host cell or lysate or the preparation albumen, wherein first group of host cell or lysate or prepare proteic this enzymic activity and just represent that above and below second group this candidate substances is the medicine of treatment cholesterol related diseases or neural transformation relative disease.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Description of drawings
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1: people ACAT1b cDNA sequence is the polynucleotide encoding sequence of people's cholesteryl ester synthetase 1 b.
Fig. 2: the aminoacid sequence of people's cholesteryl ester synthetase 1 b.
Fig. 3: the recombinant expression vector and the western blot analysis that contain people ACAT1b encoding sequence:
A. the structure synoptic diagram of the recombinant expression vector of people ACAT1b encoding sequence;
B. the western blot analysis of people's cholesteryl ester synthetase 1 b.
Fig. 4: the activation analysis of people's cholesteryl ester synthetic enzyme of people ACAT1b genetic expression.
Embodiment
The inventor is through extensive and deep research, prove that first there is the non-AUG translation initiation site in upstream in the people ACAT1b cDNA that the clone obtains, a kind of people's cholesteryl ester synthetic enzyme aminoacid sequence that coding produces, structure contains the recombinant expression vector of people ACAT1bcDNA, transfection mammalian cell is expressed, in order to the enzymic activity of analyst ACAT1b.Finished the present invention on this basis.
As used herein, term " cholesteryl ester synthetic enzyme-1b ", " ACAT1b " are used interchangeably, and refer to have the enzyme of ACAT1b aminoacid sequence (Fig. 2); Term " cholesteryl ester synthetic enzyme-1b cDNA " and " ACAT1b cDNA " are used interchangeably, and refer to have the polymerized nucleoside acid sequence (Fig. 1, SEQ ID NO:1) of coding ACAT1b aminoacid sequence.
In the present invention, " cholesteryl ester synthetic enzyme-1b conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
The invention still further relates to the polynucleotide varient of above-mentioned cDNA.The varient that allelic variant that these polynucleotide varients can be natural generations or non-natural take place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of this cDNA in fact.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 10 Nucleotide at least, better is at least 50 Nucleotide, is more preferably at least 100 Nucleotide, preferably at least 200 above total lengths to people's cholesteryl ester synthetic enzyme-1b cDNA of Nucleotide.Nucleic acid fragment can be used for the nucleotide sequence of amplification technique (as PCR) to determine and/or to clone cDNA of the present invention of nucleic acid.
The Nucleotide full length sequence of people ACAT1b cDNA of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention relevant nucleotide sequence design primer, and the cDNA library in personnel selection cell source or the cDNA library that contains the human chromosome cell be as template, amplification and must relevant sequence.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.At present, can be fully obtain the dna sequence dna of gene of the present invention (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.
The method of application round pcr DNA amplification/RNA (Saiki RK et al., Science, 1985,230:1350-1354) be optimized for acquisition cDNA of the present invention.
The present invention also relates to comprise the construction or the carrier of gene of the present invention, and transform or the host cell of transduction with described construction or carrier, and the method that produces ACAT1b through recombinant technology.
Be applicable to that exogenous promoter of the present invention is not particularly limited, nearly all exogenous promoter all can be used for the present invention.The example of representational exogenous promoter comprises (but being not limited to): various recombinant clone promotors, and as promotor of SV40 promotor, CMV promotor etc. and various synthetic etc.It should be noted that exogenous promoter also comprises the promotor from host itself.For example, for some inherited disease the disease that high reactivity or low activity caused of certain promotor (for example because of), can separate from patient itself and obtain relevant promotor, then it is linked to each other with cholesteryl ester synthetic enzyme of the present invention-1bcDNA sequence, formation contains the construction of exogenous promoter, then described construction is used to screen the medicine of treatment cholesterol related diseases or be used for gene therapy.
The exogenous promoter that a kind of example of construction is exactly with the cholesteryl ester synthetic enzyme-1b cDNA links to each other.As for the position relation of cholesteryl ester synthetic enzyme-1b cDNA and exogenous promoter, described cDNA sequence should be positioned at the downstream of exogenous promoter.
Among the present invention, the nucleotide sequence that contains people's cholesteryl ester synthetic enzyme-1b cDNA can preferably be inserted into carrier, for example in the expression vector.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: expression vector, cloning vector for example are applicable to the carrier in protokaryon (as bacteriums such as intestinal bacteria), eucaryon (as yeast), insect cell, vegetable cell, the mammalian cell.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.In expression vector, except containing replication orgin, cholesteryl ester synthetic enzyme-1b cDNA, also can contain controlling elementss such as exogenous promoter is transcribed with other, translation.
Method well-known to those having ordinary skill in the art can be used to make up and contains cholesteryl ester synthetic enzyme-1b cDNA and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al.Molecular Cloning, a Laboratory Manual, Cold SpringHarbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can be effectively be connected with exogenous promoter to be expressed, and is synthetic to instruct described cDNA and corresponding mRNA.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of suitable sequence and suitable promotor or the control sequence of people's cholesteryl ester synthetic enzyme-1b cDNA, can be used to transform appropriate host cell, so that it can expressing human cholesteryl ester synthetic enzyme-1b.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.The preferred mammal cell, as mouse, rat, monkey and people's cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.The method for transformation that is adopted includes, but are not limited to: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, to express ACAT1b.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth and expresses, cultivate.The extracellular can be expressed or be secreted into to above-mentioned recombinant polypeptide in cell or on cytolemma.
The present invention also comprises ACAT1b DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into ACAT1b gene product or fragment.The present invention also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.Antibody of the present invention can be prepared by the known various technology of those skilled in that art.
The antibody of anti-ACAT1b can be used in the immunohistochemistry technology, detects the ACAT1b in the biopsy specimen.Utilize albumen of the present invention,, can filter out with ACAT1b interactional material takes place, as inhibitor, agonist or antagonist etc. by various conventional screening methods.
The present invention also provides a kind of pharmaceutical composition, and it contains ACAT1b of the present invention, its coding nucleic acid, inhibitor, agonist, antagonist or antisense nucleic acid or their combination of safe and effective amount, and pharmaceutically acceptable carrier or vehicle.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 0.01 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that the ACAT1b of safe and effective amount or its antagonist, agonist are applied to Mammals, wherein this safe and effective amount is usually at least about 0.01 microgram/kg body weight, and in most of the cases be no more than about 10 mg/kg body weight, preferably this dosage is about 0.01 microgram/kg body weight-Yue 100 micrograms/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization ACAT1b level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The ACAT1b level that is detected in the test can be with laying down a definition the importance of ACAT1b in various diseases and be used to diagnose ACAT1b to lack as or increase caused disease.
The method that whether has ACAT1b in a kind of test sample is to utilize the specific antibody of ACAT1b to detect, and it comprises: sample is contacted with the ACAT1b specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample ACAT1b.
In one embodiment of the invention, method by pcr amplification and gene recombination has obtained people ACAT1b cDNA sequence, analyze simultaneously and find that this cDNA sequence 5 '-zone has the GGC translation initiation codon, 3 '-zone has TAG translation stop codon, illustrate that this is the gene cDNA sequence that frame is read in a kind of atypia translation, a kind of people's cholesteryl ester synthetic enzyme of 591 aminoacid sequences of its coding is ACAT1b.
In another embodiment, the present invention is with the expression vector of people ACAT1b cDNA, transfection mammalian cell is expressed, analyzed the cholesteryl ester synthetase albumen that people ACAT1b cDNA expresses, utilize the Cell-free systems approach to measure the cholesteryl ester synthase activity simultaneously, show that transfectional cell expressing human ACAT1b has the cholesteryl ester synthase activity, but far below the positive control activity, show its diagnosis and treatment, drug research, have extremely important value cholesterol metabolic relative diseases such as hypercholesterolemia ester diseases.
Cholesteryl ester synthetic enzyme of the present invention-1b cDNA has broad application prospects.ACAT1b is still significant to diagnosis, treatment and the drug screening of cholesterol related diseases (comprising atherosclerosis, Alzheimer's disease etc.) to fundamental research.The present invention makes people can change the expression activity of ACAT in specific period, particular organization, thereby, and can utilize cDNA of the present invention in mammalian cell, to express ACAT1b for treatment cholesterol metabolic relative disease (as atherosclerosis etc.) and neural transformation disease provide another kind of approach.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:Cold Spring HarborLaboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Clone, the evaluation of embodiment 1 people ACAT1b cDNA
For obtaining to contain people ACAT1b cDNA sequence, design synthetic primer, sequence is as follows:
L1D2BF：5’ACCGCTCGAGTAGTTAAATAG3’
H1T7C1：5’AGGTCTAGAACAGCTGGCTCCAAAT3’
Use L1D2BF and H1T7C1 primer, utilize pcr amplification ACAT1 cDNA K1 sequence, this PCR product cloning is gone into XhoI and the XbaI site of pcDNA3 (available from Invitrogen), sequencing is correct.Find that on this basis this cDNA sequence has the function of 591 amino acid whose people's cholesteryl ester synthetic enzyme of coding, contriver's called after ACAT1b gene order.
The nucleotide sequence of the people ACAT1b cDNA that records is shown in Fig. 1 and SEQ ID NO:1.
The ACAT1b cDNA sequence that obtains according to order-checking and the research of a series of series jumps, analyze and find that this cDNA sequence 5 '-zone has non-AUG (GGC) translation initiation codon, 3 '-zone and has TAG translation stop codon, illustrate that this is to have the gene cDNA sequence that frame is read in the atypia translation, people's cholesteryl ester synthetic enzyme of 591 aminoacid sequences of its coding is ACAT1b (Fig. 2), has Duoed 41 amino acid residue sequences than the people ACAT1s of external colleague report.
Be to determine protein expression and the enzyme activity assay of people ACAT1b cDNA, with the coding region of the people ACAT cDNA K1 sequence of report earlier as positive (Positive) contrast; Then, the positive control and the sample cDNA that obtain are inserted respectively between the XhoI and XbaI of pcDNA3 (available from Invitrogene company), be positioned at the downstream of CMV promotor, obtain corresponding carrier for expression of eukaryon: pcDNA3-A1s and pcDNA3-A1b (referring to Fig. 3 A collection of illustrative plates).For separating with ACAT1s albumen, corresponding codon in ACAT1b cDNA is introduced sudden change, inserts equally between the XhoI and XbaI of pcDNA3, is positioned at the downstream of CMV promotor, obtain corresponding carrier for expression of eukaryon: pcDNA3-A1bm, make its expression ACAT1b (referring to Fig. 3 B expression map).
Utilize the Chinese hamster ovary celI strain AC29 of a strain ACAT defective type, in F12 substratum (containing 10%FBS, 100 μ g/mlstreptomycin, 100 μ g/ml penicillin), in humidity 95%, 5%CO
2, 37 ℃ cultivate down.The expression analysis of people ACAT1bcDNA proteins encoded determines that by transfection experiment the method for selecting for use is coprecipitation of calcium phosphate method (Calcium-phosphate transfection, Liu J et al.1997).With carrier pcDNA3 (Negative contrast), pcDNA3-A1s (Positive contrast), pcDNA3-A1b and four kinds of plasmid DNA of pcDNA3-A1bm, AC29 carries out expression study with the strain of calcium phosphate method transfection ACAT defective type Chinese hamster ovary celI respectively.
Concrete experimentation is as follows: transfection seeds cells in the 60mm culture dish (dish) the day before yesterday, and every dish cell count is 500,000/5ml, and the cell abundance reaches 30-50% during transfection.Transfection renewed bright substratum in preceding 3 hours.Preparation calcium phosphate precipitation plasmid DNA comprises 12 μ g sample plasmid DNA (each dish), dropwise DNA/ calcium phosphate precipitation liquid is added in the training liquid 37 ℃ of transfection AC29 cells then.After 10 hours, PBS washes cell 2 times, recovers growth in fresh culture.Collect cells transfected after 48 hours.
It is as follows that collecting cell is measured protein expression: the transfectional cell of cultivation washes twice with cold PBS, adds 100 μ l cell pyrolysis liquids (10%SDS, 50mM Tris-HCl pH 6.8,1mM EDTA, 25mM DTT) dissolved cell protein.The lysis protein solution is sheared for several times with No. 18 syringe needles, with fracture heavy-gravity chromosomal DNA.Determining the protein quantity carries out according to Lowry method slightly modified.SDS-PAGE analyzes and carries out according to the Laemmli method, and gum concentration is 12%.After electrophoresis finished, polyacrylamide gel-4 a layer electricity that shifts filter paper-nitrocellulose filter-electricity commentaries on classics damping fluid rinsing of spreading 4 layers of electrotransfer liquid on the instrument from bottom to up respectively and soaking at running gel changeed the filter paper that liquid soaks, and sets electric current 1mA/cm
2Shifted 30 minutes.Nitrocellulose filter that transfer finishes after 30 minutes, adds the DM54 ACAT2 antibody mulch film of dilution with the TBST damping fluid sealing that contains 5% skim-milk, and 4 ℃ are shaken and spend the night or room temperature 2 hours.The TBST damping fluid is washed film 3 times.The goat anti-rabbit igg mulch film that adds the horseradish peroxidase-labeled of dilution then, room temperature 1 hour, the TBST damping fluid is washed film 3 times, and the TBS damping fluid is washed film 2 times.Carry out fluorography by the method that ECL Western blot detection kit (Santa CruzBiotechnology Inc. company) provides, the result is referring to Fig. 3 B.
The enzyme activity assay of embodiment 5 cell cultures, DNA transfection and people ACAT1b cDNA expressing protein
Cell cultures, DNA transfection experiment carry out the Cell-free systems approach then and measure the cholesteryl ester synthase activity substantially with above-mentioned embodiment 4.
The analysis reference literature reported method of Cell free systems measurement cholesteryl ester synthase activity (Chang CCYet al., 1995, J.Biol.Chem.270:29532-29540), the cracking transfectional cell, add cholesterol and
3The oleoyl CoA substrate of H mark, the enzymic activity of ACAT in the mensuration microsome.Specific practice is, the transfection AC29 cell that cold PBS washes after twice adds the 1mM Tris (pH 7.8) that 100 μ l contain 1mM EDTA, place collecting cell lysate after 5 minutes on ice, get 15 μ l 2M KCl, 7.5 μ l 10%CHAPS, 37 ℃ of effects of 15 μ l cell lysates and reaction substrate 10 minutes add 4ml CHCl3: MeOH (2: 1) mixing termination reaction then, add 10 μ l oleoyl cholesterol again, mixing adds 1ml water, and is centrifugal, abandon water, dry up, add 60 μ l ethyl acetates, thin-layer chromatography, collect cholesterol ester, isotropic substance is counted, and proofreaies and correct the expression amount (standard A CAT activity, Normalized ACAT Activity) of ACAT1b with Western blot.This method records ACAT1b and has the cholesteryl ester synthase activity, but far below positive control (referring to Fig. 4).
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Shanghai Inst. of Life Science, CAS
＜120〉people's cholesteryl ester synthetic enzyme-1b and encoding sequence thereof
<130>03121b
<160>4
<170>PatentIn?version?3.1
<210>1
<211>1873
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<220>
<221>CDS
<222>(32)…(1807)
<223>
<400>1
1?tagttaaata?gctatattta?tatatatcca?g 31
ggc?acc?ccg?aat?tcg?gga?gag?ctt?ccc?gga?gtc?gac?ctt?cct?gct 76
Gly?Thr?Pro?Asn?Ser?Gly?Glu?Leu?Pro?Gly?Val?Asp?Leu?Pro?Ala
1 5 10 15
ggc?tgc?tct?gtg?acc?gct?tcc?cgg?ctc?tgc?cct?ctt?ggc?cga?agt 121
Gly?Cys?Ser?Val?Thr?Ala?Ser?Arg?Leu?Cys?Pro?Leu?Gly?Arg?Ser
20 25 30
gcc?cgc?tgc?cgg?gcg?cgg?gcc?tca?gac?aat?aca?atg?gtg?ggt?gaa 166
Ala?Arg?Cys?Arg?Ala?Arg?Ala?Ser?Asp?Asn?Thr?Met?Val?Gly?Glu
35 40 45
gag?aag?atg?tct?cta?aga?aac?cgg?ctg?tca?aag?tcc?agg?gaa?aat 211
Glu?Lys?Met?Ser?Leu?Arg?Asn?Arg?Leu?Ser?Lys?Ser?Arg?Glu?Asn
50 55 60
cct?gag?gaa?gat?gaa?gac?cag?aga?aac?cct?gca?aag?gag?tcc?cta 256
Pro?Glu?Glu?Asp?Glu?Asp?Gln?Arg?Asn?Pro?Ala?Lys?Glu?Ser?Leu
65 70 75
gag?aca?cct?agt?aat?ggt?cga?att?gac?ata?aaa?cag?ttg?ata?gca 301
Glu?Thr?Pro?Ser?Asn?Gly?Arg?Ile?Asp?Ile?Lys?Gln?Leu?Ile?Ala
80 85 90
aag?aag?ata?aag?ttg?aca?gca?gag?gca?gag?gaa?ttg?aag?cca?ttt 346
Lys?Lys?Ile?Lys?Leu?Thr?Ala?Glu?Ala?Glu?Glu?Leu?Lys?Pro?Phe
95 100 105
ttt?atg?aag?gaa?gtt?ggc?agt?cac?ttt?gat?gat?ttt?gtg?acc?aat 391
Phe?Met?Lys?Glu?Val?Gly?Ser?His?Phe?Asp?Asp?Phe?Val?Thr?Asn
110 115 120
ctc?att?gaa?aag?tca?gca?tca?tta?gat?aat?ggt?ggg?tgc?gct?ctc 436
Leu?Ile?Glu?Lys?Ser?Ala?Ser?Leu?Asp?Asn?Gly?Gly?Cys?Ala?Leu
125 130 135
aca?acc?ttt?tct?gtt?ctt?gaa?gga?gag?aaa?aac?aac?cat?aga?gcg 481
Thr?Thr?Phe?Ser?Val?Leu?Glu?Gly?Glu?Lys?Asn?Asn?His?Arg?Ala
140 145 150
aag?gat?ttg?aga?gca?cct?cca?gaa?caa?gga?aag?att?ttt?att?gca 526
Lys?Asp?Leu?Arg?Ala?Pro?Pro?Glu?Gln?Gly?Lys?Ile?Phe?Ile?Ala
155 160 165
agg?cgc?tct?ctc?tta?gat?gaa?ctg?ctt?gaa?gtg?gac?cac?atc?aga 571
Arg?Arg?Ser?Leu?Leu?Asp?Glu?Leu?Leu?Glu?Val?Asp?His?Ile?Arg
170 175 180
aca?ata?tat?cac?atg?ttt?att?gcc?ctc?ctc?ttt?ctc?ttt?atc?ctc 616
Thr?Ile?Tyr?His?Met?Phe?Ile?Ala?Leu?Leu?Phe?Leu?Phe?Ile?Leu
185 190 195
agc?aca?ctt?gta?gta?gat?tac?att?gat?gaa?gga?agg?ctg?gtg?ctt 661
Ser?Thr?Leu?Val?Val?Asp?Tyr?Ile?Asp?Glu?Gly?Arg?Leu?Val?Leu
200 205 210
gag?ttc?agc?ctc?ctg?tct?tat?gct?ttt?ggc?aaa?ttt?cct?acc?gtt 706
Glu?Phe?Ser?Leu?Leu?Ser?Tyr?Ala?Phe?Gly?Lys?Phe?Pro?Thr?Val
215 220 225
gtt?tgg?acc?tgg?tgg?atc?atg?ttc?ctg?tct?aca?ttt?tca?gtt?ccc 751
Val?Trp?Thr?Trp?Trp?Ile?Met?Phe?Leu?Ser?Thr?Phe?Ser?Val?Pro
230 235 240
tat?ttt?ctg?ttt?caa?cat?tgg?gcc?act?ggc?tat?agc?aag?agt?tct 796
Tyr?Phe?Leu?Phe?Gln?His?Trp?Ala?Thr?Gly?Tyr?Ser?Lys?Ser?Ser
245 250 255
cat?ccg?ctg?atc?cgt?tct?ctc?ttc?cat?ggc?ttt?ctt?ttc?atg?atc 841
His?Pro?Leu?Ile?Arg?Ser?Leu?Phe?His?Gly?Phe?Leu?Phe?Met?Ile
260 265 270
ttc?cag?att?gga?gtt?cta?ggt?ttt?gga?cca?aca?tat?gtt?gtg?tta 886
Phe?Gln?Ile?Gly?Val?Leu?Gly?Phe?Gly?Pro?Thr?Tyr?Val?Val?Leu
275 280 285
gca?tat?aca?ctg?cca?cca?gct?tcc?cgg?ttc?atc?att?ata?ttt?gag 931
Ala?Tyr?Thr?Leu?Pro?Pro?Ala?Ser?Arg?Phe?Ile?Ile?Ile?Phe?Glu
290 295 300
cag?att?cgt?ttt?gta?atg?aag?gcc?cac?tca?ttt?gtc?aga?gag?aac 976
Gln?Ile?Arg?Phe?Val?Met?Lys?Ala?His?Ser?Phe?Val?Arg?Glu?Asn
305 310 315
gtg?cct?cgg?gta?cta?aat?tca?gct?aag?gag?aaa?tca?agc?act?gtt 1021
Val?Pro?Arg?Val?Leu?Asn?Ser?Ala?Lys?Glu?Lys?Ser?Ser?Thr?Val
320 325 330
cca?ata?cct?aca?gtc?aac?cag?tat?ttg?tac?ttc?tta?ttt?gct?cct 1066
Pro?Ile?Pro?Thr?Val?Asn?Gln?Tyr?Leu?Tyr?Phe?Leu?Phe?Ala?Pro
335 340 345
acc?ctt?atc?tac?cgt?gac?agc?tat?ccc?agg?aat?ccc?act?gta?aga 1111
Thr?Leu?Ile?Tyr?Arg?Asp?Ser?Tyr?Pro?Arg?Asn?Pro?Thr?Val?Arg
350 355 360
tgg?ggt?tat?gtc?gct?atg?aag?ttt?gca?cag?gtc?ttt?ggt?tgc?ttt 1156
Trp?Gly?Tyr?Val?Ala?Met?Lys?Phe?Ala?Gln?Val?Phe?Gly?Cys?Phe
365 370 375
ttc?tat?gtg?tac?tac?atc?ttt?gaa?agg?ctt?tgt?gcc?ccc?ttg?ttt 1201
Phe?Tyr?Val?Tyr?Tyr?Ile?Phe?Glu?Arg?Leu?Cys?Ala?Pro?Leu?Phe
380 385 390
cgg?aat?atc?aaa?cag?gag?ccc?ttc?agc?gct?cgt?gtt?ctg?gtc?cta 1246
Arg?Asn?Ile?Lys?Gln?Glu?Pro?Phe?Ser?Ala?Arg?Val?Leu?Val?Leu
395 400 405
tgt?gta?ttt?aac?tcc?atc?ttg?cca?ggt?gtg?ctg?att?ctc?ttc?ctt 1291
Cys?Val?Phe?Asn?Ser?Ile?Leu?Pro?Gly?Val?Leu?Ile?Leu?Phe?Leu
410 415 420
act?ttt?ttt?gcc?ttt?ttg?cac?tgc?tgg?ctc?aat?gcc?ttt?gct?gag 1336
Thr?Phe?Phe?Ala?Phe?Leu?His?Cys?Trp?Leu?Asn?Ala?Phe?Ala?Glu
425 430 435
atg?tta?cgc?ttt?ggt?gac?agg?atg?ttc?tat?aag?gat?tgg?tgg?aac 1381
Met?Leu?Arg?Phe?Gly?Asp?Arg?Met?Phe?Tyr?Lys?Asp?Trp?Trp?Asn
440 445 450
tcc?acg?tca?tac?tcc?aac?tat?tat?aga?acc?tgg?aat?gtg?gtg?gtc 1426
Ser?Thr?Ser?Tyr?Ser?Asn?Tyr?Tyr?Arg?Thr?Trp?Asn?Val?Val?Val
455 460 465
cat?gac?tgg?cta?tat?tac?tat?gct?tac?aag?gac?ttt?ctc?tgg?ttt 1471
His?Asp?Trp?Leu?Tyr?Tyr?Tyr?Ala?Tyr?Lys?Asp?Phe?Leu?Trp?Phe
470 475 480
ttc?tcc?aag?aga?ttc?aaa?tct?gct?gcc?atg?tta?gct?gtc?ttt?gct 1516
Phe?Ser?Lys?Arg?Phe?Lys?Ser?Ala?Ala?Met?Leu?Ala?Val?Phe?Ala
485 490 495
gta?tct?gct?gta?gta?cac?gaa?tat?gcc?ttg?gct?gtt?tgc?ttg?agc 1561
Val?Ser?Ala?Val?Val?His?Glu?Tyr?Ala?Leu?Ala?Val?Cys?Leu?Ser
500 505 510
ttt?ttc?tat?ccc?gtg?ctc?ttc?gtg?ctc?ttc?atg?ttc?ttt?gga?atg 1606
Phe?Phe?Tyr?Pro?Val?Leu?Phe?Val?Leu?Phe?Met?Phe?Phe?Gly?Met
515 520 525
gct?ttc?aac?ttc?att?gtc?aat?gat?agt?cgg?aaa?aag?ccg?att?tgg 1651
Ala?Phe?Asn?Phe?Ile?Val?Asn?Asp?Ser?Arg?Lys?Lys?Pro?Ile?Trp
530 535 540
aat?gtt?ctg?atg?tgg?act?tct?ctt?ttc?ttg?ggc?aat?gga?gtc?tta 1696
Asn?Val?Leu?Met?Trp?Thr?Ser?Leu?Phe?Leu?Gly?Asn?Gly?Val?Leu
545 550 555
ctc?tgc?ttt?tat?tct?caa?gaa?tgg?tat?gca?cgt?cgg?cac?tgt?cct 1741
Leu?Cys?Phe?Tyr?Ser?Gln?Glu?Trp?Tyr?Ala?Arg?Arg?His?Cys?Pro
560 565 570
ctg?aaa?aat?ccc?aca?ttt?ttg?gat?tat?gtc?cgg?cca?cgt?tcc?tgg 1786
Leu?Lys?Asn?Pro?Thr?Phe?Leu?Asp?Tyr?Val?Arg?Pro?Arg?Ser?Trp
575 580 585
act?tgt?cgt?tac?gtg?ttt?tag?aagcttggac?tttgtttcct?ccttgtcact?1837
Thr?Cys?Arg?Tyr?Val?Phe
590
gaagattggg?tagctccctg?atttggagcc?agctgt 1873
<210>2
<211>591
<212>PRT
＜213〉homo sapiens
<400>2
Gly?Thr?Pro?Asn?Ser?Gly?Glu?Leu?Pro?Gly?Val?Asp?Leu?Pro?Ala
1 5 10 15
Gly?Cys?Ser?Val?Thr?Ala?Ser?Arg?Leu?Cys?Pro?Leu?Gly?Arg?Ser
20 25 30
Ala?Arg?Cys?Arg?Ala?Arg?Ala?Ser?Asp?Asn?Thr?Met?Val?Gly?Glu
35 40 45
Glu?Lys?Met?Ser?Leu?Arg?Asn?Arg?Leu?Ser?Lys?Ser?Arg?Glu?Asn
50 55 60
Pro?Glu?Glu?Asp?Glu?Asp?Gln?Arg?Asn?Pro?Ala?Lys?Glu?Ser?Leu
65 70 75
Glu?Thr?Pro?Ser?Asn?Gly?Arg?Ile?Asp?Ile?Lys?Gln?Leu?Ile?Ala
80 85 90
Lys?Lys?Ile?Lys?Leu?Thr?Ala?Glu?Ala?Glu?Glu?Leu?Lys?Pro?Phe
95 100 105
Phe?Met?Lys?Glu?Val?Gly?Ser?His?Phe?Asp?Asp?Phe?Val?Thr?Asn
110 115 120
Leu?Ile?Glu?Lys?Ser?Ala?Ser?Leu?Asp?Asn?Gly?Gly?Cys?Ala?Leu
125 130 135
Thr?Thr?Phe?Ser?Val?Leu?Glu?Gly?Glu?Lys?Asn?Asn?His?Arg?Ala
140 145 150
Lys?Asp?Leu?Arg?Ala?Pro?Pro?Glu?Gln?Gly?Lys?Ile?Phe?Ile?Ala
155 160 165
Arg?Arg?Ser?Leu?Leu?Asp?Glu?Leu?Leu?Glu?Val?Asp?His?Ile?Arg
170 175 180
Thr?Ile?Tyr?His?Met?Phe?Ile?Ala?Leu?Leu?Phe?Leu?Phe?Ile?Leu
185 190 195
Ser?Thr?Leu?Val?Val?Asp?Tyr?Ile?Asp?Glu?Gly?Arg?Leu?Val?Leu
200 205 210
Glu?Phe?Ser?Leu?Leu?Ser?Tyr?Ala?Phe?Gly?Lys?Phe?Pro?Thr?Val
215 220 225
Val?Trp?Thr?Trp?Trp?Ile?Met?Phe?Leu?Ser?Thr?Phe?Ser?Val?Pro
230 235 240
Tyr?Phe?Leu?Phe?Gln?His?Trp?Ala?Thr?Gly?Tyr?Ser?Lys?Ser?Ser
245 250 255
His?Pro?Leu?Ile?Arg?Ser?Leu?Phe?His?Gly?Phe?Leu?Phe?Met?Ile
260 265 270
Phe?Gln?Ile?Gly?Val?Leu?Gly?Phe?Gly?Pro?Thr?Tyr?Val?Val?Leu
275 280 285
Ala?Tyr?Thr?Leu?Pro?Pro?Ala?Ser?Arg?Phe?Ile?Ile?Ile?Phe?Glu
290 295 300
Gln?Ile?Arg?Phe?Val?Met?Lys?Ala?His?Ser?Phe?Val?Arg?Glu?Asn
305 310 315
Val?Pro?Arg?Val?Leu?Asn?Ser?Ala?Lys?Glu?Lys?Ser?Ser?Thr?Val
320 325 330
Pro?Ile?Pro?Thr?Val?Asn?Gln?Tyr?Leu?Tyr?Phe?Leu?Phe?Ala?Pro
335 340 345
Thr?Leu?Ile?Tyr?Arg?Asp?Ser?Tyr?Pro?Arg?Asn?Pro?Thr?Val?Arg
350 355 360
Trp?Gly?Tyr?Val?Ala?Met?Lys?Phe?Ala?Gln?Val?Phe?Gly?Cys?Phe
365 370 375
Phe?Tyr?Val?Tyr?Tyr?Ile?Phe?Glu?Arg?Leu?Cys?Ala?Pro?Leu?Phe
380 385 390
Arg?Asn?Ile?Lys?Gln?Glu?Pro?Phe?Ser?Ala?Arg?Val?Leu?Val?Leu
395 400 405
Cys?Val?Phe?Asn?Ser?Ile?Leu?Pro?Gly?Val?Leu?Ile?Leu?Phe?Leu
410 415 420
Thr?Phe?Phe?Ala?Phe?Leu?His?Cys?Trp?Leu?Asn?Ala?Phe?Ala?Glu
425 430 435
Met?Leu?Arg?Phe?Gly?Asp?Arg?Met?Phe?Tyr?Lys?Asp?Trp?Trp?Asn
440 445 450
Ser?Thr?Ser?Tyr?Ser?Asn?Tyr?Tyr?Arg?Thr?Trp?Asn?Val?Val?Val
455 460 465
His?Asp?Trp?Leu?Tyr?Tyr?Tyr?Ala?Tyr?Lys?Asp?Phe?Leu?Trp?Phe
470 475 480
Phe?Ser?Lys?Arg?Phe?Lys?Ser?Ala?Ala?Met?Leu?Ala?Val?Phe?Ala
485 490 495
Val?Ser?Ala?Val?Val?His?Glu?Tyr?Ala?Leu?Ala?Val?Cys?Leu?Ser
500 505 510
Phe?Phe?Tyr?Pro?Val?Leu?Phe?Val?Leu?Phe?Met?Phe?Phe?Gly?Met
515 520 525
Ala?Phe?Asn?Phe?Ile?Val?Asn?Asp?Ser?Arg?Lys?Lys?Pro?Ile?Trp
530 535 540
Asn?Val?Leu?Met?Trp?Thr?Ser?Leu?Phe?Leu?Gly?Asn?Gly?Val?Leu
545 550 555
Leu?Cys?Phe?Tyr?Ser?Gln?Glu?Trp?Tyr?Ala?Arg?Arg?His?Cys?Pro
560 565 570
Leu?Lys?Asn?Pro?Thr?Phe?Leu?Asp?Tyr?Val?Arg?Pro?Arg?Ser?Trp
575 580 585
Thr?Cys?Arg?Tyr?Val?Phe
590
<210>3
<211>21
<212>DNA
＜213〉synthetic
<220>
<221>misc_feature
<222>(1)..(21)
＜223〉primer L1D2BF
<400>3
accgctcgag?tagttaaata?g 21
<210>4
<211>25
<212>DNA
＜213〉synthetic
<220>
<221>misc_feature
<222>(1)..(25)
＜223〉primer H1T7C1
<400>4
aggtctagaa?cagctggctc?caaat 25
Claims (15)
1. people's cholesteryl ester synthetic enzyme-1b is characterized in that this albumen is selected from down group:
(a) have albumen or its conservative property variant protein or its active fragments or its reactive derivative of SEQ ID NO:2 aminoacid sequence, and the 191st amino acids is proline(Pro),
(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have people's cholesteryl ester synthetic enzyme-1b function by (a) deutero-albumen, and the 191st amino acids is a proline(Pro).
2. people's cholesteryl ester synthetic enzyme-1b as claimed in claim 1 is characterized in that it has the aminoacid sequence shown in the SBQ ID NO:2.
3. isolating polynucleotide is characterized in that, it comprises a nucleotide sequence, and this nucleotide sequence is selected from down group:
(a) polynucleotide of polypeptide as claimed in claim 1 or 2 of encoding;
(b) with polynucleotide (a) complementary polynucleotide.
4. polynucleotide as claimed in claim 3 is characterized in that, this polynucleotide encoding has the albumen of aminoacid sequence shown in the SEQ ID NO:2.
5. polynucleotide as claimed in claim 4 is characterized in that, the sequence of these polynucleotide is selected from down a kind of of group:
(a) has the sequence of 32-1807 position among the SEQ ID NO:1;
(b) has the sequence of 1-1873 position among the SEQ ID NO:1.
6. a carrier is characterized in that, it contains the described polynucleotide of claim 3.
7. a host cell is characterized in that, it contains the described carrier of claim 6.
8. host cell as claimed in claim 7 is characterized in that described host cell is a mammalian cell.
9. host cell as claimed in claim 8 is characterized in that, described host cell is mouse, rat, monkey or people's a cell.
10. one kind has the active proteic preparation method of people's cholesteryl ester synthetic enzyme-1b, it is characterized in that this method comprises:
(a) under the condition that is fit to expressing human cholesteryl ester synthetic enzyme-1b, cultivate the described host cell of claim 7;
(b) from culture, isolate and have the active albumen of people's cholesteryl ester synthetic enzyme-1b.
11. an energy and the described people's cholesteryl ester synthetic enzyme of claim 1-1b specificity bonded antibody.
12. a pharmaceutical composition is characterized in that, it contains the claim 1 described people's cholesteryl ester synthetic enzyme-1b or the described polynucleotide of claim 3 of safe and effective amount, and pharmaceutically acceptable carrier.
13. the application of the described people's cholesteryl ester of claim 1 synthetic enzyme-1b in the medicine of screening or preparation treatment cholesterol related diseases.
14. the application of the described polynucleotide of claim 3 in the medicine of screening or preparation treatment cholesterol related diseases.
15. a method of screening the medicine of treatment cholesterol related diseases and neural transformation relative disease is characterized in that, comprises step:
(a) under the condition that is fit to growth, cultivate host cell, described host cell contains the described expression vector of claim 6, described expression vector contains described polynucleotide of claim 3 and the exogenous promoter that links to each other with this polynucleotide operability, wherein in the substratum of first group of host cell or lysate or preparation albumen, add candidate substances, in the substratum of second group of host cell or lysate or preparation albumen, do not add candidate substances;
(b) measure first group and second group of host cell or lysate or prepare the described cholesteryl ester synthetic enzyme of proteic claim 1-1b activity, wherein first group of host cell or lysate or prepare proteic this enzymic activity and be higher or lower than second group and just represent that this candidate substances is the medicine of treatment cholesterol related diseases.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2003101093683A CN1303209C (en) | 2003-12-12 | 2003-12-12 | Synthetase-1b for human cholesterol ester and coded sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2003101093683A CN1303209C (en) | 2003-12-12 | 2003-12-12 | Synthetase-1b for human cholesterol ester and coded sequence |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1626655A CN1626655A (en) | 2005-06-15 |
| CN1303209C true CN1303209C (en) | 2007-03-07 |
Family
ID=34758952
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2003101093683A Expired - Fee Related CN1303209C (en) | 2003-12-12 | 2003-12-12 | Synthetase-1b for human cholesterol ester and coded sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1303209C (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5834283A (en) * | 1992-10-14 | 1998-11-10 | Trustees Of Dartmouth College | Acyl coenzyme A:cholesterol acyltransferase (ACAT) |
| CN1224466A (en) * | 1996-06-21 | 1999-07-28 | 科奈尔研究基金会公司 | Acyltransferase and gene encoding acyltransferase |
| US6579974B1 (en) * | 1998-06-23 | 2003-06-17 | The Regents Of The University Of California | Acyl CoA:cholesterol acyltransferase (ACAT-2) |
-
2003
- 2003-12-12 CN CNB2003101093683A patent/CN1303209C/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5834283A (en) * | 1992-10-14 | 1998-11-10 | Trustees Of Dartmouth College | Acyl coenzyme A:cholesterol acyltransferase (ACAT) |
| CN1224466A (en) * | 1996-06-21 | 1999-07-28 | 科奈尔研究基金会公司 | Acyltransferase and gene encoding acyltransferase |
| US6579974B1 (en) * | 1998-06-23 | 2003-06-17 | The Regents Of The University Of California | Acyl CoA:cholesterol acyltransferase (ACAT-2) |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1626655A (en) | 2005-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1048731C (en) | Drug binding protein | |
| CN1117876C (en) | Screening assay for compounds stimulating somatostatin and insulin production | |
| CN1835969A (en) | Mechanism of conditional regulation of hypoxia-inducible factor-1 by von Hippel-Lindau tumor suppressor protein | |
| CN1170850C (en) | Human angiogenin-like protein and coding sequence and application thereof | |
| CN1303209C (en) | Synthetase-1b for human cholesterol ester and coded sequence | |
| CN100335620C (en) | Human cholesteryl ester synthetase-2b and its coding sequence | |
| CN1160370C (en) | A novel human cell cysle control related protein and a sequence encoding the same | |
| CN1244595C (en) | Tumor suppressor protein and its application | |
| CN1932016A (en) | Polynucleotide affecting SRE activity and its coding polypeptides and use | |
| CN1234728C (en) | Novel human lymphokine, its coding sequence and use | |
| CN1618958A (en) | Human cholesteryl ester synthetase-2c and its coding sequence | |
| CN1241941C (en) | Protein for promoting nerve differentiation and resisting cell death, and its coding gene | |
| CN1170844C (en) | Human macrobiosis-ensuring protein and its coding sequence and application | |
| CN1704426A (en) | Cancer gene and its medical use | |
| CN1281962C (en) | Tumor relevant secretory protein as a liver cancer marker and uses thereof | |
| CN1289524C (en) | Human telomerase active inhibitor protein and use thereof | |
| CN1194010C (en) | New human protein with the function of inhibiting cancer cell growth and its coding sequence | |
| CN1177862C (en) | Human NIP2 associated protein and coding sequence and application thereof | |
| CN1500807A (en) | Method for diagnosing and curing alopecia utilizing the Rhor gene of human and rat and the encoding products | |
| CN1329064A (en) | Novel human protein with expression difference in liver cancer tissue and its code sequence | |
| CN1243017C (en) | Tumor suppressor, coded protein and application thereof | |
| CN1169958C (en) | Human protein able to suppress growth of cancer cells and its coding sequence | |
| CN1170843C (en) | Noven huamn protein with function of promoting growth of cancer cell and its code sequence | |
| CN1249082C (en) | Apoptosis promoting gene BNIPL, coding albumen and uses thereof | |
| CN1190446C (en) | New human protein with function of improving mouse NIH/3T3 cell transformation and its encoding sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200717 Address after: 200031 building 35, No. 320, Yueyang Road, Xuhui District, Shanghai Patentee after: Center for excellence and innovation of molecular cell science, Chinese Academy of Sciences Address before: 200031 No. 320, Yueyang Road, Shanghai Patentee before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| TR01 | Transfer of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070307 Termination date: 20211212 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |