CN1302899A - Human protein tyrosine phosphatase and its coding sequence - Google Patents

Abstract

The present invention discloses a novel human protein tyrosine phosphatase hPTP expressed in human normal suprarenal tissue and its coding sequence, the process for preparing said protein and nucleic acid sequence, and the method for detecting hPTP nucleic acid sequence and polypeptide from specimen.

Description

Human Protein-Tyrosine Phosphatase and encoding sequence thereof

The present invention relates to cytology, molecular endocrinology, neurobiology, immunology and genetically engineered field.Particularly, the present invention relates to a kind of in human suprarenal gland expressed proteins tyrosine phosphatase (Protein-Tyrosine Phosphatase abbreviates " PTP " as) and nucleotide sequence thereof.The invention still further relates to the preparation method and the purposes of this albumen and nucleotide sequence.

PTP albumen is the proteolytic enzyme of the protein-tyrosine residue dephosphorylation reaction of extensive existence, catalysis phosphorylation in the organism.The phosphorylation that has confirmed protein-tyrosine is the important component part of many basic physiological process adjustments.Many hormones and somatomedin with receptors bind after all be by regulation protein tyrosine phosphorylation kinases realize they function (Cell 199161,203-212).Under physiological condition, the phosphorylation of protein-tyrosine is dynamic and reversible, and the phosphorylation level of tyrosine is the result of protein tyrosine phosphatase kinases and the Protein Tyrosine Phosphatases effect of vying each other.Therefore, Protein Tyrosine Phosphatases is the same with the protein tyrosine phosphatase kinases in the physiological process of somatomedin and the conduction of cytokine mediated signal, have important function (Blood 1994 Dec.15 Vol.84,4186-4194).Some PTP is directly with the tyrosine dephosphorylation of growth factor receptors phosphorylation, some PTP as the adjusting of stream signal to the downstream physiological process, also has some PTP as negative-feedback signal (Cell Signal 1996 Jan in the somatomedin regulation and control as second messenger's mediating growth factor; 8 (1): 13-9).

Numerous PTP has identical katalysis mechanism, can be divided into two steps.The first step is the fracture of phosphorus oxygen key in the phosphorylated tyrosine and the formation of intermediate product.A catalytic activity site of this step is the halfcystine with nucleophilicity sulphur atom.This nucleophilicity derives from the hydrogen atom that the main chain amido group of closing on and the Serine (as the Ser222 among the PTP1B) on the PTP specificity motif are provided.Another catalytic site is aspartic acid (as the Asp181 among the PTP1B), and it provides proton for catalyzed reaction.The intermediate product that generates is the phosphorylation halfcystine.Second step was the hydrolysis of phosphorylation halfcystine.This step reaction is provided the water of a part by a glutamine (as the Gln262 among the PTP1B).This reaction mechanism is identical with most of GTP enzymes.In reaction, also relate to a distinctive ring texture of PTP albumen (WPD loop) (as the amino acid/11 79-187 among the PTP1B).This ring texture has the change of a conformation in reaction process, fixedly phosphorylated tyrosine and help aspartic acid to provide proton (Annu Rev Biophys Biomol Struct 1998 27:133-164) for reaction.

Existing studies show that, PTP participates in following physiological function: conduction (JCell Physiol 1999 Aug that participate in regulating the mitotic division signal; 180 (2): 173-81), the process of cell cycle plays an important role; Participate in regulating megalokaryocyte and generate (megakaryocytopoiesis) and thrombocyte generation (Methods 1999 Mar; 17 (3): 250-64); Help I type molecules in inhibiting acceptor to realize closing natural killer cell (natural killer cell) the active function of congenital immunity, thereby realize histocompatibility (Curr Biol 1996 Sep 1; 6 (9): 1070-2); Participate in some important steps (Immunol Today 1996 Aug in modulating T cell growth and the signal conductive process; 17 (8): 385-91), be necessary (the Recent Prog Horm Res1996 of T cell amplification reaction institute of antigen mediation as CD45; 5l:405-14; Discussion 415); In the signal conductive process of somatomedin mediation, participate in forward and reverse regulation and control, overexpression or all relevant (the Cell Signal 1996Jan of disappearance with the vicious transformation of cell; 8 (1): 13-9); SHP-1 (src-homology protein 1) tyrosine phosphatase transforms relevant (Curr Top Microbiol Immunol 1999 with conduction of bone-marrow-derived lymphocyte antigen receptor signal and B cell amplification; 246:291-7; Discussion 298).

Because Protein-tyrosine-phosphatase is unusual relevant with some diseases, therefore, to research and develop Human Protein-Tyrosine Phosphatase significant for therapeutic purpose.

First purpose of the present invention just provides a kind of new people's gene hPTP (Genbank AccessionNo.AF150732), and this gene is a Protein-tyrosine-phosphatase gene.

Second purpose of the present invention provides a kind of new people's albumen, i.e. Human Protein-Tyrosine Phosphatase (abbreviating " hPTP " as).

The 3rd purpose of the present invention provides a kind of recombinant technology that utilizes and produces the above-mentioned new Human Protein-Tyrosine Phosphatase and the method for nucleotide sequence.

The present invention also provides the application of this Protein-tyrosine-phosphatase polypeptide and encoding sequence.

In one aspect of the invention, a kind of isolated dna molecular is provided, this molecule comprises: coding has the nucleotide sequence of the polypeptide of people hPTP protein active, shows at least 70% homology from the nucleotides sequence of Nucleotide 10-2406 position dna molecular among described nucleotide sequence and the SEQ ID NO.6; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.6 in from the nucleotide sequence hybridization of Nucleotide 10-2406 position.Preferably, described sequence encoding has the polypeptide of the aminoacid sequence shown in the SEQ ID NO.7.More preferably, described sequence has among the SEQ ID NO.6 nucleotide sequence from Nucleotide 10-2406 position.

In another aspect of this invention, provide a kind of isolated people hPTP protein and peptide, it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.7 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO.7 polypeptide of sequence.

In another aspect of this invention, also provide a kind of carrier, it comprises above-mentioned dna molecular.

In another aspect of this invention, also provide a kind of usefulness above-mentioned carrier transformed host cells.This host cell is intestinal bacteria in an example; In another example, this host cell is an eukaryotic cell.

In another aspect of this invention, also provide a kind of generation to have the method for the polypeptide of people hPTP protein active, this method comprises:

(1) nucleotide sequence that coding is had a polypeptide of people hPTP protein-active operationally is connected in expression regulation sequence, form people hPTP protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 10-2406 position among described nucleotide sequence and the SEQ ID NO.6;

(2) change the expression vector in the step (1) over to host cell, form the proteic reconstitution cell of people hPTP;

(3) under the condition that is fit to expressing human hPTP protein polypeptide, the reconstitution cell in the culturing step (2);

(4) isolate polypeptide with people hPTP protein-active.

Preferably, the nucleotide sequence that uses in the method has the sequence of 10-2406 position among the SEQ ID NO.6.

The present invention also provides and hPTP protein polypeptide specificity bonded antibody.

In the present invention, " isolating ", " purifying " or " pure substantially " DNA are meant, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.

In the present invention, term " people hPTP albumen (or polypeptide) encoding sequence " refer to the encode nucleotide sequence of polypeptide with natural human hPTP protein-active is as 10-2406 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.6.This degenerate sequence is meant, is arranged in the encoder block 10-2406 position Nucleotide of SEQ ID NO.6 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.6 in 10-2406 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.7 of also encoding out.This term also comprises can be under the moderate stringent condition, better under the height stringent condition with SEQ ID NO.6 in from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 10-2406 position.This term also comprise with SEQ ID NO.6 in from the homology of nucleotide sequence at least 70% of Nucleotide 10-2406 position, preferably at least 80%, more preferably at least 90%, at least 95% nucleotide sequence best.

This term also comprises encoding to have the variant form of open reading frame sequence among proteic, the SEQ ID NO.6 with people hPTP identical function.These variant forms comprise (but being not limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 60 to hold interpolation 5 ' and/or 3 ', preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.

In the present invention, " pure substantially " protein or polypeptide are meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as measure the purity of polypeptide with column chromatography, PAGE or HPLC method.Substantially pure polypeptide is substantially free of the component of following it under the native state.

In the present invention, term " people hPTP albumen or polypeptide " refers to have the SEQID NO.7 polypeptide of sequence of natural hPTP protein-active.This term also comprises having and variant form people hPTP identical function, SEQ ID NO.7 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of hPTP and reactive derivative.

The variant form of inventor hPTP polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low stringent condition can with the coded albumen of the DNA of people hPTP DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people hPTP polypeptide to obtain.The present invention also provides other polypeptide, as comprises people hPTP polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention also comprises the soluble fragments of people hPTP polypeptide.Usually, this fragment have people hPTP peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.

In the present invention, " hPTP conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO.7, has 10 at the most, and preferably at the most 8, more preferably 5 amino acid is replaced by similar performance or close amino acid and formed polypeptide at the most.These conservative property variation polypeptide are preferably replaced according to table 1 and are produced.

Table 1

Initial residue	Representational replacement	The preferred replacement
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Lys；Arg	Gln
Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro；Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe	Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	Leu
			Pro(P)	Ala	Ala

Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser
Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	Phe
Val(V)	Ile；Leu；Met；Phe；Ala	Leu

Invention also comprises the analogue of people hPTP albumen or polypeptide.The difference of these analogues and natural human hPTP polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.

(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.

In the present invention, can select various carrier known in the art for use, the carrier as commercially available comprises plasmid, clay etc.When producing people hPTP polypeptide of the present invention, the hPTP encoding sequence operationally can be connected in expression regulation sequence, thereby form people hPTP protein expression vector.

As used herein, " operationally being connected in " refers to a kind of like this situation, and promptly some part of linear DNA sequence can influence the activity of same other parts of linear DNA sequence.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA operationally is connected in polypeptid DNA so; If transcribing of promotor control sequence, it is operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally, " operationally being connected in " means adjacent, then means in reading frame adjacent for the secretion leader sequence.

In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is an eukaryotic cell, as Chinese hamster ovary celI, COS cell etc.

The present invention also provides the antibody special to people hPTP, comprises polyclonal antibody and monoclonal antibody.

In the present invention, can use a series of methods known in the art to prepare special antibody at hPTP.For example, the people hPTP gene product or its antigen fragment of purifying are injected in people's animal body to produce polyclonal antibody.Equally, the cell of expressing human hPTP or its antigen fragment also can be used for animal is caused immunity and produces antibody.Antibody prepared in accordance with the present invention also can be monoclonal antibody, and these monoclonal antibodies can prepare (for example, Kohler et al., Nature 256:495,1975 with hybridoma technology; Kohler et aI., Eur.J.Immunol.6:511,1976; Kohler et al., Eur.J.Immunol.6:292,1976).Antibody of the present invention comprises the antibody that can prevent the hPTP function, also can be the antibody that does not influence people hPTP function.Each antibody-like can produce by the fragment of people hPTP gene product or functional domain are caused immunity, and people hPTP gene product and fragment thereof can produce or synthesize with Peptide synthesizer with recombination method.With the hPTP gene product bonded antibody of non-modified forms, can come immune animal to obtain by being used in the gene product that prokaryotic cell prokaryocyte for example produces among the E.coli.With posttranslational modification form such as glycosylation or phosphorylated protein or polypeptide bonded antibody, can obtain by the immune animal that comes that is used in the gene product that produces in eukaryotic cell such as yeast or the insect cell.

People hPTP antibody of the present invention can be used for identifying the cell of expressing human hPTP albumen or polypeptide, as Jurkat T cell.For example, can with a kind of detectable molecule for example fluorescein isothiocyanic acid (FITC) come mark hPTP specific antibody, allow people hPTP specific antibody contact then, detect and hPTP specific antibody bonded cell with fluorescent microscope or flow cytometer again with cell sample.

Except cell surface detects people hPTP, can also analyze this protein with the Western engram technology.Cell pyrolysis liquid can from culturing cell or take from patient's tissue sample such as suprarenal gland extract, and be dissolved in the lysis buffer that contains stain remover.Use sds polyacrylamide gel electrophoresis isolated cell extract (simultaneously with the people hPTP polypeptide of purifying as positive control) then, then it is transferred on the nitrocellulose by electrophoresis hybridization.In order to survey the hPTP polypeptide, can use typical antibodies detection method, for example radioautograph or alkaline phosphatase enzyme assay method with the immunity of Western trace.And can use the contrast of immunization serum or incoherent monoclonal antibody as non-specific responding.

Whether and quantity the expression of also available Nothern blotting technical Analysis hPTP gene product, the i.e. existence of rna transcription thing in cell of analyst hPTP.

The Western engram analysis of the Nothern engram analysis of people hPTP DNA and people hPTP specific antibody can be united use, with the expression of confirmer hPTP in biological specimen.People hPTP DNA can also be used for Southern engram analysis or in situ hybridization analysis, with this assignment of genes gene mapping on karyomit(e), and can carry out genetic linkage analysis to find out other possible disease related gene.

In addition, the present invention also provides a kind of nucleic acid molecule that can be used as probe, and this molecule has 8-1000 of hPTP nucleotide coding sequence, preferably 15-500 continuous nucleotide usually.This probe can be used for whether existing in the test sample nucleic acid molecule of the hPTP that encodes.

The present invention also provides the method that whether has the hPTP nucleotide sequence in the test sample, and it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer is corresponding to the hPTP nucleotide coding sequence, and can be positioned at the both sides or the centre of this encoding sequence.Primer length is generally 15-50 Nucleotide.

In addition, according to hPTP nucleotide sequence of the present invention and aminoacid sequence, can be on the homology basis of nucleic acid homology or marking protein, screening hPTP homologous gene or homologous protein.

In order to obtain and the people cDNAs of hPTP gene-correlation or the dot matrix of genomic dna s, can screen people cDNA or genome dna library with dna probe, these probes are under low stringent condition, use ³²P hPTP all or part of cooked the radioactivity mark and.The cDNA library that most is suitable for screening is the library from the human adrenal gland tissue.Also can be used for screening purpose from the cDNA library that participates in endocrine other tissue or specific human body cell strain.Structure is that biology field is well-known from the method in the cDNA library of interested cell or tissue.In addition, many such cDNA libraries also can buy, for example available from Clontech, and Palo Alto, Cal..This screening method can be discerned the nucleotide sequence of the gene family relevant with hPTP.

Can finish as follows according to Nucleotide similarity screening hPTP homologue.Human acth cDNA library, for example (Clontech, Palo Alto Cal.) can use one section all or part of random primer dna probe screening that comprises the hPTP gene order to Clontech Cat.#7430-1.Finish having clone's the evaluation of the DNA insertion sequence of 70% homology at least with the hPTP sequence, can use hybridization temperature is 55 ℃ hybridization solution, uses 0.5 * SSC and 0.1%SDS to clean then.Shi Bie clone's DNA insertion sequence can be further estimated the similarity of it and hPTP gene with DNA restriction endonuclease analysis and dna sequencing in this way.The distribution of tissue expression can be with above-mentioned Northern blotting technical Analysis.

The hPTP homologue also can be used at the antibody of hPTP albumen or polypeptide and discern.For example, can be with the method for standard to commercial or make up with currently known methods, from cell or organize for example adrenal expression library to screen.With the library plate of falling people, on colony lift to a nitrocellulose membrane, the recombinant protein of expression is attached on the film.Just can carry out typical antibodies and detection then with specific people hPTP antibody.Identify the DNA insertion sequence among the clone in this way, can be further analyze to estimate the similarity of it and hPTP gene with DNA restriction endonuclease analysis and dna sequencing.The tissue expression of the gene of new identification distributes and can similarly analyze as stated above.

People hPTP Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.

In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally with its human cloning carrier, changes cell over to again, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.

In addition, also the method for available artificial chemosynthesis is synthesized relevant sequence.Before the application, prior art fully can be by first synthetic a plurality of polynucleotide small segments, and then connect and obtain the proteic nucleotide sequence of code book contriver hPTP.Then, can be with in various existing dna moleculars (as carrier) and the cell in this nucleotide sequence introducing this area.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.

The proteic fragment of the present invention is except available recombination method produces, and also available solid phase technique is produced (people such as Stewart, (1969) Solid-Phase Peptide Synthesis, WH Freeman Co., San Francisco by direct peptide synthesis; Merrifield J. (1963) J.Am Chem.Soc 85:2149-2154).Can carry out by hand or automatically at external synthetic protein.For example, can (Foster City CA) synthesizes peptide automatically with the 431A type peptide synthesizer of Applied Biosystems.Can distinguish proteic each fragment of chemosynthesis the present invention, be connected to produce the molecule of total length with chemical process then.

The proteic encoding sequence of the present invention can be used for the assignment of genes gene mapping.For example,, the cDNA clone is hybridized with the karyomit(e) of metaphase, can carry out chromosomal localization exactly by fluorescence in situ hybridization technique (FISH).This technology can be used the cDNA that is as short as about 500bp; Also can use and grow to about 2000bp or longer cDNA.For this technology, can be referring to people such as Verma, Human Chromosomes:A Manual ofBasic Techniques, Pergamon Press, New York (1988).

In case sequence is located in certain exact position on the karyomit(e), the physical location of sequence on karyomit(e) can be associated with the genetic map data.These genetic map data can obtain, for example by Mendelian (Mendelian) people genetic database (can obtain on the net by Johns Hopkins University Welch MedicalLibrary).Then, come identified gene by linkage analysis and be positioned dependency between the disease of same chromosomal region.

Then, be necessary to determine the cDNA between diseased individuals and the healthy individual or the difference of genome sequence aspect.Be not present in normal individual if a certain sudden change is present in part or all of diseased individuals, this sudden change may be exactly the paathogenic factor of this disease so.

Utilize people hPTP albumen of the present invention,, can filter out with people hPTP interactional material takes place, as acceptor, inhibitor or antagonist etc. by various conventional screening methods.

Inventor hPTP albumen and antibody thereof, inhibitor, antagonist or acceptor etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, subcutaneous, intracutaneous or topical.

With people hPTP albumen of the present invention is example, can be with itself and suitable pharmaceutically acceptable carrier coupling.This class pharmaceutical composition contains protein and the pharmaceutically acceptable carrier or the vehicle for the treatment of significant quantity.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.People hPTP albumen of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.

When people hPTP protein polypeptide of the present invention is used as medicine, this polypeptide of treatment effective dose can be applied to Mammals, wherein should treat effective dose usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.

Find by the homology retrieval, new gene of the present invention has with having delivered and be identified and is people PTP homologous protein (PTP homolog, abbreviate " PTPh " as) gene and mouse (Mus musculus) PTP gene height homologous sequence, and new albumen of the present invention has the aminoacid sequence of mouse PTP albumen and people PTPh high conservative.So hPTP of the present invention is a kind of new human protein tyrosine phosphatase, it is the homology base of mouse PTP gene and has similar function.

Fig. 1 is that the homology of people hPTP of the present invention and people PTPh gene nucleic acid sequence (GenBank Accession No.AF077031) compares (FASTA) figure.Wherein, identical Nucleotide marks with " Shu ".

Fig. 2 is people hPTP albumen of the present invention and people PTPh aminoacid sequence (SwissProt ACCESSIONAAD27764), and house mouse (Mus musculus) PTP Argine Monohydrochloride sequence (SwissProt ACCESSIONp29352) homology is (PILEUP) figure relatively.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1

The clone of hPTP gene

1. separate tissue (Tissue isolation)

Suprarenal gland derives from 5 normal adult male sex donors, takes out adrenal tissue in after death four hours, places the freezing preservation of liquid nitrogen immediately.

2.mRNA separation (mRNA isolation)

Take out tissue, grind, add the 50ml pipe that fills lysate, fully after the vibration, move in the glass homogenizer again with mortar.Move to 50ml after the homogenate and newly manage, and extracted total RNA (TRIzol Reagents, Gibco, NY, USA).Identify total RNA quality with the denaturing formaldehyde gel electrophoresis.Cellulose column with band Oligo d (T) separates mRNA among total RNA, quantitatively.

3.cDNA the structure in library (Construction of cDNA library)

With mRNA is template, and synthetic double chain cDNA, reverse transcription primer are seen SEQ ID NO.1.After mending flat end, add the joint that contains the EcoRI point of contact, joint sequence is seen SEQ ID NO.2 and 3 respectively.Behind the phosphorylation EcoR I end, use Xho I digestion with restriction enzyme 1.5 hours, carry out fragment again and separate.Cross the fragment of post screening length＞500bp, use the phenol-chloroform extracting, ethanol sedimentation, the sterilized water dissolving, be connected to Uni-ZAP XR carrier (Stratagene, CA9203, USA), with Zap-cDNA Gigapack III Gold Cloning Kit (Stratagene, CA9203 USA) packs, and the host bacterium is used XL 1-Blue MRF ' (Stratagene, CA9203, USA) bacterium.Coated plate is also measured titre.

4. order-checking and database are set up (Seqencing and Database Constructing)

Select the clone who has the external source fragment to insert in the library, amplification back extracting plasmid (Qiagen, Germany), with T3 and T7 universal primer as 3 ' end and 5 ' hold, adopt thing fluorescent mark (Big-Dye, Perkin-Elmer, method USA) of stopping, (Perkin-Elmer carries out the EST large scale sequencing on USA) at the ABI377 sequenator.Sequencing result is removed the carrier sequence with FACTURA software, is transferred to the processing of carrying out next step on SUN Ultra 450 Server.All sequence informations are used the GCG software package again, and (Wisconsin group, USA) BLAST in and the existing database of FASTA software search (Genebank+EMBL) are lower than 95% sequence with no homology or homology and are considered as new gene and set up database.

5. the full-length clone of gene (Cloning of Full-length cDNA)

On the new gene fragment order information basis that obtains, carry out the cDNA full-length clone, carry out in two stages:

(1) " electronic cloning " (Electronic Cloning)

Search the dbEST database with new gene fragment order as probe, with overlap＞50bp, homology is at (the Expressed Sequence Tag of the expressed sequence tag more than 98%, being called for short " EST ") sequence thinks same sequence (consensus sequence), take out and splice with AUTOASSEMBLER software, part EST can the extension probes sequence.Whether the sequence that is extended with the STRIDER software analysis has complete open reading frame (Open Reading Frame again, ORF), on Nucleotide and amino acid levels, whether homology is arranged with definite this sequence with BLAST search Genbank or SwissProt, to help how differentiate resulting full length gene integrity with other species.By the method for electronic cloning, can obtain the full length sequence of hPTP gene usually.

(2) the terminal rapid amplifying of cDNA (Rapid Amplification of cDNA Ends, RACE)

If do not obtain complete cDNA total length yet by " electronic cloning " method, then at 5 of existing sequence ' or 3 ' end design primer, (Clontech Lab, Inc carry out the long range PCR reaction in USA) in the mankind-Marathon-Ready cDNA library.Then to PCR product cloning, order-checking.The sequence that is extended with AUTOASSEMBLER and STRIDER software analysis has or not complete ORF, as not having, repeats said process until obtaining total length.

(3)RT-PCR

For 5 ' and 3 ' end known sequences, if the centre still has an intersegmental crack (gap) to obtain from existing public database or its data storehouse, can consider to adopt the method for RT-PCR.At sequence 5 ' end design primer, 3 ' end primer adopts Oligo-dT, increases in the total RNA of suprarenal gland storehouse.Then product is cloned, checked order.Splice at last and obtain total length.

By being used in combination above-mentioned 3 kinds of methods, obtained candidate's the proteic complete encoding sequence of people hPTP.Obtain on the total length basis of (comprising complete open reading frame) in splicing, further R1:5 '-TATGGCGGCTCAGAAAGATCTC-3 ' (SEQ ID NO.4) is a forward primer to the design primer, primer R2:5 '-ACCCATCTCAAACGTCCTTGC-3 ' (SEQ ID NO.5) is a reverse primer, total RNA with adrenal tissue is a template, carry out the RT-PCR amplification, the PCR condition of R1/R2 be 94 ℃ 5 minutes, carried out 35 circulations in 1 minute with 94 ℃ 30 seconds, 60 ℃ 30 seconds and 72 ℃ thereupon, extended 5 minutes with 72 ℃ at last.The electrophoresis detection pcr amplification product, the acquisition expanding fragment length is 2452bp.Clone, check order with pcr amplification product according to a conventional method then, obtain the sequence shown in the SEQ ID NO.6.

Embodiment 2

The sequence information of hPTP gene and homology analysis:

People hPTP full-length cDNA (the GenBank Accession No.AF150732 that the present invention is new.Because of applying for maintaining secrecy, so open before the application to the public) length be 2452bp, detailed sequence is seen SEQ ID NO.6, wherein open reading frame is positioned at 10-2406 position Nucleotide.Derive the aminoacid sequence of hPTP according to full-length cDNA, totally 799 amino-acid residues, molecular weight 90610.53, pI are 6.63.Detailed sequence is seen SEQ ID NO.7.

Full length cDNA sequence and coded protein thereof with hPTP, in Non-redundantGenBank+EMBL+DDBJ+PDB and Non-redundant GenBank CDS translations+PDB+SwissProt+Superdate+PIR database, carry out Nucleotide and protein homology retrieval with blast program, found that there are certain homology in it and Protein-tyrosine-phosphatase gene.On nucleotide level, the 64-1315 bit base of the mRNA whole coding sequence (GenBank Accession No.AF077031) of it and people PTPh gene has 96.7% homogeny (Fig. 1).On amino acid levels, the 1-799 amino acids residue of it and people hPTP homologous protein (SwissProtAccession No.AAD27764) has 89.2% homogeny, with house mouse (Mus musculus) PTP Argine Monohydrochloride sequence (SwissProt ACCESSION p29352) 64.7% homogeny (Fig. 2) is arranged also.Therefore hPTP genes encoding of the present invention is a kind of Human Protein-Tyrosine Phosphatase, and there are higher homology in albumen of the present invention and known protein tyrosine phosphatase on protein level, so both also have very high similarity on function.

People hPTP of the present invention is used for further functional study except can be used as this family's a member, also can be used for producing fusion rotein with other albumen, such as producing fusion rotein with immunoglobulin (Ig).In addition, inventor hPTP can also merge with other members of this family or exchange fragment, to produce new albumen.For example proteic N end of inventor hPTP and the proteic N end of mouse PTP are exchanged, to produce the albumen that new activity is higher or have new features.

At the antibody of inventor hPTP, be used to screen other members of this family, perhaps be used for affinity purification associated protein (as other members of this family).

In addition, inventor hPTP nucleic acid (encoding sequence or antisense sequences) can be introduced into cell, with expression level that improves people hPTP or the overexpression that suppresses people hPTP.People hPTP albumen of the present invention or its active polypeptide fragment can be applied to patient, with treatment or alleviate because of people hPTP disappearance, no function or unusual cause related disorders arranged.In addition, can also be with carrying out relevant diagnosis or prognosis judgement based on nucleotide sequence of the present invention or antibody.

Because people hPTP albumen of the present invention has the natural acid sequence that is derived from the people, therefore, compare with the albumen of the same clan that derives from other species (as mouse (Mus musculus)), estimate to have higher active and/or lower side effect (for example in the intravital immunogenicity of people lower or do not have) being applied to man-hour.

Embodiment 3

The proteic 26S Proteasome Structure and Function research of hPTP

1. three the amino acid AHL of C-terminal with the proteic aminoacid sequence of hPTP are Mammals peroxysome signal sequence 1 (peroxisomal targeting signal 1), this is the characteristic signal sequence of mammalian proteins passer peroxysome, this has confirmed in this place, enzyme applied field peroxysome (J.Cell Biol.1989 108,1657-64).

2．hPTPmotif ( ：http://www.motif.genome.ad.jp ) ,： 1 MDQREILQKF LDEAQSKKIT KEEFANEFLK LKRQSTKYKA DKTYPTTVAE 51 KPKNIKKNRY KDILPYDYSR VELSLITSDE DSSYINANFI KGVYGPEAYI101 ATQGPLSTTL LDFWRMIWEY SVLIIVMACM EYEMGKKKCE RYWAEPGEMQ151 LEFGPFSVSC EAEKRKSDYI IRTLKVKFNS ETRTIYQFHY KNWPDHDVPS201 SIDPILELIW DVRCTQEDDS VPICIHCSAG CGRTGVISAI DYTWMLLKDG251 IIPENFSVFS LIREMRTQRP SLVQTQEQYE LVYNAVLELF KRQMDVIRDK301 HSGTESQAKH CIPEKNHTLQ ADSYSPNLPK STTKAAKMMN QQRTKMEIKE351 SSSFDFRTSE ISAKEDVSLA PENQAFFCLS EVNSSFAKML PHHEMPAKAF401 QIVGSSSEAS KLNWASLCLG MSNSNLVCSR KIFNPRCQYP DQINSFELIQ451 QENQGGDSKK TFLFESQPHD SCFVEMQAQK VMHVSSAELN YSLPYDSKHQ501 IRNASNVKHH DSSALGVYSY IPLVENPYFS SWPPSGTSSK MSLDLPEKQD551 GTVFPSSLLP TSSTSLFSYY NSHDSLSLNS PTNISSRIEQ ESAVLATAPR601 IDDEIPLHFL YGTPESFIVV EEAGEFSPNV PKSLSSAVKV KIGTSLEWGG651 TSEPKKFDDS VILRPSKSVK LRSPKSELHQ DRSSPPPPLP ERTLESIFLA701 DEDCMQAQSI ETYSTSYPDT MENSTSSKQT LKTPGKSFTR SKSLKILRNM751 KKSICNSCPP NKPAESVQSN NSSSFLNFGF ANRFSKPKGP RNPPPTWNI

(1) underscore district (17-19 36-38 182-184 282-284 350-352 383-385453-455 485-487 568-570 618-620 707-709 712-714 768-770 772-774 785-787) is protein kinase phosphorylation site (Protein kinase C phosphorylation site) in aminoacid sequence

(2) runic district (18-21 33-36 173-176) is the protein kinase phosphorylation site (cAMP-and cGMP-dependent protein kinasephosphorylation site) of cyclisation VITAMIN B4 and guanylic acid dependence in aminoacid sequence

(3) in aminoacid sequence, with the lower area casein kinase II phosphorylation site (Casein kinase II phosphorylation site): 21-24 48-51 72-75 80-83 81-84 115-118 227-230 320-323362-365 373-376 383-386 429-432 512-515 619-622 680-683 758-761

(4) italic district (38-45 62-69) is Tyrosylprotein kinase phosphorylation site (Tyrosinekinase phosphorylation site) in aminoacid sequence.

(5) bold Italic district (237-249) is tyrosine-specific protein phosphatase avtive spot (Tyrosine specific protein phosphatases active site) in aminoacid sequence.

In hPTP of the present invention, these phosphorylation sites of (1)-(4) participate in the active adjusting for hPTP, coordinate the realization of its physiological function; (5) be the tyrosine-specific protein phosphatase avtive spot, these confirm that the present invention has the proteic catalytic activity of PTP, thereby also have the important physical function that PTP albumen is had.

3. (network address is: http://blocks.fhcrc.org/blocks/blocks_serach.html) carry out structural analysis and obtain following result: 1 MDQREILQKF LDEAQSKKIT KEE in the website FANEFLK LKRQSTKYKA DKTYPTTVAE51 KPKNIKKNRY KDILPYDYSR VELSLITSDE DSSYINANFI KGVYGPEAYI101 ATQGPLSTTL LDFWRMIWEY SVLIIVMACM EYEMGKKKCE RYWAEPGEMQ151 LEFGPFSVSC EAEKRKSDYI IRTLKVKFNS ETRTIYQFHY KNWPDHDVPS201 SIDPILELIW DVRCTQEDDS VPICIHCSAG CGRTGVICAI DYTWMLLKDG251 IIPENFSVFS LIREMRTQRP SLVQTQEQYE LVYNAVLELF KRQMDVIRDK301 HSGTESQAKH CIPEKNHTLQ ADSYSPNLPK STTKAAKMMN QQRTKMEIKE351 SSSFDFRTSE ISAKEDVSLA PENQAFFCLS EVNSSFAKML PHHEMPAKAF401 QIVGSSSEAS KLNWASLCLG MSNSNLVCSR KIFNPRCQYP DQINSFELIQ451 QENQGGDSKK TFLFESQPHD SCFVEMQAQK VMHVSSAELN YSLPYDSKHQ501 IRNASNVKHH DSSALGVYSY IPLVENPYFS SWPPSGTSSK MSLDLPEKQD551 GTVFPSSLLP TSSTSLFSYY NSHDSLSLNS PTNISSRIEQ ESAVLATAPR601 IDDEIPLHFL YGTPESFIVV EEAGEFSPNV PKSLSSAVKV KIGTSLEWGG651 TSEPKKFDDS VILRPSKSVK LRSPKSELHQ DRSSPPPPLP ERTLESIFLA701 DEDCMQAQSI ETYSTSYPDT MENSTSSKQT LKTPGKSFTR SKSLKILRNM751 KKSICNSCPP NKPAESVQSN NSSSFLNFGF ANRFSKPKGP RNPPPTWNI

In hPTP sequence of the present invention, there is following Protein-tyrosine-phosphatase its specific structure:

The runic district (203-280) of I in aminoacid sequence is the peculiar structure of the special protein phosphatase of tyrosine;

The underscore district (24-289) of II in aminoacid sequence is the peculiar structure of PTP proteinoid Starch phosphorylase.

Above presentation of results, hPTP have the active structure of protein tyrosine phosphatase enzyme, thereby have catalytic activity and its physiological function of protein tyrosine phosphatase enzyme.

In sum, further confirmed the similarity of hPTP of the present invention and mouse PTP from the proteic structure of hPTP and physicochemical property.Because protein structure has determined the specific biochemical theory of function, therefore people hPTP of the present invention has or identical functions similar to mouse PTP.

Embodiment 4

The distribution expression pattern of hPTP gene

1. electronics Northern express spectra.Press people's such as Ton C. method (Ton C et al., Biochem BiophysRes Commun 1997 Dec 18; 241 (2): 589-594; Hwang DM, et al., Circulation 1997 Dec16; 96 (12): 4146-4203), the BLAST retrieval will be done in the dbEST database of hPTP cDNA sequence in the GCG software package, in the human EST that obtains, probable value＜10e-10, the EST of homogeny＞95% has 135, can be considered the transcriptional expression of this gene in tissue originally, draw the tissue spectrum of expressing this gene thus, find that it is at brain, mammary gland, cerebellum, colon, inoblast, B cell germinal center (B cell germinalcenter), heart, hippocampus, kidney, liver, lung, melanocyte, Jurkat T cell, ovary, pancreas, parathyroid gland, Tiroidina, pineal gland, placenta, prostate gland, spleen, expression is all arranged in uterus and the testis, show that it is all bringing into play important effect in the many histoorgans of human body.

Embodiment 5

The preparation of hPTP polypeptide and purification

In this embodiment, the hPTP encoding sequence of total length or fragment are built into commercial protein merge among the expression vector, to express and purification of recombinant proteins.

1. the hPTP polypeptide is carried out prokaryotic expression with the form of gst fusion protein in intestinal bacteria.

Construction of prokaryotic expression vector, and transformed into escherichia coli

Complete encoding sequence (SEQ ID NO.6) according to people hPTP, design amplifies complete coding and reads the primer of frame (correspond respectively to encoding sequence 5 ' and about 20 above Nucleotide of 3 ' end), and on positive anti-primer, introduce restriction endonuclease sites (this decides according to the pGEX-2T carrier of selecting for use) respectively, so that construction of expression vector.With the amplified production that obtains among the embodiment 1 is template, behind pcr amplification, with the hPTP gene guarantee to read be cloned under the correct prerequisite of frame the pGEX-2T carrier (Pharmacia, Piscataway, NJ).Identify that good expression vector utilizes CaCl ₂Method changes bacillus coli DH 5 alpha over to, and Screening and Identification obtains containing the engineering bacteria DH5 α-pGEX-2T-hPTP of pGEX-2T-hPTP expression vector.

Express the isolation identification of the engineering bacteria of GST-hPTP recombinant protein

DH5 α-pGEX-2T-hPTP the engineering bacteria of picking list bacterium colony contains jolting overnight incubation in the LB substratum of 100 μ g/ml penbritins in 3ml, drawing nutrient solution by 1: 100 concentration cultivated about 3 hours in new LB substratum (containing 100 μ g/ml penbritins), after reaching 0.5 to OD600, adding IPTG continues at 37 ℃ to final concentration 1mmol/L and cultivates 0 respectively, 1,2,3 hours.It is centrifugal to get the different 1ml bacterium liquid of incubation time, in the bacterial precipitation thing, add lysate (2 * SDS sample-loading buffer, 50 μ l, distilled water 45 μ l, 3-mercaptoethanol 5 μ l), the suspendible bacterial precipitation, boiled in the boiling water bath 5 minutes, centrifugal 1 minute of 10000rpm, supernatant adds electrophoresis in the 12%SDS-PAGE glue.The bacterial strain that the protein content of dyeing back observation expection molecular weight size increases with the IPTG induction time is the engineering bacteria of expressing the GST-hPTP fusion rotein.

The extraction purifying of GST-hPTP fusion rotein

The proteic engineering bacteria DH5 of abduction delivering GST-hPTP amalgamation and expression α-pGEX-2T-hPTP as stated above.Bacterium centrifugation after inducing adds the resuspended bacterium of 20ml PBS, ultrasonication bacterium by every 400ml bacterium.The ultrasonic completely liquid of broken bacterium adds 50% saturated Triptide Sepharose 4B of PBS by every milliliter of amount that adds 20 microlitres, 37 ℃ of joltings were in conjunction with 30 minutes, 10000rpm precipitated the Triptide Sepharose 4B that combines GST-hPTP in centrifugal 10 minutes, abandoned supernatant.Clean twice by the amount that every milliliter of ultrasonic liquid gained precipitation adds 100 μ l PBS, then add people's 10 μ l reduced glutathione elutriants by every milliliter of ultrasonic liquid gained precipitation, room temperature was put 10 minutes, centrifugal 10 minutes of 10000rpm, and supernatant is the fusion rotein of wash-out.Repeat twice of wash-out.The supernatant of wash-out is stored in-80 ℃, and carries out the SDS-PAGE electrophoresis, detects purification effect.Protein band at the 91kDa place is hPTP albumen.

Embodiment 6

HPTP albumen or polypeptide carry out eukaryotic cell expression in insect cell

The structure of hPTP rhabdovirus expression vector and transfection Sf 9 insect cell strain

According to the complete encoding sequence (SEQ ID NO.6) of people hPTP, design amplifies the primer that complete coding is read frame, and introduces restriction endonuclease sites (this is decided by the carrier of selecting for use) respectively on positive anti-primer, so that construction of expression vector.With the amplified production that obtains among the embodiment 1 is template, behind pcr amplification, with hPTPcDNA under the prerequisite that guarantees reading frame, be cloned into the pVL1392 carrier (Invitrogen, Carlsbad, CA).Identify good expression vector 3 μ g, wild-type linearized baculovirus dna (BaculoGold ^TMACMNPV DNA, Pharmingen, San Diego, CA) 1 μ g and Lipofection (power is gone in the insect substratum of 1ml serum-free for Gibco-BRL, NY) 25 μ l, the 15 seconds mixings that vibrate, incubated at room 15 minutes is standby.Get 1ml (2 * 10 ⁶) Sf9 insect cell suspension is in 60mm tissue culturing plate, change transfection media after adherent 1 hour, incubated at room was abandoned substratum after 15 minutes, add the dna vector transfection mixture for preparing previously, Parafilm seals culture plate, cultivated 4 hours in 27 ℃ of joltings of room temperature, then change perfect medium and cultivated 3 days, it is standby to collect supernatant.

2. change the Screening and Identification of the insect cell line of recombinant expression vector over to

The insect cell of transfection after 3 days made cell suspension (2 * 10 with fresh culture ⁶/ 1ml), get the 1ml cell suspension and place 60mm tissue culture ware, add the 3ml substratum, the culture supernatant that 100 μ l collect, adherent 1 hour, abandon the 2ml substratum, continue incubated at room temperature 1 hour, and discarded all substratum, add the 3ml semisolid medium that contains 20 μ l4%X-gal of preheating, cultivate after 5-7 days picking white cell clone and in 96 well culture plates, cultivated 3-5 days, then draw supernatant infection Sf9 insect cell.

Collect the cell that infects and carry out the Western evaluation.The SDS-PAGE electrophoresis will be carried out after the lysis, glue behind the electrophoresis prints to protein transduction on the nitrocellulose membrane in the electrotransfer instrument in the Multiphor of Pharmacia II half, nitrocellulose membrane is placed confining liquid sealing 1 hour, then in the antibody-solutions of anti-hPTP, sealed 1 hour, the jolting of TBS liquid is cleaned 5 minutes 2 times totally, then film is placed the anti-second antibody solution jolting of biotin labeled anti-PTP one 1 hour, TBS cleans, adding avidin-alkaline phosphatase enzyme complex reacted 30 minutes, TBS cleans 2 times, adds freshly prepared colour developing liquid colour developing and observes protein band.

The Sf9 cell clone of picking high expression level hPTP.

The proteic extraction purifying of hPTP

Supernatant with the Sf9 cell clone of high expression level hPTP infects the Sf9 cell in a large number, infects collecting cell after 48 hours, the PBS washing.Per 2 * 10 ⁸Cell adds 20ml cell pyrolysis liquid (0.5%Triton X-100,20mM Na ₃PO ₄(sodium phosphate, pH7.8), 500mM NaCl, lmM Na ₃VO ₄(vanadic acid sodium), 1mM Pefabloc, μ g/ml pepstatin, leupeptin and aprotinin) broken cell, the centrifugal 20min of 12000 * g removes cell debris, and supernatant is by per 2 * 10 ⁸Cell add the 2mlNTA-agarose (Qiagen, Germany), 4 ℃ of absorption 1 hour.Then with containing the His damping fluid washed twice of 100nM imidazoles, with containing 20mM N, N '-two piperazine, 500mM NaCl, the buffer solution elution of 300mM imidazoles is to obtain the albumen of purifying.Elutriant is stored in 4 ℃, and carries out the proteic purity of hPTP that the SDS-PAGE electrophoresis detection is extracted.Protein band at the 91kDa place is hPTP albumen.

Embodiment 7

The preparation of anti-people hPTP antibody

1. the preparation of immune mouse and splenocyte: it is standby that the hPTP albumen that obtains among embodiment 5 and the embodiment 6 is separated the back with chromatography, also can separate with the SDS-PAGE gel electrophoresis, electrophoretic band is cut off from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Get the female mouse of 6-8 week Balb/C in age, the albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days, with the same antigen of non-complete Freund ' s adjuvant emulsion to mouse with the dosage of 50-100 μ g/0.2ml again booster immunization once be used for after 3-5 days merging.Wherein, E Zheng chief editor, " tissue culture and molecular cell learn a skill ", Beijing Publishing House, the 210th page are seen in the splenocyte preparation.

2. by " tissue culture and molecular cell learn a skill " (the same), the method in the 371st page, preparation feeder cell.

3. by " tissue culture and molecular cell learn a skill " (the same), the method in the 213rd page is carried out cytogamy.

4. detection of antibodies: after cytogamy 10-15 days, need to check by the hole, in case find vigorous hybrid cell colony growth, just use hPTP albumen and do the preliminary screening of antibody activity, method commonly used has: immunofluorescent test, emission immunity test (RIA), enzyme linked immunosorbent assay (ELISA).After checking out the hole of antibody activity, clone cultivation at once, and isolate antibody.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

(1) general information:

(ⅰ) applicant: Nanfang Research Centre, State Human Gene Group

(ⅱ) denomination of invention: Human Protein-Tyrosine Phosphatase and encoding sequence thereof

(ⅲ) sequence number: 7

(2) information of SEQ ID NO.1

(ⅰ) sequence signature:

(A) length: 50bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅸ) sequence description: SEQ ID NO.1GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTT50

(2) information of SEQ ID NO.2

(ⅰ) sequence signature:

(A) length: 13bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅸ) sequence description: SEQ ID NO.2

AATTCGGCACGAG????????????????????????????????13

(2) information of SEQ ID NO.3

(ⅰ) sequence signature:

(A) length: 9bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅸ) sequence description: SEQ ID NO.3

GCCGTGCTC????????????????????????????????9

(2) information of SEQ ID NO.4

(ⅰ). sequence signature:

(A) length: 22bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ⅱ). molecule type: oligonucleotide

(ⅸ). sequence description: SEQ ID NO.4 CTCTGCAGCATGGACCAAA 19

(2) information of SEQ ID NO.5

(ⅰ). sequence signature:

(A) length: 21bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ⅱ). molecule type: oligonucleotide

(ⅸ). sequence description: SEQ ID NO.5CAGGTGTACTTGCAGCCCAT 20

(2) information of SEQ ID NO.6

(ⅰ). sequence signature:

(A) length: 2452bp

(B) type: Nucleotide

(C) chain: two strands

(D) topological framework: linearity

(ⅱ). molecule type: oligonucleotide

( ⅸ ) ．：SEQ ID NO.6 1 CTCTGCAGCA TGGACCAAAG AGAAATTCTG CAGAAGTTCC TGGATGAGGC 51 CCAAAGCAAG AAAATTACTA AAGAGGAGTT TGCCAATGAA TTTCTGAAGC101 TGAAAAGGCA ATCTACCAAG TACAAGGCAG ACAAAACCTA TCCTACAACT151 GTGGCTGAGA AGCCCAAGAA TATCAAGAAA AACAGATATA AGGATATTTT 201 GCCCTATGAT TATAGCCGGG TAGAACTATC CCTGATAACC TCTGATGAGG 251 ATTCCAGCTA CATCAATGCC AACTTCATTA AGGGAGTTTA TGGACCCGAG 301 GCTTATATTG CCACCCAGGG TCCTTTATCT ACAACCCTCC TGGACTTCTG 351 GAGGATGATT TGGGAATATA GTGTCCTTAT CATTGTTATG GCATGCATGG 401 AGTATGAAAT GGGAAAGAAA AAGTGTGAGC GCTACTGGGC TGAGCCAGGA 451 GAGATGCAGC TGGAATTTGG CCCTTTCTCT GTATCCTGTG AAGCTGAAAA 501 AAGGAAATCT GATTATATAA TCAGGACTCT AAAAGTTAAG TTCAATAGTG 551 AAACTCGAAC TATCTACCAG TTTCATTACA AGAATTGGCC AGACCATGAT 601 GTACCTTCAT CTATAGACCC TATTCTTGAG CTCATCTGGG ATGTCCGTTG 651 TACCCAAGAG GATGACAGTG TTCCCATATG CATTCACTGC AGTGCTGGCT 701 GTGGAAGGAC TGGTGTTATT TGTGCTATTG ATTATACATG GATGTTGCTA 751 AAAGATGGGA TAATTCCTGA GAACTTCAGT GTTTTCAGTT TGATCCGGGA 801 AATGCGGACA CAGAGGCCTT CATTAGTTCA AACGCAGGAA CAATATGAAC 851 TGGTCTACAA TGCTGTATTA GAACTATTTA AGAGACAGAT GGATGTTATC 901 AGAGATAAAC ATTCTGGAAC AGAGAGTCAA GCAAAGCATT GTATTCCTGA 951 GAAAAATCAC ACTCTTCAAG CAGACTCTTA TTCTCCTAAT TTACCAAAAA1001 GTACCACAAA AGCAGCAAAA ATGATGAACC AACAAAGGAC AAAAATGGAA1051 ATCAAAGAAT CTTCTTCCTT TGACTTTAGG ACTTCTGAAA TAAGTGCAAA1101 AGAAGACGTA AGTTTGGCCC CGGAAAACCA GGCTTTTTTT TGCCTTTCGG1151 AAGTAAATTC CAGTTTTGCA AAAATGTTGC CCCACCATGA AATGCCAGCA1201 AAGGCTTTCC AAATAGTGGG AAGCTCTTCA GAAGCATCAA AGTTGAATTG1251 GGCCTCTCTT TGTTTAGGAA TGTCTAATTC TAACCTTGTA TGCAGCAGAA1301 AGATATTTAA TCCAAGGTGC CAATACCCGG ACCAAATCAA CTCTTTTGAA1351 TTGATCCAGC AAGAGAACCA AGGAGGTGAC AGCAAGAAAA CTTTCTTATT1401 TGAATCTCAA CCACATGATT CTTGTTTTGT AGAGATGCAG GCTCAAAAAG1451 TAATGCATGT TTCTTCAGCA GAACTGAATT ATTCACTGCC ATATGACTCT1501 AAACACCAAA TACGTAATGC CTCTAATGTA AAGCACCATG ACTCTAGTGC1551 TCTTGGTGTA TATTCTTACA TACCTTTAGT GGAAAATCCT TATTTTTCAT1601 CATGGCCTCC AAGTGGTACC AGTTCTAAGA TGTCTCTTGA TTTACCTGAG1651 AAGCAAGATG GAACTGTTTT TCCTTCTTCT CTGTTGCCAA CATCCTCTAC1701 ATCCCTCTTC TCTTATTACA ATTCACATGA TTCTTTATCA CTGAATTCTC1751 CAACCAATAT TTCCTCACGT ATTGAACAGG AGTCAGCTGT ACTAGCAACT1801 GCTCCAAGGA TAGATGATGA AATCCCCCTC CACTTCCTGT ACGGGACACC1851 TGAATCATTT ATTGTGGTTG AGGAAGCTGG AGAATTCTCA CCAAATGTTC1901 CCAAATCCTT ATCCTCAGCT GTGAAGGTAA AAATTGGAAC ATCACTGGAA1951 TGGGGTGGAA CATCTGAACC AAAGAAATTT GATGACTCTG TGATACTTAG2001 ACCAAGCAAG AGTGTAAAAC TCCGAAGTCC TAAATCAGAA CTACATCAAG2051 ATCGTTCTTC TCCCCCACCT CCTCTCCCAG AAAGAACTCT AGAGTCAATC2101 TTTCTTGCCG ATGAAGATTG TATGCAGGCC CAATCTATAG AAACATATTC2151 TACTAGCTAT CCTGACACCA TGGAAAATTC AACATCTTCA AAACAGACAC2201 TGAAGACTCC TGGAAAAAGT TTCACAAGGA GTAAGAGCTT GAAAATTTTG2251 CGAAACATGA AAAAGAGTAT CTGTAATTCT TGCCCACCAA ACAAGCCTGC2301 AGAATCTGTT CAGTCAAATA ACTCCAGCTC ATTTCTGAAT TTTGGTTTTG2351 CAAACCGTTT TTCAAAACCC AAAGGACCAA GGAATCCACC ACCAACTTGG2401 AATATTTAAT AAAACTCCAG ATTTATAATA ATATGGGCTG CAAGTACACC2451 TG

(2) information of SEQ ID NO.7

(ⅰ) sequence signature:

(A) length: 799 amino acid

(B) type: amino acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: polypeptide

( ⅸ ) ：SEQ ID NO.7 1 Met Asp Gln Arg Glu Ile Leu Gln Lys Phe Leu Asp Glu Ala Gln 16 Ser Lys Lys Ile Thr Lys Glu Glu Phe Ala Asn Glu Phe Leu Lys 31 Leu Lys Arg Gln Ser Thr Lys Tyr Lys Ala Asp Lys Thr Tyr Pro 46 Thr Thr Val Ala Glu Lys Pro Lys Asn Ile Lys Lys Ash Arg Tyr 61 Lys Asp Ile Leu Pro Tyr Asp Tyr Ser Arg Val Glu Leu Ser Leu 76 Ile Thr Ser Asp Glu Asp Ser Ser Tyr Ile Asn Ala Ash Phe Ile 91 Lys Gly Val Tyr Gly Pro Glu Ala Tyr Ile Ala Thr Gln Gly Pro106 Leu Ser Thr Thr Leu Leu Asp Phe Trp Arg Met Ile Trp Glu Tyr121 Ser Val Leu Ile Ile Val Met Ala Cys Met Glu Tyr Glu Met Gly136 Lys Lys Lys Cys Glu Arg Tyr Trp Ala Glu Pro Gly Glu Met Gln151 Leu Glu Phe Gly Pro Phe Ser Val Ser Cys Glu Ala Glu Lys Arg166 Lys Ser Asp Tyr Ile Ile Arg Thr Leu Lys Val Lys Phe Asn Ser181 Glu Thr Arg Thr Ile Tyr Gln Phe His Tyr Lys Asn Trp Pro Asp196 His Asp Val Pro Ser Ser Ile Asp Pro Ile Leu Glu Leu Ile Trp211 Asp Val Arg Cys Thr Gln Glu Asp Asp Ser Val Pro Ile Cys Ile226 His Cys Ser Ala Gly Cys Gly Arg Thr Gly Val Ile Cys Ala Ile241 Asp Tyr Thr Trp Met Leu Leu Lys Asp Gly Ile Ile Pro Glu Asn256 Phe Ser Val Phe Ser Leu Ile Arg Glu Met Arg Thr Gln Arg Pro271 Ser Leu Val Gln Thr Gln Glu Gln Tyr Glu Leu Val Tyr Asn Ala286 Val Leu Glu Leu Phe Lys Arg Gln Met Asp Val Ile Arg Asp Lys301 His Ser Gly Thr Glu Ser Gln Ala Lys His Cys Ile Pro Glu Lys316 ASn His Thr Leu Gln Ala Asp Ser Tyr Ser Pro Asn Leu Pro Lys331 Ser Thr Thr Lys Ala Ala Lys Met Met Asn Gln Gln Arg Thr Lys346 Met Glu Ile Lys Glu Ser Ser Ser Phe Asp Phe Arg Thr Ser G1u361 Ile Ser Ala Lys Glu Asp Val Ser Leu Ala Pro Glu Asn Gln Ala376 Phe Phe Cys Leu Ser Glu Val Asn Ser Ser Phe Ala Lys Met Leu391 Pro His His Glu Met Pro Ala Lys Ala Phe Gln Ile Val Gly Ser406 Ser Ser Glu Ala Ser Lys Leu ASn Trp Ala Ser Leu Cys Leu Gly421 Met Ser Asn Ser Asn Leu Val Cys Ser Arg Lys Ile Phe Asn Pro436 Arg Cys Gln Tyr Pro Asp Gln Ile Asn Ser Phe Glu Leu Ile Gln451 Gln Glu Asn Gln Gly Gly Asp Ser Lys Lys Thr Phe Leu Phe Glu466 Ser Gln Pro His Asp Ser Cys Phe Val Glu Met Gln Ala Gln Lys481 Val Met His Val Ser Ser Ala Glu Leu Asn Tyr Ser Leu Pro Tyr496 Asp Ser Lys His Gln Ile Arg ASn Ala Ser Asn Val Lys His His511 Asp Ser Ser Ala Leu Gly Val Tyr Ser Tyr Ile Pro Leu Val Glu526 Asn Pro Tyr Phe Ser Ser Trp Pro Pro Ser Gly Thr Ser Ser Lys541 Met Ser Leu Asp Leu Pro Glu Lys Gln Asp Gly Thr Val Phe Pro556 Ser Ser Leu Leu Pro Thr Ser Ser Thr Ser Leu Phe Ser Tyr Tyr571 Asn Ser His Asp Ser Leu Ser Leu Asn Ser Pro Thr Asn Ile Ser586 Ser Arg Ile Glu Gln Glu Ser Ala Val Leu Ala Thr Ala Pro Arg601 Ile Asp Asp Glu Ile Pro Leu His Phe Leu Tyr Gly Thr Pro Glu616 Ser Phe Ile Val Val Glu Glu Ala Gly Glu Phe Ser Pro Asn Val631 Pro Lys Ser Leu Ser Ser Ala Val Lys Val Lys Ile Gly Thr Ser646 Leu Glu Trp Gly Gly Thr Ser Glu Pro Lys Lys Phe Asp Asp Ser661 Val Ile Leu Arg Pro Ser Lys Ser Val Lys Leu Arg Ser Pro Lys676 Ser Glu Leu His Gln Asp Arg Ser Ser Pro Pro Pro Pro Leu Pro691 Glu Arg Thr Leu Glu Ser Ile Phe Leu Ala Asp Glu Asp Cys Met706 Gln Ala Gln Ser Ile Glu Thr Tyr Ser Thr Ser Tyr Pro Asp Thr721 Met Glu Asn Ser Thr Ser Ser Lys Gln Thr Leu Lys Thr Pro Gly736 Lys Ser Phe Thr Arg Ser Lys Ser Leu Lys Ile Leu Arg ASn Met751 Lys Lys Ser Ile Cys Asn Ser Cys Pro Pro Asn Lys Pro Ala Glu766 Ser Val Gln Ser Asn Asn Ser Ser Ser Phe Leu Asn Phe Gly Phe781 Ala Asn Arg Phe Ser Lys Pro Lys Gly Pro Arg Asn Pro Pro Pro796 Thr Trp Asn Ile

Claims (10)

1. isolated dna molecular, it is characterized in that, it comprises: coding has the nucleotide sequence of the polypeptide of people hPTP protein active, shows at least 70% homology from the nucleotides sequence of Nucleotide 10-2406 position among described nucleotide sequence and the SEQ ID NO.6; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.6 in from the nucleotide sequence hybridization of Nucleotide 10-2406 position.

2. dna molecular as claimed in claim 1 is characterized in that described sequence encoding has the polypeptide of sequence shown in the SEQ IDNO.7.

3. dna molecular as claimed in claim 1 is characterized in that, this sequence has among the SEQ ID NO.6 nucleotide sequence from Nucleotide 10-2406 position.

4. isolated people hPTP protein polypeptide is characterized in that it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.7 aminoacid sequence, or its reactive derivative.

5. polypeptide as claimed in claim 4 is characterized in that, this polypeptide is to have SEQ ID NO.7 polypeptide of sequence.

6. a carrier is characterized in that, it comprises the described DNA of claim 1.

7. one kind with the described carrier transformed host cells of claim 6.

8. a generation has the method for the polypeptide of people hPTP protein active, it is characterized in that this method comprises:

(1) nucleotide sequence that coding is had a polypeptide of people hPTP protein-active operationally is connected in expression regulation sequence, form people hPTP protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 10-2406 position among described nucleotide sequence and the SEQ ID NO.6;

(2) change the expression vector in the step (1) over to host cell, form the proteic reconstitution cell of people hPTP;

(3) under the condition that is fit to expressing human hPTP protein polypeptide, the reconstitution cell in the culturing step (2);

(4) isolate polypeptide with people hPTP protein-active.

9. energy and the described people hPTP of claim 7 protein polypeptide specificity bonded antibody.

10. a probe molecule is characterized in that, it comprises 8-1000 continuous nucleotide in the described dna molecular of claim 1.

Images