CN1286305A - Human membrane transfer protein and its coding sequence - Google Patents

Abstract

The present invention discloses a new human Ras- related protein hRab18 expressed in human normal suprarene tissue and its coding sequence. The precess for preparing said protein and its nucleic acid sequence and the process for detecting the hRab18 nucleic acid sequence and polypeptide in sample are also diclosed.

Description

A kind of new human membrane transfer protein and encoding sequence thereof

The present invention relates to cytology, immunology, oncology and neurophysiology field, more specifically, the present invention relates to a kind of new human membrane transfer protein hRab18 and nucleotide sequence thereof.The invention still further relates to the preparation method and the purposes of this albumen and nucleotide sequence.

The Rab family of mammalian cell is one of member of Ras superfamily, and it comprises more than 40 family member.Rab albumen is being brought into play important adjusting and directive function in secretion of eukaryotic film bubble and endocytic pathway.Dual isoprenylation takes place in the proteic carboxyl terminal of Rab under the effect of isoprene transferring enzyme, it is had and film accumulative function mutually.Rab albumen has the GTP hydrolytic enzyme activities, can combine with GTP and GDP respectively, and is little according to its molecular weight, features such as monomer structure, and " small molecules GTP kinases " is otherwise known as.The circulation that GTP combination and GTP are hydrolyzed between the GDP in the Rab albumen has formed a kind of molecular switch mechanism, promptly forms different proteic activity form of kinases conformation-Rab and inactive form by the multi-form combination of guanylic acid.Rab needs meticulous location as the regulatory factor that film bubble in the cell inner membrance bubble transportation merges, and each Rab family member all has specific cell inner membrance location.The diversity of the diversity of this complicacy and mammalian cell types, film bubble haulage track is closely related.As a big protein family, Rab brings into play its biological function and clinical value widely by its different family member, mainly contains the following aspects:

(a) regulating the transportation of intracellular film bubble mainly shows: the formation of transportation film bubble is subjected to finely regulating in (1) cell, have only when containing berth (docking) in the film bubble and merge required material, the reaction of sprouting could take place, the formation of transportation film bubble needs the participation (Pfeffer of Rab, S.R et al, Curr.Biol.1994,6,522-526; Nuoffer, C et al, Annu.Rev.Biochem.1994,63,949-990).(2) different Rab albumen are positioned diaphragm area in the different cells, are instructing the film bubble reactant transport of different routes respectively.The film bubble that participates between endoplasmic reticulum and the golgi body as Rab6 transports (Beranger F et al, Mol Cell Biol 1994 Jan; 14 (1): 744-58); Rab30 then relevant (de Leeuw HP et al, Br J Haematol 1998Oct with the accumulation of golgi body; 103 (1): 15-9).

(b) influence composition the discovering of cytoskeleton to Rab6: by Actin muscle, have between the film bubble that the cytoskeleton that microtubule is formed and Rab regulate transports certain getting in touch (Echard A et al, Science 1,998 279,580-585); (Kato M et al, J.Biol.Chm.1996 271,31775-31778) between the exocytosis of the synaptic membrane bubble that Rab3A-GTP regulates and the cytoskeleton that Actin muscle constitutes certain uncertainty relationship also.

(c) conduction has all specifically expressings in brain of important regulatory role Rab3a and Rab15 to signal, they are distributed in neurone and the neuroendocrine cell, in the dispose procedure of neurotransmitter, play an important role (Burns ME et al, J Gen Physiol 1998 Feb by the flowability of regulating the nerve ending film; 111 (2): 243-55).

(d) with panimmunity disease-related (1) Sai Saili syndromes (Sezary syndrome, erythroderma) is a kind of cutaneous T cell lymphoma, show as general property exfoliating erythrodermia, the unusual monocyte of hyperchromasy appears containing in violent itch in periphery lymphadenopathy and skin, lymphoglandula and the peripheral blood.In 17 Sai Saili syndromes patients, have the proteic overexpression of Rab2 (Culine S et al, JBiol Chem 1993 Jun5 are arranged in 13 its peripheral mononuclear cellses of patient; 268 (16): 11548-52); (2) in solid tumor patient's therapeutic process, find that the proteic overexpression of Rab2 changes with therapeutic process in its peripheral mononuclear cells.Deep shape mycosis and solid tumor patient are investigated discovery, and the proteic overexpression of Rab2 is relevant with the intravital immune events of machine.(Culine Set al, Eur J Cancer 1994; 30A (5): 670-4) Culine S et al, Nouv Rev Fr Hematol 1993Feb; 35 (1): 41-4; Culine S et al, Cancer Res 1992 Jun 1; 52 (11): 3083-8) (3) Xie Diyake-Dong syndromes (Chediak-Higashi syndrome) is a kind of autosomal recessive systemic disease, simultaneous phenomenon has oculocutaneous albimism, a large amount of leukocyte inclusionses occur (huge lysosome), the multiple organ-tissue cellular infiltration of health and pancytopenia, and malignant lymphoma may take place.Infer that this disease is because the defective of cell inner membrance bubble transportation aspect causes.It is relevant with Xie Diyake-Dong syndromes that Rab4 albumen has been determined.(Ikeda Het al, Biochem Mol Biol Int 1996 Nov; 40 (4): 647-51) (4) recent research shows, the antigenic action approach that Rab4 regulates acceptor in mouse (Mus musculus) A20 B cell strain plays crucial control action kou.(Lazzarino?DA?et?al，J?Exp?Med?1998?Nov?16；188(10)：1769-74)

(e) mutant of regulating organism metabolism GTP bonded Rablb can suppress new life's low-density lipoprotein (LDL) acceptor at intracellular normal transport and maturation (Castellano.F et al, J.Recept.Transduct.Res.1995 Sep-Dec; 15 (7-8): 847-62), and the unusual and arteriosclerosis and the coronary heart disease of low-density lipoprotein are closely related.

Rab18 mainly is expressed in the end face of the end face (apicalside) of the little tube cells of kidney central authorities (renal proximal tubule cell) and intestinal epithelial cells and basal surface, and (Genomics 1,997 45,623-625).Mouse Rab18 is mainly relevant with the function of the central tubule cell of kidney end face organoid.Studies show that Rab18 appears in the clothing structure under the cytolemma, this illustrate it and cytolemma relevant with the transportation between the endocytosis body in early days (J.Cell Sci.1994107,3437-3448).In neuronal cell, early stage endocytosis body has been considered to mediate transportation (the Curr.Opin.Cell Biol.1991 3 of cynapse bubble, 654-660), in epithelial cell, then mediated the iuntercellular transporter generation (J.Cell Biol.1992 116,577-583).But the function of Rab18 is not limited to the end face transport mechanism, its also relevant with the transportation of basal surface (J.Cell Sci.1994 Dec; 107 (Pt 12): 3437-3448).

Yet before the application, still there is not to disclose or reported people hRab18 albumen involved in the present invention.

First purpose of the present invention just provides a kind of new people's gene sequences h Rab18 (Genbank AccessionNo.AF136974), and this gene is a Ras protein related gene.

Second purpose of the present invention provides a kind of new people's albumen hRab18.

The 3rd purpose of the present invention provides a kind of recombinant technology that utilizes and produces the above-mentioned new people hRab18 albumen and the method for nucleotide sequence.

The present invention also provides the application of this hRab18 protein polypeptide and encoding sequence.

In one aspect of the invention, a kind of isolated dna molecular is provided, this molecule comprises: coding has the nucleotide sequence of the polypeptide of people hRab18 protein active, shows at least 70% homology from the nucleotides sequence of Nucleotide 6-623 position dna molecular among described nucleotide sequence and the SEQ ID NO.6; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.6 in from the nucleotide sequence hybridization of Nucleotide 6-623 position.Preferably, described sequence encoding has the polypeptide of the aminoacid sequence shown in the SEQ ID NO.7.More preferably, described sequence has among the SEQ ID NO.6 nucleotide sequence from Nucleotide 6-623 position.

In another aspect of this invention, provide a kind of isolated people hRab18 protein and peptide, it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.7 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO.7 polypeptide of sequence.

In another aspect of this invention, also provide a kind of carrier, it comprises above-mentioned dna molecular.

In another aspect of this invention, also provide a kind of usefulness above-mentioned carrier transformed host cells.This host cell is intestinal bacteria in an example; In another example, this host cell is an eukaryotic cell.

In another aspect of this invention, also provide a kind of generation to have the method for the polypeptide of people hRab18 protein active, this method comprises:

(1) nucleotide sequence that coding is had a polypeptide of people hRab18 protein-active operationally is connected in expression regulation sequence, form people hRab18 protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 6-623 position among described nucleotide sequence and the SEQ ID NO.6;

(2) change the expression vector in the step (1) over to host cell, form the proteic reconstitution cell of people hRab18;

(3) under the condition that is fit to expressing human hRab18 protein polypeptide, the reconstitution cell in the culturing step (2);

(4) isolate polypeptide with people hRab18 protein-active.

Preferably, the nucleotide sequence that uses in the method has the sequence of 6-623 position among the SEQ ID NO.6.

The present invention also provides and hRab18 protein polypeptide specificity bonded antibody.

In the present invention, " isolating ", " purifying " or " pure substantially " DNA are meant, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.

In the present invention, term " people hRab18 albumen (or polypeptide) encoding sequence " refer to the encode nucleotide sequence of polypeptide with people hRab18 protein-active is as 6-623 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.6.This degenerate sequence is meant, is arranged in the encoder block 6-623 position Nucleotide of SEQ ID NO.6 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.6 in 6-623 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.7 of also encoding out.This term also comprises can be under the moderate stringent condition, better under the height stringent condition with SEQ ID NO.6 in from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 6-623 position.This term also comprise with SEQ ID NO.6 in from the homology of nucleotide sequence at least 70% of Nucleotide 6-623 position, preferably at least 80%, more preferably at least 90%, at least 95% nucleotide sequence best.

This term also comprises encoding to have the variant form of open reading frame sequence among proteic, the SEQ ID NO.6 with people hRab18 identical function.These variant forms comprise (but being not limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 60 to hold interpolation 5 ' and/or 3 ', preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.

In the present invention, " pure substantially " protein or polypeptide are meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as measure the purity of polypeptide with column chromatography, PAGE or HPLC method.Substantially pure polypeptide is substantially free of the component of following it under the native state.

In the present invention, term " people hRab18 albumen or polypeptide " refers to have the SEQ ID NO.7 polypeptide of sequence of natural human hRab18 protein-active.This term also comprises having and variant form people hRab18 identical function, SEQID NO.7 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of hRab18 and reactive derivative.

The variant form of inventor hRab18 polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low stringent condition can with the coded albumen of the DNA of people hRab18 DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people hRab18 polypeptide to obtain.The present invention also provides other polypeptide, as comprises people hRab18 polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention also comprises the soluble fragments of people hRab18 polypeptide.Usually, this fragment have people hRab18 peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.

In the present invention, " hRab18 conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO.7, has 10 at the most, and preferably at the most 8, more preferably 5 amino acid is replaced by similar performance or close amino acid and formed polypeptide at the most.These conservative property variation polypeptide are preferably replaced according to table 1 and are produced.Table 1

Invention also comprises the analogue of people hRa18 albumen or polypeptide.The difference of these analogues and natural human hRab18 polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.

(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.

In the present invention, can select various carrier known in the art for use, the carrier as commercially available comprises plasmid, clay etc.When producing people hRab18 polypeptide of the present invention, the hRab18 encoding sequence operationally can be connected in expression regulation sequence, thereby form people hRab18 protein expression vector.

As used herein, " operationally being connected in " refers to a kind of like this situation, and promptly some part of linear DNA sequence can influence the activity of same other parts of linear DNA sequence.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA operationally is connected in polypeptid DNA so; If transcribing of promotor control sequence, it is operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally, " operationally being connected in " means adjacent, then means in reading frame adjacent for the secretion leader sequence.

In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is an eukaryotic cell, as Chinese hamster ovary celI, COS cell etc.

The present invention also provides the antibody special to people hRab18, comprises polyclonal antibody and monoclonal antibody.

In the present invention, can use a series of methods known in the art to prepare special antibody at hRab18.For example, the people hRab18 gene product or its antigen fragment of purifying is injected in the animal body to produce polyclonal antibody.Equally, the cell of expressing human hRab18 or its antigen fragment also can be used for animal is caused immunity and produces antibody.Antibody prepared in accordance with the present invention also can be monoclonal antibody, and these monoclonal antibodies can prepare (for example, Kohler et al., Nature 256:495,1975 with hybridoma technology; Kohler et al., Eur.J.Immunol.6:511,1976; Kohler et al., Eur.J.Immunol.6:292,1976).Antibody of the present invention comprises the antibody that can prevent the hRab18 function, also can be the antibody that does not influence people hRab18 function.Each antibody-like can produce by the fragment of people hRab18 gene product or functional domain are caused immunity, and people hRab18 gene product and fragment thereof can produce or synthesize with Peptide synthesizer with recombination method.With the hRab18 gene product bonded antibody of non-modified forms, can come immune animal to obtain by being used in the gene product that prokaryotic cell prokaryocyte for example produces among the E.coli.With posttranslational modification form such as glycosylation or phosphorylated protein or polypeptide bonded antibody, can obtain by the immune animal that comes that is used in the gene product that produces in eukaryotic cell such as yeast or the insect cell.

People hRab18 antibody of the present invention can be used for identifying the cell of expressing human hRab18 albumen or polypeptide, as Jurkat T cell.For example, can with a kind of detectable molecule for example fluorescein isothiocyanic acid (FITC) come mark hRab18 specific antibody, allow people hRab18 specific antibody contact then, detect and hRab18 specific antibody bonded cell with fluorescent microscope or flow cytometer again with cell sample.

Except cell surface detects people hRab18, can also analyze this protein with the Western engram technology.Cell pyrolysis liquid can from culturing cell or take from patient's tissue sample such as suprarenal gland extract, and be dissolved in the lysis buffer that contains stain remover.Use sds polyacrylamide gel electrophoresis isolated cell extract (simultaneously with the people hRab18 polypeptide of purifying as positive control) then, then it is transferred on the nitrocellulose by electrophoresis hybridization.In order to survey the hRab18 polypeptide, can use typical antibodies detection method, for example radioautograph or alkaline phosphatase enzyme assay method with the immunity of Western trace.And can use the contrast of immunization serum or incoherent monoclonal antibody as non-specific responding.

Whether and quantity the expression of also available Nothern blotting technical Analysis hRab18 gene product, the i.e. existence of rna transcription thing in cell of analyst hRab18.

The Western engram analysis of the Nothern engram analysis of people hRab18 DNA and people hRab18 specific antibody can also be united use, with the expression of confirmer hRab18 in biological specimen.People hRab18 DNA can also be used for Southern engram analysis or in situ hybridization analysis, with this assignment of genes gene mapping on karyomit(e), and can carry out genetic linkage analysis to find out other possible disease related gene.

In addition, the present invention also provides a kind of nucleic acid molecule that can be used as probe, and this molecule has 8-100 of hRab18 nucleotide coding sequence, preferably 15-50 continuous nucleotide usually.This probe can be used for whether existing in the test sample nucleic acid molecule of the hRab18 that encodes.

The present invention also provides the method that whether has the hRab18 nucleotide sequence in the test sample, and it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer is corresponding to the hRab18 nucleotide coding sequence, and can be positioned at the both sides or the centre of this encoding sequence.Primer length is generally 20-50 Nucleotide.

In addition, according to hRab18 nucleotide sequence of the present invention and aminoacid sequence, can be on the homology basis of nucleic acid homology or marking protein, screening hRab18 homologous gene or homologous protein.

In order to obtain and the people cDNAs of hRab18 gene-correlation or the dot matrix of genomic dna s, can screen people cDNA or genome dna library with dna probe, these probes are under low stringent condition, use ³²P hRab18 all or part of cooked the radioactivity mark and.The cDNA library that most is suitable for screening is the library from the human adrenal gland tissue.Also can be used for screening purpose from the cDNA library that participates in endocrine other tissue or specific human body cell strain.Structure is that biology field is well-known from the method in the cDNA library of interested cell or tissue.In addition, many such cDNA libraries also can buy, for example available from Clontech, and Palo Alto, Cal..This screening method can be discerned the nucleotide sequence of the gene family relevant with hRab18.

Can finish as follows according to Nucleotide similarity screening hRab18 homologue.Human acth cDNA library, for example (Clontech, Palo Alto Cal.) can use one section all or part of random primer dna probe screening that comprises the hRab18 gene order to Clontech Cat.#7430-1.Finish having clone's the evaluation of the DNA insertion sequence of 70% homology at least with the hRab18 sequence, can use hybridization temperature is 55 ℃ hybridization solution, uses 0.5 * SSC and 0.1%SDS to clean then.Shi Bie clone's DNA insertion sequence can be further estimated the similarity of it and hRab18 gene with DNA restriction endonuclease analysis and dna sequencing in this way.The distribution of tissue expression can be with above-mentioned Northern blotting technical Analysis.

The hRab18 homologue also can be used at the antibody of hRab18 albumen or polypeptide and discern.For example, can be with the method for standard to commercial or make up with currently known methods, from cell or organize for example adrenal expression library to screen.Pour the library into plate, on colony lift to a nitrocellulose membrane, the recombinant protein of expression is attached on the film.Just can carry out typical antibodies and detection then with specific people hRab18 antibody.Identify the DNA insertion sequence among the clone in this way, can be further analyze to estimate the similarity of it and hRab18 gene with DNA restriction endonuclease analysis and dna sequencing.The tissue expression of the gene of new identification distributes and can similarly analyze as stated above.

People hRab18 Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.

In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes people's cell again, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.

In addition, also the method for available artificial chemosynthesis is synthesized relevant sequence.Before the application, prior art fully can be by first synthetic a plurality of polynucleotide small segments, and then connect and obtain the proteic nucleotide sequence of code book contriver hRab18.Then, can be with in various existing dna moleculars (as carrier) and the cell in this nucleotide sequence introducing this area.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.

Except producing with recombination method, the also available solid phase technique of the proteic fragment of the present invention is produced (people such as Stewart, (1969) Solid-Phase Peptide Synthesis, WH Freeman Co., San Francisco by direct peptide synthesis; Merrifield J. (1963) J.Am Chem.Soc 85:2149-2154).Can carry out by hand or automatically at external synthetic protein.For example, can (Foster City CA) synthesizes peptide automatically with the 431A type peptide synthesizer of Applied Biosystems.Can distinguish proteic each fragment of chemosynthesis the present invention, be connected to produce the molecule of total length with chemical process then.

The proteic encoding sequence of the present invention can be used for the assignment of genes gene mapping.For example,, the cDNA clone is hybridized with the karyomit(e) of metaphase, can carry out chromosomal localization exactly by fluorescence in situ hybridization technique (FISH).This technology can be used the cDNA that is as short as about 500bp; Also can use and grow to about 2000bp or longer cDNA.For this technology, can be referring to people such as Verma, Human Chromosomes:A Manual ofBasic Techniques, Pergamon Press, New York (1988).

In case sequence is located in certain exact position on the karyomit(e), the physical location of sequence on karyomit(e) can be associated with the genetic map data.These genetic map data can obtain, for example by Mendelian (Mendelian) people genetic database (can obtain on the net by Johns Hopkins University Welch MedicalLibrary).Then, come identified gene by linkage analysis and be positioned dependency between the disease of same chromosomal region.

Then, be necessary to determine the cDNA between diseased individuals and the healthy individual or the difference of genome sequence aspect.Be not present in normal individual if a certain sudden change is present in part or all of diseased individuals, this sudden change may be exactly the paathogenic factor of this disease so.

Utilize people hRab18 albumen of the present invention,, can filter out with people hRab18 interactional material takes place, as acceptor, inhibitor or antagonist etc. by various conventional screening methods.

Inventor hRab18 albumen and antibody thereof, inhibitor, antagonist or acceptor etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, subcutaneous, intracutaneous or topical.

With people hRab18 albumen of the present invention is example, can be with itself and suitable pharmaceutically acceptable carrier coupling.This class pharmaceutical composition contains protein and the pharmaceutically acceptable carrier or the vehicle for the treatment of significant quantity.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.People hRab18 albumen of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.

When people hRab18 protein polypeptide of the present invention is used as medicine, this polypeptide of treatment effective dose can be applied to Mammals, wherein should treat effective dose usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.

Find by the homology retrieval, new gene of the present invention has and delivers and be confirmed to be the proteic gene of mouse (Musmusculus) Rab18 (GeneBank Accession X803333) height homologous sequence, and new albumen of the present invention has the aminoacid sequence of mouse (Mus musculus) Rab18 albumen (GenPept AccessionCAA56583) high conservative.So hRab18 of the present invention is a homologous gene of mouse (Mus musculus) Rab18 protein gene and has similar function.

Find that by the homology retrieval new albumen of the present invention has and the gene height homologous sequence of delivering and be confirmed to be Rab18, and new albumen of the present invention has the aminoacid sequence of Rab gene family high conservative.Further studies show that, the present invention with deliver and be confirmed to be mouse Rab18 gene and have high homology (mouse Rab18 gene belongs to the Rab gene family), also have higher homology with other Rab family members in addition.So hRab18 gene of the present invention belongs to the Rab gene family, be a homologous gene of mouse Rab18 gene and have similar function.

Fig. 1 is that the homology of people hRab18 of the present invention and mouse Rab18 (mRab18) gene nucleic acid sequence (GenBankAccession No.X80333) compares (FASTA) figure.Wherein, identical Nucleotide marks with " | ".

Fig. 2 is that the homology of people hRab18 albumen of the present invention and other Rab gene family members' aminoacid sequence compares (PILEUP) figure.RB18_MOUSE: mouse Rab Argine Monohydrochloride sequence (GenePept ACCESSION No.CAA56583); Hrab13: people Rab13 Argine Monohydrochloride sequence (Swissprot Accession No.P51153); Hrablc: people Rablc Argine Monohydrochloride sequence (Swissprot Accession No.Q15286); Hrab30: people Rab30 Argine Monohydrochloride sequence (Swissprot Accession No.Q15771); Hrab18: people Rab18 Argine Monohydrochloride sequence; Hrab14: people Rab14 Argine Monohydrochloride sequence; Hrab2: people Rab2 Argine Monohydrochloride sequence (Swissprot AccessionNo.P08886)

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1

The clone of hRab18 gene

1. separate tissue (Tissue isolation)

Suprarenal gland derives from 5 normal adult male sex donors, takes out adrenal tissue in after death four hours, places the freezing preservation of liquid nitrogen immediately.

2.mRNA separation (mRNA isolation)

Take out tissue, grind, add the 50ml pipe that the people fills lysate, fully after the vibration, move again in people's glass homogenizer with mortar.Move to 50ml after the homogenate and newly manage, and extracted total RNA (TRlzol Reagents, Gibco, NY, USA).Identify total RNA quality with the denaturing formaldehyde gel electrophoresis.Cellulose column with band Oligo d (T) separates mRNA among total RNA, quantitatively.

3.cDNA the structure in library (Construction of cDNA library)

With mRNA is template, and synthetic double chain cDNA, reverse transcription primer are seen SEQ ID NO.1.After mending flat end, add the joint that contains the EcoRI point of contact, joint sequence is seen SEQ ID NO.2 and 3 respectively.Behind the phosphorylation EcoRI end, use XhoI digestion with restriction enzyme 1.5 hours, carry out fragment again and separate.Cross the fragment of post screening length＞500bp, use the phenol-chloroform extracting, ethanol sedimentation, the sterilized water dissolving is connected to Uni-ZAP XR carrier (Stratagene, CA9203, USA), with Zap-cDNA Gigapack III Gold Cloning Kit (Stratagene, CA9203, USA) pack, the host bacterium is used XL 1-Blue MRF bacterium.Coated plate is also measured titre.

4. order-checking and database are set up (Seqencing and Database Constructing)

Select the clone who has the external source fragment to insert in the library, amplification back extracting plasmid (Qiagen, Germany), with T3 and T7 universal primer as 3i end and 5 ends, adopt thing fluorescent mark (Big-Dye, Perkin-Elmer, method USA) of stopping, (Perkin-Elmer carries out the EST large scale sequencing on USA) at ABI 377 sequenators.Sequencing result is removed the carrier sequence with FACTURA software, is transferred to the processing of carrying out next step on SUN Ultra 450 Server.All sequence informations are used the GCG software package again, and (Wisconsin group, USA) BLAST in and the existing database of FASTA software search (Genebank+EMBL) are lower than 95% sequence with no homology or homology and are considered as new gene and set up database.

5. the full-length clone of gene (Cloning of Full-length cDNA)

On the new gene fragment order information basis that obtains, carry out the cDNA full-length clone, carry out in two stages:

(1) " electronic cloning " (Electronic Cloning)

Search the dbEST database with new gene fragment order as probe, with overlap＞50bp, homology is at (the Expressed Sequence Tag of the expressed sequence tag more than 98%, being called for short " EST ") sequence thinks same sequence (consensus sequence), take out and splice with AUTOASSEMBLER software, part EST can the extension probes sequence.Whether the sequence that is extended with the STRIDER software analysis has complete open reading frame (Open Reading Frame again, ORF), on Nucleotide and amino acid levels, whether homology is arranged with definite this sequence with BLAST search Genbank or SwissProt, to help how differentiate resulting full length gene integrity with other species.By the method for electronic cloning, can obtain the full length sequence of hRab18 gene usually.

(2) the terminal rapid amplifying of cDNA (Rapid Amplification of cDNA Ends, RACE)

If do not obtain complete cDNA total length yet by " electronic cloning " method, then at 5 of existing sequence ' or 3 ' end design primer, (Clontech Lab, Inc carry out the long range PCR reaction in USA) in human suprarenal gland Marathon-Ready cDNA library.Then to PCR product cloning, order-checking.The sequence that is extended with AUTOASSEMBLER and STRIDER software analysis has or not complete ORF, as not having, repeats said process until obtaining total length.

(3)RT-PCR

For 5 ' and 3 ' end known sequences, the centre still has an intersegmental crack (gap) to obtain from existing public database or its data storehouse, can consider to adopt the method for RT-PCR.At sequence 5 ' end design primer, 3 ' end primer adopts Oligo-dT, increases in the total RNA of suprarenal gland storehouse.Then product is cloned, checked order.Splice at last and obtain total length.

By being used in combination above-mentioned 3 kinds of methods, obtained candidate's the proteic complete encoding sequence of people hRab18.Obtain on the total length basis of (comprising complete open reading frame at least) in splicing, further the design primer " R1:5 '-TCAGGATGGACGAGGACGT-3 ' (SEQ ID NO.4) be a forward primer; oligonucleotide R2:5 '-GCAAGGTCCCTAAAATAGCAGT-3 ' (SEQ ID NO.5) be a reverse primer; the total RNA with adrenal tissue is a template; carry out RT-PCR and increase; the PCR condition of R1/R2 be 94 ℃ 5 minutes; carried out 35 circulations in 1 minute with 94 ℃ 30 seconds, 55 ℃ 30 seconds and 72 ℃, at last with 72 ℃ of extensions 5 minutes thereupon.The electrophoresis detection pcr amplification product, obtaining the purpose fragment length is 716bp.Clone, check order with pcr amplification product according to a conventional method then, obtain the sequence shown in SEQ ID NO.6.

Embodiment 2

The sequence information of hRab18 gene and homology analysis:

People hRab18 full-length cDNA (the GenBank Accession No.AF136974 that the present invention is new.Because of applying for maintaining secrecy, so open before the application to the public) length be 716bp, detailed sequence is seen SEQ ID NO.6, wherein open reading frame is positioned at 6-623 position Nucleotide.Derive the aminoacid sequence of hRab18 according to full-length cDNA, totally 206 amino-acid residues, molecular weight 22977.07, pI are 5.11.Detailed sequence is seen SEQ ID NO.7.

Full length cDNA sequence and coded protein thereof with hRab18, in Non-redundant GenBank+EMBL+DDBJ+PDB and Non-redundant GenBank CDStranslations+PDB+SwissProt+Superdate+PIR database, carry out the retrieval of Nucleotide and protein homology with blast program, found that all there is higher homology in the Rab gene in it and people, rat, mouse, nematode and even the fruit bat.On nucleotide level, the 1-618 bit base of the mRNA whole coding sequence (GenBankAccession No.X80333) of it and mouse Rab18 gene has 94.0% homogeny (Fig. 1).On amino acid levels, it and Ras family protein all have higher homology (Fig. 2), with mouse Rab18 albumen 99% homogeny are arranged.Thereby can determine that hRab18 of the present invention is a kind of people's a membrane transfer protein, belongs to Rab family.

People hRab18 of the present invention is used for further functional study except can be used as this family's a member, also can be used for producing fusion rotein with other albumen, such as producing fusion rotein with immunoglobulin (Ig).In addition, inventor hRab18 can also merge with other members of this family or exchange fragment, to produce new albumen.For example the N end of the N of inventor hRab18 end with the Rab18 of mouse exchanged, to produce the albumen that new activity is higher or have new features.

At the antibody of inventor hRab18, be used to screen other members of this family, perhaps be used for affinity purification associated protein (as other members of this family).

In addition, inventor hRab18 nucleic acid (encoding sequence or antisense sequences) can be introduced into cell, with expression level that improves people hRab18 or the overexpression that suppresses people hRab18.People hRab18 albumen of the present invention or its active polypeptide fragment can be applied to patient, with treatment or alleviate because of people hRab18 disappearance, no function or unusual cause related disorders arranged.In addition, can also be with carrying out relevant diagnosis or prognosis judgement based on nucleotide sequence of the present invention or antibody.

Embodiment 3

The proteic 26S Proteasome Structure and Function research of hRab18:

1. obtain following result according to sequence comparing analysis:

1?MDEDVLTTLK?ILIIGESGVG?KSSLLLRFTD?DTFDPELAAT?IGVDFKVKTI

51?SVDGNKAKLA?IWDTAGQERF?RTLTPSYYRG?AQGVILVYDV?TRRDTFVKLD

101?NWLNELETYC?TRNDIVNMLV?GNKIDKENRE?VDRNEGLKFA?RKHSMLFIEA

151?SAKTCDGVQC?AFEELVEKII?QTPGLWESEN?QNKGVKLSHR?EEGQGGGACG

201?GYCSVL

Conservative amino-acid residue below in aminoacid sequence, existing:

(1) underscore place (62,79,162) are the amino-acid residue of the high conservative of Ras superfamily

(2) runic (45,102) is that (Gene 1,993 132,273-278) for the distinctive conservative amino-acid residue of Rab family

With the proteic aminoacid sequence of hRab18 the PROSITE database (network address is: http://www.motif.genome.ad.jp/motif-bin/) retrieval motif (motif), obtain following result:

1?MDEDVLTTLK?ILIIGESGVG?KSSLLLRFTD?DTFDPELAAT?IGVDFKVKTI

51?SVDGNKAKLA?IWDTAGQERF?RTLTPSYYRG?AQGVILVYDV?TRRDTFVKLD

101?NWLNELETYC?TRNDIVNMLV?GNKIDKENRE?VDRNEGLKFA?RKHSMLFIEA

151?SAKTCDGVQC?AFEELVEKII?QTPGLWESEN?QNKGVKLSHR?EEGQGGGACG

201?GYCSVL

(1) in aminoacid sequence, there is following function motif:

(ⅰ) the underscore district (92-95,141-144): the protein kinase phosphorylation site (cAMP-and cGMP-dependent protein kinase phosphorylation site) that cAMP-and cGMP-rely on

(ⅱ) the runic district (8-10,91-93,151-153,188-190): protein kinase C phosphorylation site (Proteinkinase C phosphorylation site)

(ⅲ) wavy line district (135-138): casein kinase II phosphorylation site (Casein kinase II phosphorylation site)

(ⅳ) the italic district (18-23,136-141,157-162,174-179,184-189,193-198,195-200,196-201,197-202,200-205): N-myristoylation site (N-myristoylation site)

(ⅴ) double underline district (18-25): ATP/GTP-binding site motif A (ATP/GTP-binding site motifA (P-loop))

(ⅵ) the bold Italic district (7-10,111-114): N-glycosylation site (N-glycosylation site)

(2) functional analysis:

N holds glycosylation site, casein kinase II type phosphorylation site, and the N-glycosylation site, N-myristoylation site, the protein kinase C phosphorylation site is relevant with posttranslational modification (post-translational modifications).ATP/GTP-binding site motif is significant to the function of Rabs family, and Rabs albumen has the activity of GTP lytic enzyme, and they combine with regard to this site on dependence and the albumen with GTP, GDP's.

With the proteic aminoacid sequence of hRab18 the Blocks database (network address is: index structure module http://blocks.fhcrc.org) obtains following result:

1?MATAPYNYSY?IFKYIIIGDM?GVGKSCLLHQ?FTEKKFMADC?PHTIGVEFGT

51?RIIEVSGQKI?KLQIWDTAGQ?ERFRAVTRSY?YRGAAGALMV?YDITRRSTYN

101?HLSSWLTDAR?NLTNPNTVII?LIGNKADLEA?QRDVTYEEAK?QFAEENGLLF

151?LEASAKTGEN?VEDAFLEAAK?KIYQNIQDGS?LDLNAAESGV?QHKPSAPQGG

201?RLTSEPQPQR?EGCGC

(1) in aminoacid sequence, there is following construction module district:

(ⅰ) underscore zone: (12-33,35-51,53-75,29-51,115-128,150-172) transforming protein P21 (TRANSFORMING PROTEIN P21) belongs to the mark of Ras superfamily.

(ⅱ) runic zone: (46-85) ADP-ribosylation factor (ADP-ribosylation factors) includes a conservative GTP calmodulin binding domain CaM in this structural domain.

(2) structural analysis:

Above result shows that hRab18 belongs to one of member of Ras superfamily, and includes in its structure and GTP bonded zone, points out it with combining with hydrolysis of GTP close getting in touch to be arranged.

In sum, confirmed further that from proteic structure of hRab18 and physicochemical property this gene is the member of Rab gene family.Because protein structure has determined the specific biochemical theory of function, therefore people hRab18 gene of the present invention has or identical functions similar to Rab gene family member.This gene plays a significant role in the transportation of film bubble.

Embodiment 4

The distribution expression pattern of hRab18 gene

1. electronics Northern express spectra.Press people's such as Ton C. method (Ton C et al., Biochem BiophysRes Commun 1997 Dec 18; 241 (2): 589-594; Hwang DM, et al., Circulation 1997 Dec16; 96 (12): 4146-4203), the BLAST retrieval will be done in the dbEST database of hRab18 cDNA sequence in the GCG software package, in the human EST that obtains, the EST of probable value＜10e-10, homogeny＞95% has 21, can be considered the transcriptional expression of this gene in tissue originally, draw the tissue spectrum of expressing this gene thus, find that it all has expression in brain, thymus gland, heart, liver, lung, marrow, pancreas, prostate gland and spleen cell.This shows that this albumen all bringing into play important effect in the many tissues of human body.

Embodiment 5

The preparation of hRab18 polypeptide and purification

In this embodiment, the hRab18 encoding sequence of total length or fragment are built into commercial protein merge among the expression vector, to express and purification of recombinant proteins.

HRab18 albumen or polypeptide can carry out prokaryotic expression with the form of gst fusion protein in intestinal bacteria.

(a) construction of prokaryotic expression vector, and transformed into escherichia coli

Complete encoding sequence (SEQ ID NO.ID No.6) according to people hRab18, design amplifies complete coding and reads the primer of frame (correspond respectively to encoding sequence 5 ' and about 20 above Nucleotide of 3 ' end), and on positive anti-primer, introduce restriction endonuclease sites (this is decided by the carrier of selecting for use) respectively, so that construction of expression vector.With the amplified production that obtains among the embodiment 1 is template, behind pcr amplification, with the hRab18 gene guarantee to read be cloned under the correct prerequisite of frame the pGEX-2T carrier (Pharmacia, Piscataway, NJ).Identify that good expression vector utilizes CaCl ₂Method changes bacillus coli DH 5 alpha over to, and Screening and Identification obtains containing the engineering bacteria DH5 α-pGEX-2T-hRab18 of pGEX-2T-hRab18 expression vector.

(b) isolation identification of the engineering bacteria of expression GST-hRab18 recombinant protein

DH5 α-pGEX-2T-hRab18 the engineering bacteria of picking list bacterium colony contains jolting overnight incubation in the LB substratum of 100 μ g/ml penbritins in 3ml, draw nutrient solution by 1: 100 concentration and in new LB substratum (containing 100 μ g/ml penbritins), cultivated about 3 hours, to OD ₆₀₀After reaching 0.5, adding IPTG continues at 37 ℃ to final concentration 1mmol/L and cultivated respectively 0,1,2,3 hours.It is centrifugal to get the different 1ml bacterium liquid of incubation time, in the bacterial precipitation thing, add lysate (2 * SDS sample-loading buffer, 50 μ l, distilled water 45 μ l, 3-mercaptoethanol 5 μ l), the suspendible bacterial precipitation, boiled in the boiling water bath 5 minutes, 10000 left the heart 1 minute, and supernatant adds electrophoresis in the 12%SDS-PAGE glue.The bacterial strain that the protein content of dyeing back observation expection molecular weight size increases with the IPTG induction time is the engineering bacteria of expressing the GST-hRabl8 fusion rotein.

(c) the extraction purifying of GST-hRab18 fusion rotein

The proteic engineering bacteria DH5 of abduction delivering GST-hRab18 amalgamation and expression α-pGEX-2T-hRab18 as stated above.Bacterium centrifugation after inducing adds the resuspended bacterium of 20ml PBS, ultrasonication bacterium by every 400ml bacterium.The ultrasonic completely liquid of broken bacterium adds 50% saturated Triptide Sepharose4B of PBS by every milliliter of amount that adds 20 microlitres, 37 ℃ of joltings were in conjunction with 30 minutes, 10000rpm/min precipitated the Triptide Sepharose4B that combines GST-hRabl8 in centrifugal 10 minutes, abandoned supernatant.Clean twice by the amount that every milliliter of ultrasonic liquid gained precipitation adds 100 μ l PBS, then add 10 μ l reduced glutathione elutriants by every milliliter of ultrasonic liquid gained precipitation, room temperature was put 10 minutes, centrifugal 10 minutes of 10000rpm/min, and supernatant is the fusion rotein of wash-out.Repeat twice of wash-out.The supernatant of wash-out is stored in-80 ℃, and carries out the SDS-PAGE electrophoresis, detects purification effect.Band at about 22kDa place is hRab18 albumen.

Embodiment 6

HRab18 albumen or polypeptide carry out eukaryotic cell expression in insect cell

1.hRab18 the structure of rhabdovirus expression vector and transfection Sf 9 insect cell strain

According to the complete encoding sequence (SEQ ID NO.6) of people hRab18, design amplifies the primer that complete coding is read frame, and introduces restriction endonuclease sites (this is decided by the carrier of selecting for use) respectively on positive anti-primer, so that construction of expression vector.With the amplified production that obtains among the embodiment 1 is template, behind pcr amplification, with hRab18 cDNA under the prerequisite that guarantees reading frame, be cloned into the pVL1392 carrier (Invitrogen, Carlsbad, CA).Identify good expression vector 3 μ g, wild-type linearized baculovirus dna (BaculoGold ^TMACMNPV DNA, Pharmingen, San Diego, CA) 1 μ g and Lipofection (Gibco-BRL, NY) 25 μ l add in the insect substratum of 1ml serum-free, the 15 seconds mixings that vibrate, incubated at room 15 minutes is standby.Get 1ml (2 * 10 ⁶) Sf9 insect cell suspension is in 60mm tissue culturing plate, change transfection media after adherent 1 hour, incubated at room was abandoned substratum after 15 minutes, add the dna vector transfection mixture for preparing previously, Parafilm seals culture plate, cultivated 4 hours in 27 ℃ of joltings of room temperature, then change perfect medium and cultivated 3 days, it is standby to collect supernatant.

(2) change the Screening and Identification of the insect cell line of recombinant expression vector over to

The insect cell of transfection after 3 days made cell suspension (2 * 10 with fresh culture ⁶/ 1ml), get the 1ml cell suspension and place 60mm tissue culture ware, add the 3ml substratum, the culture supernatant that 100 μ l collect, adherent 1 hour, abandon the 2ml substratum, continue incubated at room temperature 1 hour, and discarded all substratum, add the 3ml semisolid medium that contains 20 μ l 4%X-gal of preheating, cultivate after 5-7 days picking white cell clone and in 96 well culture plates, cultivated 3-5 days, then draw supernatant infection Sf9 insect cell.

Collect the cell that infects and carry out the Western evaluation.The SDS-PAGE electrophoresis will be carried out after the lysis, glue behind the electrophoresis prints to protein transduction on the nitrocellulose membrane in the half-dried electrotransfer instrument of the Multiphor of Pharmacia II, nitrocellulose membrane is placed confining liquid sealing 1 hour, then in the antibody-solutions of anti-hRab18, sealed 1 hour, the jolting of TBS liquid is cleaned 5 minutes 2 times totally, then film is placed the anti-second antibody solution jolting of biotin labeled anti-hRab18 one 1 hour, TBS cleans, adding avidin-alkaline phosphatase enzyme complex reacted 30 minutes, TBS cleans 2 times, adds freshly prepared colour developing liquid colour developing and observes protein band.

The Sf9 cell clone of picking high expression level hRab18.

(3) the proteic extraction purifying of hRab18

Supernatant with the Sf9 cell clone of high expression level hRab18 infects the Sf9 cell in a large number, infects collecting cell after 48 hours, the PBS washing.Per 2 * 10 ⁸Cell adds 20ml cell pyrolysis liquid (0.5%Triton X-100,20mM Na ₃PO ₄(sodium phosphate, pH7.8), 500mM NaCl, 1mM Na ₃VO ₄(vanadic acid sodium), 1mMPefabloc, 1 μ g/ml pepstatin, leupeptin and aprotinin) broken cell, the centrifugal 20min of 12000 * g removes cell debris, and supernatant is by per 2 * 10 ⁸Cell add 2ml NTA-agarose (Qiagen, Germany), 4 ℃ of absorption 1 hour.Then with containing the His damping fluid washed twice of 100nM imidazoles, with containing 20mM N, N '-two piperazine, 500mM NaCl, the buffer solution elution of 300mM imidazoles is to obtain the albumen of purifying.Elutriant is stored in 4 ℃, and carries out the proteic purity of hRab18 that the SDS-PAGE electrophoresis detection is extracted.Band at about 22kDa place is hRab18 albumen.

Embodiment 7

The preparation of anti-people hRab18 antibody

1. the preparation of immune mouse and splenocyte: separate the people hRab18 recombinant protein molecule that obtains among the embodiment 5 and 6 back standby with chromatography, also can separate with the SDS-PAGE gel electrophoresis, electrophoretic band is cut off from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Get the female mouse of 6-8 week Balb/C in age, the albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days, with the same antigen of non-complete Freund ' s adjuvant emulsion to mouse with the dosage of 50-100 μ g/0.2ml again booster immunization once be used for after 3-5 days merging.Wherein, E Zheng chief editor, " tissue culture and molecular cell learn a skill ", Beijing Publishing House, the 210th page are seen in the splenocyte preparation.

2. by " tissue culture and molecular cell learn a skill " (the same), the method in the 211st page, preparation feeder cell.

3. by " tissue culture and molecular cell learn a skill " (the same), the method in the 213rd page is carried out cytogamy.

4. detection of antibodies: after cytogamy 10-15 days, need to check by the hole, in case find vigorous hybrid cell colony growth, just use hRab18 albumen and do the preliminary screening of antibody activity, method commonly used has: immunofluorescent test, emission immunity test (RIA), enzyme linked immunosorbent assay (ELISA).After checking out the hole of antibody activity, clone cultivation at once, and isolate antibody.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

(1) general information:

(ⅰ) applicant: Nanfang Research Centre, State Human Gene Group

(ⅱ) denomination of invention: a kind of new human membrane transfer protein and encoding sequence thereof

(ⅲ) sequence number: 7

(2) information of SEQ ID NO.1

(ⅰ) sequence signature:

(A) length: 50bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅸ) sequence description: SEQ ID NO.1GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTT 50

(2) information of SEQ ID NO.2

(ⅰ) sequence signature:

(A) length: 13bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅸ) sequence description: SEQ ID NO.2

AATTCGGCAC?GAG 13

(2) information of SEQ ID NO.3

(ⅰ) sequence signature:

(A) length: 9bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide (ⅸ) sequence description: the information of SEQ ID NO.3GCCGTGCTC 9 (2) SEQ ID NO.4

(ⅰ) sequence signature:

(A) length: 22bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide (ⅸ) sequence description: the information of SEQ ID NO.4TCAGGATGGACGAGGACGT 19 (2) SEQ ID NO.5

(ⅰ) sequence signature:

(A) length: 19bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide (ⅸ) sequence description: the information of SEQ ID NO.5GCAAGGTCCCTAAAATAGCAGT 22 (2) SEQ ID NO.6

(ⅰ) sequence signature:

(A) length: 716bp

(B) type: Nucleotide

(C) chain: two strands

( D ) ： ( ⅱ ) ： ( ⅸ ) ：SEQ ID NO.6 1 TCAGGATGGA CGAGGACGTG CTAACCACCC TGAAGATCCT CATCATCGGC 51 GAGAGTGGGG TGGGCAAGTC CAGCCTGCTC TTGAGGTTCA CAGATGATAC101 GTTTGATCCA GAACTTGCAG CAACAATAGG TGTTGACTTT AAGGTGAAAA151 CAATTTCAGT GGATGGAAAT AAGGCTAAAC TTGCAATATG GGATACTGCT201 GGTCAAGAGA GGTTTAGAAC ATTAACTCCC AGCTATTATA GAGGTGCACA251 GGGTGTTATA TTAGTTTATG ATGTCACAAG AAGAGATACA TTTGTTAAAC301 TGGATAATTG GTTAAATGAA TTGGAAACAT ACTGTACAAG AAATGACATA351 GTAAACATGC TAGTTGGAAA TAAAATCGAT AAGGAAAATC GTGAAGTCGA401 TAGAAATGAA GGCCTGAAAT TTGCACGAAA GCATTCCATG TTATTTATAG451 AGGCAAGTGC AAAAACCTGT GATGGTGTAC AATGTGCCTT TGAAGAACTT501 GTTGAAAAGA TCATTCAGAC CCCTGGACTG TGGGAAAGTG AGAACCAGAA551 TAAAGGAGTC AAACTGTCAC ACAGGGAAGA AGGCCAAGGA GGAGGAGCCT601 GTGGTGGTTA TTGCTCTGTG TTATAAACTC TGGGAAATTC CATCTCTTGC651 ATATTTGATC AGATAGTGAC ATCTTTCTGT ATATAAACTC TTTAACTGCT701 ATTTTAGGGA CCTTGC ( 2 ) SEQ ID NO.7

(ⅰ) sequence signature:

(A) length: 206 amino acid

(B) type: amino acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: polypeptide

(ⅸ) sequence description: SEQ ID NO.7 1 MDEDVLTTLK ILIIGESGVG KSSLLLRFTD DTFDPELAAT IGVDFKVKTI 51 SVDGNKAKLA IWDTAGQERF RTLTPSYYRG AQGVILVYDV TRRDTFVKLD101 NWLNELETYC TRNDIVNMLV GNKIDKENRE VDRNEGLKFA RKHSMLFIEA151 SAKTCDGVQC AFEELVEKII QTPGLWESEN QNKGVKLSHR EEGQGGGACG201 GYCSVL

Claims (10)

1. isolated dna molecular is characterized in that it comprises: coding has the nucleotide sequence of the polypeptide of people hRab18 protein active,

And, show at least 70% homology from the nucleotides sequence of Nucleotide 6-623 position dna molecular among described nucleotide sequence and the SEQ ID NO.6; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.6 in from the nucleotide sequence hybridization of Nucleotide 6-623 position.

2. dna molecular as claimed in claim 1 is characterized in that described sequence encoding has polypeptide of sequence shown in the SEQ IDNO.7.

3. dna molecular as claimed in claim 1 is characterized in that, this sequence has among the SEQ ID NO.6 nucleotide sequence from Nucleotide 6-623 position.

4. isolated people hRab18 protein polypeptide is characterized in that it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.7 aminoacid sequence, or its reactive derivative.

5. polypeptide as claimed in claim 4 is characterized in that, this polypeptide is to have SEQ ID NO.7 polypeptide of sequence.

6. a carrier is characterized in that, it comprises the described DNA of claim 1.

7. one kind with the described carrier transformed host cells of claim 6.

8. a generation has the method for the polypeptide of people hRab18 protein active, it is characterized in that this method comprises:

(1) nucleotide sequence that coding is had a polypeptide of people hRab18 protein-active operationally is connected in expression regulation sequence, form people hRab18 protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 6-623 position among described nucleotide sequence and the SEQ ID NO.6;

(2) expression vector in the step (1) is changeed the human host cell, form the proteic reconstitution cell of people hRab18;

(3) under the condition that is fit to expressing human hRab18 protein polypeptide, the reconstitution cell in the culturing step (2);

(4) isolate polypeptide with people hRab18 protein-active.

9. energy and the described people hRab18 of claim 7 protein polypeptide specificity bonded antibody.

10. a probe molecule is characterized in that, it comprises 8-100 continuous nucleotide in the described dna molecular of claim 1.

Images