CN1289662C - Method for efficiently establishing pure line gene knock-out mouse model - Google Patents
Method for efficiently establishing pure line gene knock-out mouse model Download PDFInfo
- Publication number
- CN1289662C CN1289662C CN 03142101 CN03142101A CN1289662C CN 1289662 C CN1289662 C CN 1289662C CN 03142101 CN03142101 CN 03142101 CN 03142101 A CN03142101 A CN 03142101A CN 1289662 C CN1289662 C CN 1289662C
- Authority
- CN
- China
- Prior art keywords
- gene
- promotor
- iap
- mouse
- human mammal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides a transgenic non-human being mammal used for generating a pure line gene knock-out mouse model. An ectogenic suicide gene is imported into an animal genome. An expression box comprises a promotor (a), a suicide gene (b) connected with the promotor in operability and a termination codon (c). After a transgenic animal (such as a mouse) establishes the family, the suicide gene is only expressed in a testis tissue. The transgenic animal can be used as a blastula donor in a gene knock-out technology in order to enhance the efficiency of the gene knock-out technology and solve the problem of impure genetic background of the knock-out mouse.
Description
Technical field
The present invention relates to field of transgenic technology.More specifically, relate to a kind of method that is sheerly the gene knockout mice model, sets up this pure lines gene knockout mice model, and the purposes that should be sheerly the gene knockout mice model.
Background technology
Since gene knochout technique comes out, in life science, obtained widespread use.Gene knochout technique itself conditional gene rejecting technology such as etap specificity, types of organization's specificity and drug-induced property occurred also in continuous development, greatly facilitates the careful research to gene function.Gene knochout technique has become one of most important means of gene functional research.
At present, obtain gene knockout mice from the cell that homologous recombination takes place and mainly contain three kinds of approach.
The one, carry out gene targeting at the ES cell levels, obtain homologous recombination ES cell clone, then through microinjection to blastaea or with the body early embryo polymerization, give the false pregnancy animal with embryo transfer, develop into chimeric animal.If the ES cell chimerism to reproductive tract, the animal in ES cell source will occur in the generation mice of chimeric animal, wherein half should be the gene knockout heterozygote.First kind of approach is most widely used at present, the most sophisticated method of technology.Yet obtain homologous recombination ES cell clone and will pass through processes such as electrotransfer, drug screening, enlarged culturing, reorganization ES cell clone exists than big-difference to the ability of reproductive tract cytodifferentiation, and causing allophenic mice and the mating of C57BL/6 black mouse acquisition grey mouse is that the probability of gene knockout heterozygote (50%) has bigger uncertainty.Under the part situation, also can influence phenotype analytical because of gene knockout mice genetic background difference.
The 2nd, utilize tetraploid embryo can only develop into the characteristics of embryo outside organization, the ES cell and the chimeric back of tetraploid blastaea of homologous recombination are transplanted to the false pregnancy animal, the offspring is the gene knockout heterozygote.This method is very high to the totipotency requirement of ES cell, and success ratio is lower, uses less.
In recent years, development along with clone's (nuclear transplantation) technology, a kind of new approach has appearred from the homologous recombination cell to the gene knockout animal: by the method for nuclear transplantation, give the ovum of stoning with the nuclear transplantation of homologous recombination cell (ES or other somatocyte), the individuality that develops into all is the gene knockout heterozygote.Because the present various health problems of cloned animal ubiquity, this method also seldom is used for gene knockout mice.
Therefore, this area presses for the efficient technology of setting up pure lines gene knockout mice model of exploitation.
Summary of the invention
Purpose of the present invention just provides a kind of method that is used for efficient foundation pure lines gene knockout mice model, and the transgene mouse model that is used for this method.
Another object of the present invention provides the purposes of this pure lines gene knockout mice model.
In a first aspect of the present invention, a kind of method that produces the transgenic nonhuman mammal of the specific expressed suicide gene of spermatogonium is provided, comprise step:
(a) provide a linearizing transgenosis construct, this construction from 5 ' to 3 ' contains (a) IAP promotor successively, (b) suicide gene that links to each other with the promotor operability, (c) terminator codon;
(b) with microinjection technique the linearizing transgenosis construct gene in the step (a) is introduced in the male pronucleus of non-human mammal zygote;
(c) with the zygote transplation of step (b) uterine tube to the non-human mammal of false pregnancy;
(d) produce genetically modified non-human mammal, be integrated with the suicide gene expression cassette in the genome of described non-human mammal, described expression cassette contains (a) IAP promotor, (b) suicide gene that links to each other with the promotor operability, (c) terminator codon.
In another preference, described method also comprises step:
(e) transgenic animal that step (d) is obtained are identified.
In another preference, described method also comprises step:
(f) making the transgenic animal of acquisition carry out that mating builds is to obtain filial generation.
In another preference, described suicide gene is hsv-TK, cytosine deaminase gene or VIV-TK.
In another preference, described non-human mammal is mouse, rat, rabbit, monkey.More preferably be mouse and rat.
In another preference, described IAP promotor contains the nucleotide sequence that the Genebank accession number is 1-1296 position among the X04120.
In another preference, behind the codon of terminator described in the transgenosis construct, also contain 3 ' the end long terminal repeat of IAP.
In a second aspect of the present invention, provide a kind of purposes of the non-human mammal that obtains with aforesaid method, as the blastaea donor in the gene knockout technology.
In a third aspect of the present invention, a kind of method that produces pure lines gene knockout non-human mammal is provided, comprise step:
(a) non-human mammal that aforesaid method of the present invention is obtained obtains its blastaea as the blastaea donor in the gene knockout technology;
(b) ES cell and the blastaea donor with homologous recombination forms chimeric blastaea, thereby obtains the mosaic embryo;
(c) produce the non-human mammal of gene knockout from the mosaic embryo;
Wherein, in the mosaic embryo development procedure or in animal birth back, induce the spermatogonium death in donor blastaea source with being selected from the suicide gene inductor of organizing down.
In another preference, described non-human mammal is mouse or rat.
Description of drawings
Fig. 1 has shown the structure collection of illustrative plates of transgenosis construct.
Fig. 2 has shown the PCR evaluation figure of IAP-TK transgenic positive mouse.The 765bp band appears in transgenic positive, and wild-type or negative mouse do not have specific amplification.
Fig. 3 has shown that RT-PCR analyzes the distribution expression pattern of hsv-TK.1 is the wild-type mice testis, and 2 is the transgenic mice testis RNA without reverse transcription, and 3-13 is respectively testis, the epididymis of transgenic mice, the gland that condenses, seminal vesicle, the heart, liver, lung, spleen, kidney, muscle, brain.Remaining tissue except that the transgenic mice testis does not all have special band amplification.
Embodiment
The inventor is extensive studies through going deep into, set up the specific commentaries on classics suicide gene of spermatogonium (as hsv-TK) mouse, with this mouse as the blastaea donor, in the mosaic growth course or the back of reaching maturity induce the spermatogonium death in blastaea source with medicine (as gancyclovir), the spermatogonium that the ES cell of then only recombinating is originated can be survived.Such allophenic mice and ES cell just can obtain the single generation mice of genetic background with the mouse mating of strain, even have increased access to the chance of gene knockout heterozygote mouse greatly.Finished the present invention on this basis.
Can be used for suicide gene of the present invention and be not particularly limited, can select the conventional various suicide genes that use in this area for use.Representational example comprises (but being not limited to): hsv-TK, Isocytosine deaminase (CD), VIV-TK etc.
Can be used for IAP promotor of the present invention and be not particularly limited, representational example comprises (but being not limited to): the IAP promotor etc. that derives from IAP promotor, other source or other type of WEHI-3B cell.The IAP promotor is A particle (intracisternal A-particle) promotor in the capsule, the sequence information of IAP can find from Genebank, its accession number is X04120, wherein 5 ' end tumor-necrosis factor glycoproteins (IAP5 ') (being also referred to as the IAP promotor) is the 1-1296 position, and 3 ' end tumor-necrosis factor glycoproteins (IAP3 ') be the 3741-5095 position.
In the present invention, the expression of suicide gene is subjected in the specific expressed IAP promotor of spermatogonium (the 1-1296 position of promptly containing sequence shown in the accession number X04120) control, thereby is implemented in the specific expressed of spermatogonium.In preference, suicide gene 3 ' end also contains 3 ' the end tumor-necrosis factor glycoproteins (IAP3 ') of IAP, for example contains the nucleotide sequence of the 3741-5095 position of sequence shown in the X04120, so that further improve specificity and the stability of expressing.
In addition, in suicide gene, except the polyA tail that can select himself for use, also can select the polyA tail in other sources for use, for example the polyA tail of SV40.
In the present invention, the example of non-human mammal comprises (but being not limited to): mouse, rat, rabbit, monkey etc. more preferably are rat and mouse (as the C57BL/6J mouse inbred lines).
In the method for generation transgenic animal of the present invention, at first make up a construction, this construction from 5 ' to 3 ' contains (a) IAP promotor successively, (b) suicide gene that links to each other with the promotor operability, (c) terminator codon.
After having obtained construction, available ordinary method changes linearizing transgenosis construct in the zygote over to.Treat mouse birth back identifies with methods such as PCR detections whether suicide gene is integrated into its genome, thereby obtain transgenic mice.
The transgenic mice that obtains with the inventive method has reproductive performance, and suicide gene (as hsv-TK) entails the offspring mouse with Mendelian's rule.
When setting up the pure lines gene knockout mice, can the ES cell of homologous recombination be introduced the mouse of the specific expressed suicide gene of spermatogonium in the mice embryonic phase by microinjection with transgenic mice of the present invention.
Because the tissue specificity of promotor, in transgenic mice of the present invention, suicide gene is only specific expressed in testis tissue, therefore use the suicide gene inductor, as 9-(1,3-dihydroxy-2-third oxygen methyl) guanine (gancyclovir), acycloguanosine (acyclovir) or pencyclovir are optionally induced the spermatogonium death in donor blastaea source, thereby the spermatogonium of allophenic mice all derives from the ES cell.Like this, improve the absolute quantity of the spermatogonium in ES cell source, and then improve the probability that occurs gene knockout mice among embedding and the body mouse offspring.In addition since mosaic can be directly and the ES cell with the mouse mating of strain, thereby be convenient to obtain the single gene knockout mice of genetic background.
In a preference of the present invention, (can be from the WEHI-3B mouse leukemia cell available from the ECACC of preservation mechanism, England) cloned the full sequence of IAP (intracisternal A-particle) except that CDS in the genomic dna, made up IAP-TK transgenosis plasmid, obtained 11 transgenic positive mouse through microinjection, bred through mating and set up 3 transgenic mice systems.Is that the expression of hsv-TK in the various tissues of male mice detects with the RT-PCR method to 49.Found that hsv-TK is only specific expressed in testis tissue.
Major advantage of the present invention is:
(a) transgenic mice of the present invention can produce pure lines gene knockout mice model efficiently.
(b) the present invention can improve the efficient that obtains gene knockout mice
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
The structure of IAP-TK plasmid
Synthetic primer IAPP1 and IAPP2 are template with the mouse cell genomic dna, and amplification contains the fragment IAPP1P2 of IAP3 ' end; Synthetic primer IAPP3 and IAPP4, amplification contains the fragment IAPP3P4 of IAP5 ' end.
The Table I primer sequence
| Primer | Sequence (5 '-3 ') | SEQ ID NO： |
| IAPP1 | CATTCGACGCGTTCTCACGA | 1 |
| IAPP2 | CTGCTCAAGTATTCTCCTGC | 2 |
| IAPP3 | GGCTGGCAAGCCTGTCTAACT | 3 |
| IAPP4 | CACGGAGTGGAAACAGGTTGT | 4 |
The IAPP1P2 fragment cloning that to cut through BamHI and SalI enzyme is to the SalI-BamHI site of pGL3-basic (Promega company), subsequently the hsv-TK gene of total length (this fragment comes from pPNT (can available from the transgenic animal mode top of University of Michigan)) is cloned into the XbaI-XhoI site, at last with the IAPP3P4 fragment cloning to the KpnI-SmaI site, obtain the structure (Fig. 1) of transgenosis plasmid IAP-TK.
Embodiment 2:
Hsv-TK introduces the generation of mouse fertilized egg and transgenic positive mouse through microinjection
After transgenosis plasmid IAP-TK uses SalI and NotI linearizing, reclaim the fragment that contains IAP and hsv-TK gene gene.
Linearizing DNA (about 500 copies) is injected in the male pronucleus of mouse fertilized egg, and the zygote transplation after the injection is given the false pregnancy mouse.After about 20 days, the mouse birth.Mouse was born after 3 weeks, cut tail and extract DNA, whether PCR (hsv-TK gene specific primer 5 '-CCCCTTCTTCGCTGGTACGAGGAG-3 ' (SEQ ID NO:5) and 5 '-AAGCGCGTGGAGTTGACCTGAAGT-3 ' (SEQID NO:6)) check and analysis have transgenosis to integrate.
The result as shown in Figure 2.Obtain 11 of transgenic positive mouse altogether, these mouse breed to build through mating and are, build together and have found 3 transgenic mice systems.
Embodiment 3:
The expression of transgenosis in the mouse testis tissue
Whether express in the mouse body in order to detect the IAP-TK fusion gene, extract the total RNA of mouse sialisterium according to a conventional method with Trizol reagent.Carry out reverse transcription by Takara RNA PCR Kit (Ver2.1) specification sheets, carry out pcr amplification then and detect the hsv-TK expression.Total tissue RNA such as transgenic mice testis, epididymis, the gland that condenses, seminal vesicle, the heart, liver, lung, spleen, kidney, muscle, brain are analyzed.
The result shows that hsv-TK only expresses (Fig. 3) in testis tissue.
This transgenic mice can be used for improving the efficient of gene knockout mice technology
The IAP-TK transgenic mice that embodiment 3 is obtained is as the blastaea donor in the gene knochout technique, in the mosaic embryo development procedure or after the birth, with medicine 9-(1,3-dihydroxy-2-third oxygen methyl) guanine (gancyclovir), acycloguanosine (acyclovir) or pencyclovir induce the spermatogonium death in donor blastaea source, the spermatogonium that only derives from the ES cell is retained, even the spermatogonium that killed spermatogonium possibility origin comes from the ES cell is compensatory, improve the absolute quantity of the spermatogonium in ES cell source, thereby improve the probability that occurs gene knockout mice among embedding and the body mouse offspring.
Utilize this transgenic mice to obtain the single gene knockout mice of genetic background
The IAP-TK transgenic mice that embodiment 3 is obtained is as the blastaea donor in the gene knochout technique, in the mosaic embryo development procedure or after the birth, with medicine 9-(1,3-dihydroxy-2-third oxygen methyl) guanine (gancyclovir), acycloguanosine (acyclovir) or pencyclovir induce the spermatogonium death in donor blastaea source, and the spermatogonium of allophenic mice all derives from the ES cell.Mosaic need not and the mating of C57BL/6 mouse, and obtains the single gene knockout mice of genetic background with the ES cell with the mouse mating of strain.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Shanghai Nanfangmoshi Biological Sci-Tech Dev Co., Ltd.
Shanghai Second Emdical University of Shanghai life science institute of Chinese Academy of Sciences health science center
Shanghai Second Emdical University
Model animals research centre, south, Shanghai
＜120〉a kind of method of efficient foundation pure lines gene knockout mice model
<130>033916
<160>6
<170>PatentIn version 3.1
<210>1
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>1
<210>2
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>2
<210>3
<211>21
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>3
ggctggcaag cctgtctaac t 21
<210>4
<211>21
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>4
cacggagtgg aaacaggttg t 21
<210>5
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>5
ccccttcttc gctggtacga ggag 24
<210>6
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>6
aagcgcgtgg agttgacctg aagt 24
Claims (11)
1. the method for the zygote of a transgenic nonhuman mammal that produces the specific expressed suicide gene of spermatogonium is characterized in that, comprises step:
(i) provide a linearizing transgenosis construct, this construction from 5 ' to 3 ' contains (a) IAP promotor successively, (b) suicide gene that links to each other with the promotor operability, (c) terminator codon;
(ii) the linearizing transgenosis construct gene in the step (i) is introduced in the male pronucleus of non-human mammal zygote, thereby is obtained zygote with microinjection technique,
Wherein said non-human mammal is mouse or rat.
2. the method for claim 1 is characterized in that, described suicide gene is hsv-TK, cytosine deaminase gene or VIV-TK.
3. the method for claim 1 is characterized in that, described non-human mammal is a mouse.
4. the method for claim 1 is characterized in that, described IAP promotor contains the nucleotide sequence that the Genebank accession number is 1-1296 position among the X04120.
5. the method for claim 1 is characterized in that, also contains 3 ' the end long terminal repeat of IAP behind the codon of terminator described in the transgenosis construct.
6. purposes with the prepared zygote of each described method among the claim 1-5, it is characterized in that, described zygote is used for preparation pure lines gene knockout non-human mammal, and described non-human mammal is mouse or rat, be integrated with the suicide gene expression cassette in the genome of wherein said non-human mammal, described expression cassette contains (a) IAP promotor, (b) suicide gene that links to each other with the promotor operability, (c) terminator codon.
7. purposes as claimed in claim 6 is characterized in that described non-human mammal is a mouse.
8. a linearizing transgenosis construct is characterized in that, this construction from 5 ' to 3 ' contains (a) IAP promotor, (b) suicide gene that links to each other with the promotor operability and (c) terminator codon successively.
9. construction as claimed in claim 8 is characterized in that, described suicide gene is hsv-TK, cytosine deaminase gene or VIV-TK.
10. construction as claimed in claim 8 is characterized in that, described IAP promotor contains the nucleotide sequence that the Genebank accession number is 1-1296 position among the X04120.
11. construction as claimed in claim 8 is characterized in that, also contains 3 ' the end long terminal repeat of IAP behind the codon of terminator described in the transgenosis construct.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03142101 CN1289662C (en) | 2003-08-08 | 2003-08-08 | Method for efficiently establishing pure line gene knock-out mouse model |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03142101 CN1289662C (en) | 2003-08-08 | 2003-08-08 | Method for efficiently establishing pure line gene knock-out mouse model |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1580251A CN1580251A (en) | 2005-02-16 |
| CN1289662C true CN1289662C (en) | 2006-12-13 |
Family
ID=34579373
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 03142101 Expired - Fee Related CN1289662C (en) | 2003-08-08 | 2003-08-08 | Method for efficiently establishing pure line gene knock-out mouse model |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1289662C (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101342372B (en) * | 2007-07-09 | 2011-06-29 | 上海南方模式生物科技发展有限公司 | Use of pancreatic lipase associated protein 1 |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101953317A (en) * | 2010-09-03 | 2011-01-26 | 浙江省医学科学院 | Method for establishing meriones unguiculatus hypercholesterolemia animal model |
| CN102876720B (en) * | 2011-07-13 | 2015-01-07 | 首都医科大学 | Kit for preparing transgenic animals through testis injection |
| CN104560944A (en) * | 2014-12-24 | 2015-04-29 | 张华� | Method for establishing mouse model for HLA-DQBI complete gene knockout experiment |
| CN105039400A (en) * | 2015-05-19 | 2015-11-11 | 上海大学 | Construction method and application of dcf1-knocked-out mouse model |
| CN107384966A (en) * | 2017-08-07 | 2017-11-24 | 苏州湖桥生物科技有限公司 | A kind of manufacture method of transgenic rabbits model |
-
2003
- 2003-08-08 CN CN 03142101 patent/CN1289662C/en not_active Expired - Fee Related
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101342372B (en) * | 2007-07-09 | 2011-06-29 | 上海南方模式生物科技发展有限公司 | Use of pancreatic lipase associated protein 1 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1580251A (en) | 2005-02-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jin et al. | Surrogate broodstock to enhance biotechnology research and applications in aquaculture | |
| McAndrew et al. | Application of genetics and genomics to aquaculture development: current and future directions | |
| Nam et al. | Accelerated growth performance and stable germ-line transmission in androgenetically derived homozygous transgenic mud loach, Misgurnus mizolepis | |
| CN112029765A (en) | Method for making Metrnl gene conditional knockout mouse model | |
| WO2022227692A1 (en) | Intermuscular bone-free crucian strain and cultivation method therefor | |
| CN107022647B (en) | SNP marker related to growth traits of micropterus salmoides and application thereof | |
| CN1289662C (en) | Method for efficiently establishing pure line gene knock-out mouse model | |
| CN111560401A (en) | Molecular breeding method for thickening interpuscular spurs of erythroculter ilishaeformis and megalobrama amblycephala | |
| Kato | Breeding studies on red sea bream Pagrus major: mass selection to genome editing | |
| KR101757619B1 (en) | Preparing method of synthetic pig by a cross between Duroc and Korean native pig, and synthetic pig using the same | |
| CN105918184A (en) | Method of hybrid breeding of excellent varieties of all-male yellow catfishes | |
| Nam et al. | Autotransgenic and allotransgenic manipulation of growth traits in fish for aquaculture: a review | |
| CN1810972A (en) | Lefteye flounder disease resistance related MHC gene marker and subsidiary breeding method | |
| Chan et al. | Electroporation-based CRISPR/Cas9 mosaic mutagenesis of β-Tubulin in the cultured oyster | |
| CN1297664C (en) | Recombination plasmid of expression bifluorescent gene | |
| CN113789352B (en) | Method for realizing sex control breeding of XX/XY sex genetic determination type fish and application | |
| Nam et al. | Development of transgenic fish: scientific background | |
| CN114403068A (en) | Low-salt-tolerance palaemon carinicauda strain breeding method | |
| CN1234871C (en) | Construction method using detoxiase gene as stable expression system in silkworm | |
| CN111549030A (en) | Molecular breeding method for thickening crucian muscles | |
| CN1647625A (en) | Method for producing new fluorescent fish and new fluorescent fish produced by said method | |
| CN1276080C (en) | Method for fish gene in site modification breeding | |
| CN117502338B (en) | Method for plasma mutagenesis of fertilized eggs of prawns at room temperature under normal pressure | |
| CN1399870A (en) | Selective cross breeding method of shellfishes | |
| CN111849977B (en) | Method for preparing transgenic animals by sperm vector, sgRNA for preparing short and small transgenic chickens and preparation method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20061213 Termination date: 20140808 |
|
| EXPY | Termination of patent right or utility model |