CN1297921A - One kind of polypeptide and polynucleotides encoding this polypeptide - Google Patents

Abstract

The present invention discloses a novel polypeptide, novel human GrpE protein (hGrpE), polynucleotides encoding this polypeptide and DNA (RNA) recombination process to produce the polypeptide. The said polypeptide or polynucleotides may be used in the treatment of mitochondrion lesion and serious respiratory system disease and in the prevention of damage and lesion caused by emergency reaction. The present invention also discloses the activator and antagonist to this kind of polypeptide and their application, as well as the diagnosis and test method based on the discrimination of the mutation in hGrpE nucleic acid sequence and the change in the expression level of hGrpE polypeptide.

Description

The polynucleotide of one peptide species and this polypeptide of coding

The invention belongs to biological technical field, relate to a kind of hGrpE (hGrpE), and the polynucleotide sequence of coded polypeptide and its production and application.

GrpE, DnaJ and DnaK (Hsp70) are the heat shock proteins of finding in intestinal bacteria at first, and their constitute the molecular chaperones system of cell, to protein folding play an important role (Schonfeld HJetal., J Bio1 Chem 1995 Feb 3; 270 (5): 2183-9).Schroder H, etal (EMBO J 1993 Nov; 12 (11): 4137-44) do test and show, DnaK (Hsp70), the protein infringement that the colibacillary molecular chaperones that DnaJ and GrpE constituted stops and repair thermal induction to cause by the concentration of regulating sigma 32 factors with Photinus pyralis LUC.With substrate-function the time, need the ATPase activity of DnaK, and GrpE can regulate the ATPase activity of DnaK, and can make the active raising 40% of ATPase of DnaK at most.GrpE exists with dimer in solution, and DnaK then can form monomer, dimer and higher polymer because of its concentration is different.When not adding Nucleotide, a part DnaK and two molecule GrpE form stable complex body, further experiment shows, the albumen segment of the N-terminal 44-kDa of DnaK promptly can 1: 2 ratio and GrpE and form same stable complex body, the tool ATPase reactive site that this albumen segment is DnaK.Skowyra D, Wickner S (J BiolChem 1995 Nov 3; 270 (44): studies show that 26282-5), GrpE can change the avidity of DnaK and ATP and Mg2+ and play regulating effect.Illustrate (Harrison CJ., etal Science 1997 Apr18 recently with the interactional crystalline structure of ATPase reactive site of DnaK among the GrpE; 276 (5311): 431-5).

In eukaryote, also there are same GrpE equimolecular companion or heat shock protein(HSP).Nakai M, etal (Biochem Biophys Res Commun 1994 Apr 15; 200 (1): 435-42) clone Ygelp gene and Ssclp gene from yeast, function is distinguished quite and GrpE and DnaK gene among the E.coli.Laloraya S, etal Proc Natl Acad Sci U S A 1994 Jul5; 91 (14): the gene of GrpE function among the similar E.coli that 6481-5 clones from yeast, called after Mgelp gene.The function that studies show that this gene is that mediating protein enters plastosome and normal the folding in plastosome.Bolliger L, etal EMBO J 1994 Apr 15; 13 (8): the GrpE gene that 1998-2006 clones an encode protein molecule amount from yeast be 23 kDa, called after GRPE gene, and prove that it is that yeast existence is necessary.At higher plant such as pea (Zhang XP, etal JMo1 Biol 1999 Apr 23; 288 (1): 177-90), corn (Lund AA, etal PlantPhysiol 1998 Mar; 116 (3): also cloned the gene that similar functions is arranged 1097-110) respectively.Naylor, D.J., (FEBS Lett.396 (2-3), 181-188,1996) clone the GrpE gene from mouse, make the critical function of molecular chaperones in the higher mammal more and clearlyer, also more and more draw attention.Mestril R for example, etal (Biochem J 1994 Mar 15; 298 Pt3:561-9) do experiment with mouse and show, can induce the molecular chaperones that shields specifically under local asphyxia, histanoxia and the heat-shocked situation.Existing evidence shows, molecular chaperones all plays an important role in immunne response, the emergent and caused clinical response of tissue injury, no matter be that new synthetic is proteinic correct folding in the cell, still all be unable to do without effect (Green JM, etal Hybridoma 1995 Aug of molecular chaperones because of the renaturation of various factors after causing protein by sex change; 14 (4): 347-54).And no matter be the mitochondrial protein of nucleus coding, still Mitochondrial DNA self encoded protein matter is in its keying action of synthesizing, all be unableing to do without molecular chaperones in transhipment and the folding process and risen.Thereby GrpE genetic flaw or pathology can cause plastosome pathology and serious respiratory disease, tumour and programmed cell apoptosis (Martinus RD, etal Eur J Biochem 1996 Aug 15; 240 (1): 98-103).Pahlavani MA, etal (Exp Cell Res 1995 May; 218 (1): 310-8) experiment of being done with the rhesus monkey lymphocyte shows, the expression of molecular chaperones reduces with the growth at age in its lymphocyte, and this prompting replenishes or strengthen the effect of GrpE gene in the human body in vivo, can be anti-ageing and promote longevity.

One of purpose of the present invention provides a kind of isolating new polypeptide-human GrpE albumen (hGrpE) and fragment, analogue and derivative;

Two of purpose of the present invention provides the polynucleotide of this polypeptide of coding;

Three of purpose of the present invention provides the recombinant vectors of the polynucleotide that contain coding hGrpE (hGrpE);

Four of purpose of the present invention provides the genetically engineered host cell of the polynucleotide that contain coding hGrpE (hGrpE);

Five of purpose of the present invention provides the method for producing hGrpE (hGrpE);

Six of purpose of the present invention provides at polypeptide of the present invention--hGrpE's (hGrpE) antibody;

Seven of purpose of the present invention has provided at polypeptide of the present invention--hGrpE's (hGrpE) simulated compound, antagonist, agonist, inhibitor;

Eight of purpose of the present invention provides the method for the diagnoses and treatment disease relevant unusually with hGrpE (hGrpE).

The said hGrpE of the present invention (hGrpE) is the people source, and it comprises: have the polypeptide of SEQ IDNO:2 aminoacid sequence or its conservative property variation polypeptide or its active fragments or its reactive derivative, analogue.Preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.

Said " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.The polynucleotide and the polypeptide that are present under the native state in the active somatic cell are not pass through separation and purification, it separate with other materials from native state, then are separation and purification.

Said " isolating hGrpE (hGrpE) " is meant that hGrpE (hGrpE) is substantially free of other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying hGrpE (hGrpE) of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.The purity of hGrpE (hGrpE) polypeptide can be used amino acid sequence analysis.

Said new polypeptide--hGrpE (hGrpE), it is made up of the aminoacid sequence shown in the SEQ IDNO:2 basically.Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.

The present invention also comprises fragment, derivative and the analogue of hGrpE (hGrpE).As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of hGrpE of the present invention (hGrpE) or active polypeptide basically.The fragment of polypeptide of the present invention, derivative or analogue can be: (I) is a kind of like this, wherein one or more amino-acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the amino acid that replaces can be also can not encoded by genetic codon; Perhaps (II) is a kind of like this, and certain group on wherein one or more amino-acid residues is replaced by other group and comprises substituting group; Perhaps (III) is a kind of like this, and wherein mature polypeptide and another kind of compound (such as the compound that prolongs the polypeptide transformation period, for example polyoxyethylene glycol) merge; Perhaps (IV) is a kind of like this, wherein additional aminoacid sequence is integrated into mature polypeptide and the peptide sequence that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying) by the elaboration of this paper, such fragment, derivative and analogue are considered within those skilled in the art's ken.

The polynucleotide of said these polypeptide of coding of the present invention comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: the polynucleotide of above-mentioned hGrpE (hGrpE) that (a) encode; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 365-946 position among the SEQ ID NO:1; (b) has the sequence of 1-3507 position among the SEQ ID NO:1.

The invention provides isolating nucleic acid (polynucleotide), substantially the polynucleotide that have a polypeptide of SEQ ID NO:2 aminoacid sequence by coding are formed.Polynucleotide sequence of the present invention comprises the nucleotide sequence of SEQ IDNO:l.Polynucleotide of the present invention are to find from the cDNA library of people's fetal brain tissue.The polynucleotide sequence total length that it comprises is 1563 bases, its open reading frame (106-759) 217 amino acid of having encoded.Find relatively that according to amino acid sequence homologous this polypeptide and mouse GrpE albumen have 88% homogeny, deducibility goes out the 26S Proteasome Structure and Function that this hGrpE (hGrpE) has mouse GrpE protein similar.

Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.Said " varient of degeneracy " is meant that coding has protein or the polypeptide of SEQID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.

The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence that has only mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.

Term " polynucleotide of coded polypeptide " is meant polynucleotide that comprise this polypeptide of encoding and the polynucleotide that comprise additional code and/or non-coding sequence.

The invention still further relates to the varient of foregoing description polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.

The invention still further relates to and the polynucleotide (have at least 50% between two sequences, preferably have 70% homogeny) of sequence hybridization described above.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time adds and to use denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.

The invention still further relates to nucleic acid fragment with sequence hybridization described above.The length of said " nucleic acid fragment " contains 10 Nucleotide at least, better is 20-30 Nucleotide at least, is more preferably 50-60 Nucleotide at least, preferably more than at least 100 Nucleotide.Nucleic acid fragment also can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate coding hGrpE's (hGrpE) polynucleotide.

Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.

Coding hGrpE's of the present invention (hGrpE) special polynucleotide sequence can obtain with several different methods.For example, separate polynucleotide with hybridization technique well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect homologous polynucleotide sequence and 2) antibody screening of expression library to be to detect the polynucleotide passage of the clone with common structure feature.

Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.

In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, etal., Molecular Cloning, A Laboratory Manual, Cold Spring HarborLaboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination the polymeric enzyme reaction technology, even few expression product also can be cloned.

Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of mensuration hGrpE's (hGrpE) transcript; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.

In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 30 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.

In (4) kind method, detect the protein product of hGrpE (hGrpE) genetic expression and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.

Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.

The gene of the present invention that obtains as mentioned above, perhaps the polynucleotide sequence of various dna fragmentations etc. can with ordinary method such as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467) measure.This class polynucleotide sequence is measured also available commercial sequencing kit etc.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.

The present invention also relates to comprise the carrier of said polynucleotide, and with carrier of the present invention or the host cell of directly using host cell that hGrpE (hGrpE) encoding sequence produces through genetically engineered, transformed or transduceing or directly transformed by above-mentioned polynucleotide or the host cell of transduction, and the method that produces polypeptide of the present invention through recombinant technology by this carrier.

Among the present invention, coding hGrpE's (hGrpE) polynucleotide sequence can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on the T7 promotor of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, JBio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.

Method well-known to those having ordinary skill in the art can be used for structure and contain the coding hGrpE (expression vector of the dna sequence dna of hGrpE and suitable transcribing/translational control element.These methods comprise (Sambroook, et al.MolecularCloning, a Laboratory Manual, cold Spring Harbor Laboratory.NewYork, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Go into the PL promotor of phage; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.

Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.

Among the present invention, coding hGrpE's (hGrpE) polynucleotide or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.

Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results ₂Method is handled, and used step is well-known in this area.Alternative is to use MgCl ₂If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.

By the recombinant DNA technology of routine, utilize polynucleotide sequence of the present invention to can be used to express or produce hGrpE (hGrpE) (Science, 1984 of reorganization; 224:1431).In general following steps are arranged:

(1) with coding of the present invention hGrpE's (hGrpE) polynucleotide (or varient), or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;

(2) in suitable medium, cultivate host cell;

(3) separation, protein purification from substratum or cell.

In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.

In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.

Specifically with regard to hGrpE, the antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment, for example, can treat infection, apoplexy, local asphyxia, lose blood, wound, histanoxia and heat-shocked, direct stimulation extremely; Tissue injury; Tumour; The programmed cell apoptosis; Plastosome pathology, serious respiratory disease and delay senility.Because hGrpE can promote the renaturation after proteinic correct folding and the protein denaturation that various factors causes of new synthetic in the cell.

HGrpE polypeptide or its fragment or derivatives thereof are added to the growing multiplication that can promote cell in the clone, can also directly join in the active somatic cell by means such as liposome, electroporations.

The present invention also provides SCREENED COMPOUND to identify the method that improves (agonist) or check (antagonist) hGrpE's (hGrpE) medicament.Agonist improves hGrpE (hGrpE) biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, can be in the presence of medicine, with mammalian cell or express of hGrpE (hGrpE) cultivation of hGrpE's (hGrpE) film preparation with mark.Measure the medicine raising then or check this interactional ability.Agonist/inhibitor also can be used in the composition of (for example as described above) pharmaceutically acceptable carrier.

HGrpE's (hGrpE) antagonist comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.HGrpE's (hGrpE) antagonist can combine and eliminate its function with hGrpE (hGrpE), or suppresses the generation of this polypeptide, or combines with the avtive spot of this polypeptide and to make this polypeptide can not bring into play biological function.

In screening during as the compound of antagonist, hGrpE (hGrpE) can be added during bioanalysis measures, determine to interactional influence between hGrpE (hGrpE) and its acceptor whether compound is antagonist by measuring compound.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the acceptor disappearance thing and the analogue of antagonist action.Can (hGrpE bonded peptide molecule can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening and obtain with the hGrpE.During screening, generally tackle hGrpE (hGrpE) molecule and carry out mark.

The invention provides and use polypeptide, and fragment, derivative, analogue or their cell are as the method for antigen with production antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at hGrpE (hGrpE) antigenic determinant.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.

The method of the available hGrpE of the production of polyclonal antibody (hGrpE) direct injection immune animal (as rabbit, mouse, rat etc.) obtains, and multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.Preparation hGrpE's (hGrpE) the technology of monoclonal antibody include but not limited to hybridoma technology (Kohler and Milstein.Nature, 1975,256:495-497), three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morrison etal, PNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody (U.S.PatNo.4946778) also can be used for producing the single-chain antibody of anti-hGrpE (hGrpE).

Anti-hGrpE's (hGrpE) antibody can be used in the immunohistochemistry technology, detects the hGrpE (hGrpE) in the biopsy specimen.

With the also available labelled with radioisotope of hGrpE (hGrpE) bonded monoclonal antibody, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.

Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of hGrpE (hGrpE) high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing hGrpE (hGrpE) positive cells.

Antibody among the present invention can be used for treatment or prevention and the relevant disease of hGrpE (hGrpE).The antibody that gives suitable dosage can stimulate or block hGrpE's (hGrpE) generation or activity.

The invention still further relates to the diagnostic testing process of quantitative and detection and localization hGrpE (hGrpE) level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The hGrpE who is detected in the test (hGrpE) level can and be used to the disease of diagnosing hGrpE (hGrpE) to work with the importance of the hGrpE that lays down a definition (hGrpE) in various diseases.

Polypeptide of the present invention also can be used as the peptide spectrum analysis, for example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.

Coding hGrpE's (hGrpE) polynucleotide also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treatment because cell proliferation, growth or the metabolic disturbance due to hGrpE's (hGrpE) nothing expression or the unusual/non-activity expression.The gene therapy vector (as virus vector) of reorganization can be designed for the hGrpE (hGrpE) who expresses variation, to suppress endogenic hGrpE (hGrpE) activity.For example, a kind of hGrpE of variation (hGrpE) can be the hGrpE (hGrpE) who shortens, lacked signal conduction function territory, though can combine with the substrate in downstream, lacks signaling activity.Therefore the gene therapy vector of reorganization can be used for treating the disease of hGrpE (hGrpE) expression or active caused by abnormal.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for coding hGrpE's (hGrpE) polynucleotide are transferred in the cell.The method of recombinant viral vector that structure carries coding hGrpE's (hGrpE) polynucleotide be found in existing document (Sambrook, etal.).Reorganization coding hGrpE's (hGrpE) polynucleotide can be packaged in the liposome and be transferred in the cell in addition.

Polynucleotide import tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.

Suppress the oligonucleotide (comprising sense-rna and DNA) of { polypeptide title } mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.Polynucleotide of the present invention can be used to design antisense DNA or RNA, can be used for treating the various disorders relevant with cell proliferation with prevention (as tumour etc.) as inhibitor.Can be used for controlling gene by the formation of triple helical body or antisense DNA or RNA (two methods all are to be combined into the basis with polynucleotide and DNA or RNA) antisense technology expresses.For example, 5 ' encoding part of the polynucleotide sequence of code book invention mature polypeptide can be used for designing the antisense rna oligonucleotide of about 10-40 base pair length.The design dna oligonucleotide is complementary to and relates to the gene region of transcribing (the triple helical body is one by one referring to Lee etc., Nucl.Acids Res., 6:3073 (1979); Cooney etc., Science, 241:456 (1988); With Dervan etc., Science, 251:1360 (1991), prevent to transcribe generation thus with RABPA.Antisense rna oligonucleotide and mRNA are hybridized in vivo, and check the mRNA molecule and translate into hGrpE.Sense-rna and DNA can transporte to cells, and like this, they are expressed in vivo, to suppress the generation of hGrpE.In addition, sense-rna and DNA can phosphoric acid thioester key or the peptiolipid key to prolong its transformation period in vivo.

Coding hGrpE's (hGrpE) polynucleotide can be used for and hGrpE's (diagnosis of the relative disease of hGrpE.The expression that coding hGrpE's (hGrpE) polynucleotide can be used for detecting hGrpE (hGrpE) hGrpE's (hGrpE) whether or under morbid state unconventionality expression.As the hGrpE's that encodes (hGrpE) dna sequence dna can be used for biopsy specimen is hybridized to judge hGrpE's (hGrpE) expression situation.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip (being called gene chip again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect hGrpE (hGrpE) with the special primer of hGrpE (hGrpE).

The sudden change that detects hGrpE (hGrpE) gene also can be used for diagnosing the relevant disease of hGrpE (hGrpE).The form of hGrpE (hGrpE) sudden change comprises that the point mutation compared with normal wild type hGrpE (hGrpE) dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.

Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Now, have only chromosomal marker thing seldom to can be used for the marker chromosomes position based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.

In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.

The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).

The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., HumanChromosomes:a Manual of Basic Techniques, Pergamon Press, NewYork (1988).

In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch MedicalLibrary).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.

Then, need to measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (supposition l megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.

Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.

The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.

Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous.HGrpE (hGrpE) comes administration with the amount that treats and/or prevents concrete indication effectively.The amount and the dosage range that are applied to patient's hGrpE (hGrpE) will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.

Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.

Fig. 1 is hGrpE of the present invention (hGrpE) and the proteic amino acid sequence homology comparison diagram of mouse GrpE.The top sequence is hGrpE (hGrpE), and the below sequence is a mouse GrpE albumen.Same amino acid represents with monocase amino acid between two sequences, similar amino acid with+represent.By figure l as seen, homogeny=192/217 (88%), similarity=207/217 (95%).

Fig. 2 is isolating hGrpE's (hGrpE) polyacrylamide gel electrophoresis figure (SDS-PAGE).21kDa is proteinic molecular weight.The arrow indication is isolated protein band.

Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually show according to people such as normal condition such as Sambrook, [molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition], or the condition of advising according to manufacturer.

Embodiment 1: hGrpE's (hGrpE) clone

Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quik mRNAIsolation Kit (Qiegene company product).2ugpoly (A) mRNA forms cDNA through reverse transcription.CDNA fragment orientation is inserted on the multiple clone site of pBSK (+) carrier (Clontech company product) with Smart cDNA clone's test kit (available from Clontech), transforms DH5 α, bacterium forms the cDNA library.Measure all clones' 5 ' and 3 ' terminal sequence with Dye terminate cyclereaction sequencing kit (Perkin-Elmer company product) and ABI 377 automatic sequencers (Perkin-Elmer company).CDNA sequence and the existing public dna sequence data storehouse (Genebank) measured are compared, found that the cDNA sequence of one of them clone 0132D08 is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way mensuration.The result shows, the contained full-length cDNA of 0132D08 clone is 1563bp (shown in Seq ID NO:1), from 106bp to 759bp the open reading frame (ORF) of a 654bp, the new protein (shown in Seq ID NO:2) of encoding arranged.We are with this clone's called after pBS-0132D08, encoded protein matter called after hGrpE (hGrpE).

Embodiment 2:cDNA clone's homology retrieval

With hGrpE's of the present invention (hGrpE) sequence and encoded protein sequence thereof, with Blast program (Basiclocal Alignment search tool) [Altschul, SF et al.J.Mol.Biol.1990; 215:403-10], carry out the homology retrieval at databases such as Genbank, Swissport.With hGrpE of the present invention (hGrpE) gene that homology is the highest be a kind of known mouse GrpE albumen, its encoded protein number is U62940 in the access of Genbank.Protein homology the results are shown in Fig. 1, both height homologies, and its homogeny is 88%; Similarity is 95%.

Embodiment 3: with RT-PCR method clones coding hGrpE's (hGrpE) gene

Total RNA is a template with fetus brain cell, is that primer carries out the synthetic cDNA of reverse transcription reaction with oligo-dT, with behind the test kit purifying of Qiagene, carries out pcr amplification with following primer:

Primer1：5’-GGATTACGGATTGGCTGAGGCG-3’(SEQ?ID?NO：3)

Primer2：5’-AAAATAAACATTAGGGCTTTA-3’?(SEQ?ID?NO：4)

Primer1 is the forward sequence that begins of 1bp that is positioned at the 5 ' end of SEQ ID NO:1;

Primer2 be SEQ ID NO:1 in 3 ' end reverse sequence.

The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/LTris-Cl, (pH8.5), 1.5mmol/L MgCl ₂, 200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ of 30sec; 55 ℃ of 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of β-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.The dna sequence analysis result shows that the dna sequence dna of PCR product and the 1-1563bp shown in the SEQID NO:1 are identical.

Embodiment 4:Northern blotting is analyzed hGrpE (hGrpE) expression of gene:

Extract total RNA[Anal.Biochem 1987,162,156-159 with single stage method ］.This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) carries out homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49: 1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.With 20 μ g RNA, on 1.2% sepharose that contains 20mM 3-(N-morpholino) propanesulfonic acid (pH7.0)-SmM sodium acetate-1mMEDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α- ³²P dATP prepares by random priming ³²The dna probe of P-mark.Used dna probe is hGrpE's (hGrpE) coding region sequence (365bp to 946bp) of pcr amplification shown in Figure 1.Will ³²The probe of p-mark (about 2 * 10 ⁶Cpm/ml) spend the night in 42 ℃ of hybridization in a solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mM KH ₂PO ₄(pH7.4)-5 * SSC-5 * Denhardt s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with Phosphor Imager.

Embodiment 5: reorganization hGrpE's (hGrpE) vivoexpression, separation and purifying

According to SEQ ID NO:1 and coding region sequence shown in Figure 1, design a pair of specificity amplification primer, sequence is as follows:

Primer3：5’-CACCCTATGATGGCGGCTCAGTGCGTGAGGTTG-3’(Seq?ID?No：5)

Primer4：5，-CATGGATCCCTAACGTTCCTTCACCACCCCCAC-3’(Seq?ID?No：6)

5 ' end of these two sections primers contains Nde I and BamH I restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 ' end and 3 ' end thereafter, Nde I and BamH I restriction enzyme site are corresponding to expression vector plasmid pET-28b (+) (Novagen company product, Cat.No.69865.3) the selectivity restriction enzyme site on.With the pBS-0132D08 plasmid that contains the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain pBS-0589 plasmid 10pg, primer Primer-3 and Primer-4 among the cumulative volume 50 μ l and be respectively 10pmol, Advantage polymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2min, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with Nde I and BamH I, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial DH5 of Calcium Chloride Method α.Select the correct positive colony of sequence (pET-0132D08) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-0132D08) is cultured to logarithmic phase at 37C, adds IPTG to final concentration 1mmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant with carrying out chromatography with 6 Histidines (6His-Tag) bonded affinity column His.Bind Quick Cartridge (Novagen company product), has obtained the target protein hGrpE (hGrpE) of purifying.Through the SDS-PAGE electrophoresis, obtain a single band (Fig. 2) at the 21kDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.

Embodiment 6 anti-hGrpE (hGrpE) production of antibodies

With synthetic following hGrpE (hGrpE) specific polypeptide: the NH of Peptide synthesizer (PE company product) ₂-Met-Ala-Ala-Gln-Cys-Val-Arg-Leu-Ala-Arg-Arg-Ser-Leu-Pro-Ala-COOH (SEQ ID NO:7).Form compoundly with hemocyanin and bovine serum albumin coupling this polypeptide respectively, method is referring to Avrameas, et al.Immunochemistry, 1969; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the cyanogen bromide-activated Sepharose4B post, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with hGrpE (hGrpE) specifically.

Sequence table (1) general information:

(ⅱ) denomination of invention: hGrpE (hGrpE) and encoding sequence thereof

(ⅲ) sequence number: the information of 7 (2) SEQ ID NO:1:

(ⅰ) sequence signature:

(A) length: 1563bp

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ⅱ) molecule type: cDNA

( ⅹⅰ ) ：SEQ ID NO：1： 1 GGATTACGGATTGGCTGAGGCGAAGTAGTAGGGCAGAAAAGTGGGTATAGCTGCCTGCAA 61 TCACGCTTGGTGCGTGCGCGGCGACTGCGACGGGCAGTGGCAGTCATGGCGGCTCAGTGC121 GTGAGGTTGGCGCGGCGCAGTCTTCCTGCTTTGGCGTTGTCTCTCAGGCCATCTCCCCGG181 TTGTTGTGCACAGCCACGAAACAAAAGAACAGTGGCCAGAACCTGGAAGAGGACATGGGT241 CAGAGTGAACAGAAGGCAGATCCTCCTGCTACAGAGAAGACCCTCCTGGAAGAGAAGGTC301 AAGTTGGAGGAACAGCTGAAGGAGACTGTGGAAAAATATAAACGAGCTTTGGCAGACACT361 GAGAACTTACGGCAGAGGAGCCAGAAATTGGTGGAGGAGGCAAAATTATACGGCATTCAA421 GCCTTCTGCAAGGACTTGTTGGAGGTGGCAGACGTTCTGGAGAAGGCAACACAGTGTGTT481 CCAAAAGAAGAAATTAAAGACGATAACCCTCACCTGAAGAACCTCTATGAGGGGCTGGTC541 ATGACTGAAGTCCAGATCCAGAAGGTGTTCACAAAGCATGGCTTGCTCAAGTTGAACCCT601 GTCGGAGCCAAGTTCGACCCTTATGAACATGAGGCCTTGTTCCACACACCGGTTGAGGGG661 AAGGAGCCAGGCACAGTGGCCCTAGTTAGCAAAGTGGGGTACAAGCTGCATGGGCGCACT721 CTGAGACCCGCCCTGGTGGGGGTGGTGAAGGAAGCTTAGCTGCTGTTGATGGGGTGGGTG781 TTTTTAAACTCACTTGATGTAACTCTCAAGGCTGGTTCATTGTTTCTCATCTATGAGTAC841 GTGTGACCTTTTCCCAAACCTTATTGGAAACCTTAAGTAACCAGTGGCTAAACAGAAAAG901 CCGGTTGCCCAACTGCATTAATGAACTCTAATTCGGGAGTCTGTTCCCTTTTAGTGCCAC 961 GCGTTGAATAGTTCCACATACTTTCAGAAGAGCTCAGCAGGGCCCTGCCTGGTCTCCCGA1021 GCATCATGAGTAACGTGTCTGCTCAGACTCTGCTGACACCAAAGTATTTTAAACAAATAA1081 AAGGTCTTGGGGAATTCTGTTTGGCTACCTGGGCACGCCAGTCTGCACCATGTGTCCCTG1141 CGGCGCATGAGTGACTGGCGTATTTAGCCCGTCACATTTCATTCGCTGAAGGAAAGGCAA1201 GAGAGTTGAAACATTTTTCTTACTTAAAAAAAATGATCTTTGTGAAGAACATAGTGAGTT1261 CGTTTGTCTTCAGTCAACAGCGGCTGAAACTGACCACTGAGAAATGGGTGTGGGCACTGA1321 CAGTTCTCCCCCATTATTTGGCCAGGAATTGAGCTTGGCTTGGCAAAGTTCCTTTTACCC1381 TGTTCTGTTCATCTAAATGCAGACATATTTAAATCATATTCAACTAGTTACTAATGACCT1441 CAAGTTGTATTCCCTGGCAAAATGGACTTTCTCAAAATAGGACTGCACGCTTGGTGTACT1501 TTAAATGTTAATGTTTAATTTAAAATTTTTATTTAAGAGGATTAAAGCCCTAATGTTTAT1561 TTT ( 3 ) SEQ ID NO：2：

(ⅰ) sequence signature:

(A) length: 217 amino acid

(B) type: amino acid

(C) topological framework: linearity

(ⅱ) molecule type: polypeptide

( ⅹⅰ ) ：SEQ ID NO：2： 1 Met Ala Ala Gln Cys Val Arg Leu Ala Arg Arg Ser Leu Pro Ala 16 Leu Ala Leu Ser Leu Arg Pro Ser Pro Arg Leu Leu Cys Thr Ala 31 Thr Lys Gln Lys Asn Ser Gly Gln Asn Leu Glu Glu Asp Met Gly 46 Gln Ser Glu Gln Lys Ala Asp Pro Pro Ala Thr Glu Lys Thr Leu 61 Leu Glu Glu Lys Val Lys Leu Glu Glu Gln Leu Lys Glu Thr Val 76 Glu Lys Tyr Lys Arg Ala Leu Ala Asp Thr Glu Asn Leu Arg Gln 91 Arg Ser Gln Lys Leu Val Glu Glu Ala Lys Leu Tyr Gly Ile Gln106 Ala Phe Cys Lys Asp Leu Leu Glu Val Ala Asp Val Leu Glu Lys121 Ala Thr Gln Cys Val Pro Lys Glu Glu Ile Lys Asp Asp Agn Pro136 His Leu Lys Asn Leu Tyr Glu Gly Leu Val Met Thr Glu Val Gln151 Ile Gln Lys Val Phe Thr Lys His Gly Leu Leu Lys Leu Asn Pro166 Val Gly Ala Lys Phe Asp Pro Tyr Glu His Glu Ala Leu Phe His181 Thr Pro Val Glu Gly Lys Glu Pro Gly Thr Val Ala Leu Val Ser196 Lys Val Gly Tyr Lys Leu His Gly Arg Thr Leu Arg Pro Ala Leu211 Val Gly Val Val Lys Glu Ala ( 4 ) SEQ ID NO：3

(ⅰ) sequence signature

(A) length: 22 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅹ ⅰ) sequence description: the information of SEQ ID NO:3:5 '-GGATTACGGATTGGCTGAGGCG-3 ' 22 (5) SEQ ID NO:4

(ⅰ) sequence signature

(A) length: 22 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅹ ⅰ) sequence description: the information of SEQ ID NO:4:5 '-AAAATAAACATTAGGGCTTTA-3 ' 22 (6) SEQ ID NO:5

(ⅰ) sequence signature

(A) length: 33 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅹ ⅰ) sequence description: the information of SEQ ID NO:5:5 '-CACCCTATGATGGCGGCTCAGTGCGTGAGGTTG-3 ' Nde I 33 (7) SEQ ID NO:6

(ⅰ) sequence signature

(A) length: 33 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅹ ⅰ) sequence description: the information of SEQ ID NO:6:5 '-CATGGATCCCTAACGTTCCTTCACCACCCCCAC-3 ' BamH I 33 (8) SEQ ID NO:7:

(ⅰ) sequence signature:

(A) length: 15 amino acid

(B) type: amino acid

(C) topological framework: linearity

(ⅱ) molecule type: polypeptide

(ⅹ ⅰ) sequence description: SEQ ID NO:7:NH ₂-Met-Ala-Ala-Gln-Cys-Val-Arg-Leu-Ala-Arg-Arg-Ser-Leu-Pro-Ala-COOH

Claims (18)

1. an isolated polypeptide-hGrpE is characterized in that it includes: the polypeptide of the aminoacid sequence shown in the SEQ IDNO:2 or the active fragments of its polypeptide, analogue or derivative.

2. polypeptide as claimed in claim 1, the aminoacid sequence that it is characterized in that described polypeptide, analogue or derivative has the homogeny with the aminoacid sequence at least 90% shown in the SEQ ID NO:2.

3. polypeptide as claimed in claim 2 is characterized in that it comprises the polypeptide with the aminoacid sequence shown in the SEQ ID NO:2.

4. isolating polynucleotide is characterized in that described polynucleotide comprise to be selected from down a kind of in the group:

(a) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in the SEQ ID NO:2 or its fragment, analogue, derivative;

(b) with polynucleotide (a) complementary polynucleotide; Or

(c) with (a) or the polynucleotide of at least 90% homogeny (b) are arranged.

5. polynucleotide as claimed in claim 4 is characterized in that described polynucleotide comprise the polynucleotide that coding has aminoacid sequence shown in the SEQ ID NO:2.

6. polynucleotide as claimed in claim 4, the sequence that it is characterized in that described polynucleotide include the sequence of 1-1563 position among the sequence of 106-759 position among the SEQ ID NO:1 or the SEQ ID NO:1.

7. a recombinant vectors that contains exogenous polynucleotide is characterized in that it is the recombinant vectors that is formed by the described polynucleotide of arbitrary claim among the claim 4-6 and plasmid, virus or vehicle expression vector establishment.

8, a kind of genetically engineered host cell that contains exogenous polynucleotide is characterized in that it is to be selected from following a kind of host cell:

(a) host cell that transforms or transduce with the described recombinant vectors of claim 7; Or

(b) host cell that transforms or transduce with the described polynucleotide of the arbitrary claim among the claim 4-6.

9. preparation method with the active polypeptide of hGrpE is characterized in that described method comprises:

(a) under expressing human GrpE albumen condition, cultivate the described through engineering approaches host cell of claim 8;

(b) from culture, isolate and have the active polypeptide of hGrpE.

10. energy and polypeptide bonded antibody, it is characterized in that described antibody be can with hGrpE's specificity bonded antibody.

11. the compound of an analoglike or adjusting polypeptide active or expression is characterized in that they are simulation, promotion, antagonism or the active compound that suppresses the hGrpE.

12. compound as claimed in claim 11 is characterized in that it is the polynucleotide sequence shown in the SEQ ID NO:1 or its segmental antisense sequences.

13. the described application of compound of claim 11, it is characterized in that described compound be used to regulate the hGrpE in vivo, the method for external activity.

14. the disease that a detection is relevant with the described polypeptide of arbitrary claim among the claim 1-3 or the method for disease susceptibility, it is characterized in that it comprises the described polypeptide expression amount that detects, perhaps detect the activity of described polypeptide, perhaps detect and cause described expression of polypeptides amount or active unusual nucleotide diversity in the polynucleotide.

15. the application as polypeptide as described in the arbitrary claim among the claim 1-3 is characterized in that it is applied to screen hGrpE's stand-in, agonist, antagonist or inhibitor; Perhaps be used for the peptide finger print identification.

16. the application as the described nucleic acid molecule of arbitrary claim among the claim 4-6 is characterized in that it is used for nucleic acid amplification reaction as primer, perhaps is used for hybridization as probe, perhaps is used to make gene chip or microarray.

17., it is characterized in that forming pharmaceutical composition with safe and effective dosage and pharmaceutically acceptable carrier as diagnosis or the treatment disease relevant unusually with the hGrpE with described polypeptide, polynucleotide or its stand-in, agonist, antagonist or inhibitor as the described polypeptide of arbitrary claim, polynucleotide or the application of compound in claim 1-6 and 11.

18. the described polypeptide of arbitrary claim, polynucleotide or application of compound in claim 1-6 and 11, it is characterized in that being used for the treatment of as malignant tumour with described polypeptide, polynucleotide or compound, hemopathy, the medicine of HIV infection and immunological disease and all kinds of inflammation.