CN1269961C - Nucleotide sequence of pichia delta12-fatty acid dehydrogenase and its use - Google Patents
Nucleotide sequence of pichia delta12-fatty acid dehydrogenase and its use Download PDFInfo
- Publication number
- CN1269961C CN1269961C CNB2004100939976A CN200410093997A CN1269961C CN 1269961 C CN1269961 C CN 1269961C CN B2004100939976 A CNB2004100939976 A CN B2004100939976A CN 200410093997 A CN200410093997 A CN 200410093997A CN 1269961 C CN1269961 C CN 1269961C
- Authority
- CN
- China
- Prior art keywords
- nucleotide sequence
- sequence
- fatty acid
- cell
- acid dehydrogenase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a nucleotide sequence for encoding delta<12>-fatty acid dehydrogenase separated from pichia yeast, which has a nucleotide sequence or a segment of the nucleotide sequence, an analog and a derivate which are shown in SEQ ID NO: 1. The present invention comprises the nucleotide sequence for encoding delta<12>-fatty acid dehydrogenase, a functionality operating expression carrier, a cell organism with the carrier of the present invention, and a filial generation with the organism, wherein the nucleotide sequence is connected to an exogenous adjusting sequence. The present invention also comprises a method for producing unsaturated fatty acid by the nucleotide sequence, a polypeptide sequence, a cell organism with the carrier of the present invention, and the filial generation of the organism, and a probe by using the nucleotide sequence shown in SEQ ID NO: 1 for identifying corresponding sequences.
Description
Technical field
The invention belongs to biological technical field and field of genetic engineering, relate to clone's Δ from one primary yeast-pichia spp (PichiaPastoris)
12-fatty acid dehydrogenase gene specifically is the pichia spp Δ
12The nucleotide sequence of-fatty acid dehydrogenase and application thereof.This gene directly or with different expression vectors is connected, be transferred in bacterium, yeast, plant or the animal, utilize its coded delta
12-fatty acid dehydrogenase produces the methods and applications of unsaturated fatty acids.
Background technology
Δ
12-fatty acid dehydrogenase belongs to a class film intergrase.Up to the present, owing to separate and identify difficulty very big [MaKeon, 1981, Enzymology method, the 12141-12147 of embrane-associated protein; Wang etc., 1988, plant physiology biological chemistry, 26:777-792], therefore be difficult to obtain comprising Δ
12-fatty acid dehydrogenase is at the higher structure of interior various embrane-associated protein character desaturases, and can only carry out preliminary study by the nucleotide sequence to enzyme, perhaps expresses the substrate specificity of studying enzyme in allogenic acceptor.The result of sequence alignment shows, coded delta
12The nucleotide sequence of-fatty acid dehydrogenase has the common constitutional features: have three Histidine conserved regions His I district HECGH, His II district HXXHH and His III district HVXHH, form structure [the Kyte et al. that strides film for 4 times, 1982, J.Mol.Biol.157:105-132], these all are to keep necessary [the Napier JA of dehydrogenase activity, Sayanova O, Stobart AK, et al., 1997, Biochem.J., 328:717-720].Comprise in people's the mammalian body owing to lack Δ
12-fatty acid dehydrogenase and can only tentatively synthesize saturated and monounsaturated fatty acids, can not synthesize polyunsaturated fatty acid (the polyunsaturated fatty acids that contains two keys more than two and two, PUFAs), these polyunsaturated fatty acids must obtain from food.Therefore, linolic acid (linoleic acid, LA) and alpha-linolenic acid (α-linoleic acid ALA) is essential fatty acid.Meals absorption linolic acid and alpha-linolenic acid are through Δ
6-fatty acid dehydrogenase is catalytically converted into gamma-linolenic acid (γ-linoleic acid, GLA) and therapic acid (Octadecatetraenoic acid, OTA), they can further change into other long chain polyunsaturated fatty acids (long-chainpolyunsaturated fatty acids again under the catalysis of other relevant enzyme, LC-PUFAs) [Horrobin DF, 1992, Prog Lipid Res., 31:163-194].These long chain polyunsaturated fatty acidss are body tissue microbial film moietys, play the effect of keeping the cell normal function and increasing body resistance, simultaneously also be precursor [the Napier JA et al. that prostaglandin(PG), prostacyclin and interleukin class etc. have self instrumentality of strong physiologically active, 1999, Curr.Opin.Plant Biol., 2:123-127], the polyunsaturated fatty acid that therefore comprises linolic acid health care and medical aspect very wide application prospect is arranged.The synthetic physiological action with it of research unsaturated fatty acids becomes one of current focus.
For the biological function of fatty acid dehydrogenase, many laboratories have been adopted the gene that the clone is relevant from various organisms and have been changed in the various acceptors, observe the method for the lipid acid change of acceptor in acceptor.At present, from different sourcess such as animal, plant, microorganism, be separated to many Δs
12The homologous sequence of-lipid acid dehydrogenation gene, and proof has corresponding biological function.Especially in recent years along with difunctional Δ
12The discovery of-fatty acid dehydrogenase (Edgar B.Cahoon etal, 2001, THE JOURNAL OF BIOLOGICAL CHEMISTRY., 26:2637-2643.) with the excavation of conjugation oleic acid at medical health care function, people's attention begins again to turn to Δ
12In the research of-fatty acid dehydrogenase.
Summary of the invention
An object of the present invention is to provide separated coding Δ from pichia spp
12The nucleotide sequence of-fatty acid dehydrogenase or the fragment of its nucleotide sequence, analogue or derivative.Clone's Δ from one primary yeast-pichia spp (Pichia pastoris)
12-fatty acid dehydrogenase gene specifically is the pichia spp Δ
12The nucleotide sequence of-fatty acid dehydrogenase and application thereof.This gene directly or with different expression vectors is connected, be transferred in bacterium, yeast, plant or the animal, utilize its coded delta
12-fatty acid dehydrogenase produces the methods and applications of unsaturated fatty acids.
Another object of the present invention provides the coded Δ of this nucleotide sequence
12-fatty acid dehydrogenase polypeptide or its fragment, analogue or derivative.
Another object of the present invention provides and contains this gene nucleotide series and allos and regulate sequence and be connected, and carries out the recombinant vectors of functional expression.
Another object of the present invention provides and contains this gene nucleotide series or this gene nucleotide series and allos and regulate host cell and the offspring thereof that recombinant vectors that sequence is connected transforms or transduces.
Another object of the present invention provides a kind of usefulness and contains this gene nucleotide series or this gene nucleotide series and allos and regulate host cell and progeny cell or the coded Δ of this nucleotide sequence that recombinant vectors that sequence is connected transforms or transduces
12-fatty acid dehydrogenase polypeptide prepares the method for unsaturated fatty acids.
A first aspect of the present invention provides fragment, analogue and derivative with the nucleotide sequence shown in the SEQ ID NO:1 or this nucleotide sequence.
Isolating Δ
12The nucleotide sequence of-fatty acid dehydrogenase gene, it comprises a nucleotide sequence, and this nucleotide sequence is shown at least 65% homology with a kind of nucleotides sequence that is selected from down group: (1) has the nucleotide sequence of the active polypeptide of coding SEQ ID NO:2 aminoacid sequence; (2) with nucleotide sequence (1) complementary nucleotide sequence.Exactly, this nucleotide sequence has the nucleotide sequence shown in the SEQ ID NO:1.More accurately, this nucleotide sequence is to be selected from down a kind of in the group: (a) have the sequence of 1-1394 in the SEQID NO:1 sequence: and (b) have the sequence of 85-1347 among the SEQ ID NO:1.
In a second aspect of the present invention, isolating this nucleotide sequence encoded polypeptide is provided, this polypeptide comprises: polypeptide or its fragment or its conservative property variation polypeptide or its derived analogs with SEQ ID NO:2 aminoacid sequence.Exactly, this polypeptide is that polypeptide or its amino acid variation with SEQ ID NO:2 aminoacid sequence is no more than 30% derivative.
A third aspect of the present invention provides the recombinant vectors that contains above-mentioned nucleotide sequence, and by above-mentioned nucleotide sequence or recombinant vectors transformed host cells and progeny cell thereof.
A fourth aspect of the present invention provides a kind of usefulness to contain this gene nucleotide series or this gene nucleotide series and allos and has regulated recombinant vectors that sequence is connected transform or transduce host cell and progeny cell thereof or with the coded Δ of this nucleotide sequence
12-fatty acid dehydrogenase polypeptide prepares the method for unsaturated fatty acids.
Other aspects of the present invention are because disclosing of this paper technology is conspicuous to those skilled in the art.
As used herein, " isolating " are meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.For example, nucleotide sequence and polypeptide under the native state in the active somatic cell do not have separation and purification, but same nucleotide sequence or polypeptide as from native state with separating in other material that exists, then be separation and purification.
As used herein, " isolating nucleotide sequence " is meant and is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can be with the DNA purification technique purifying of standard.
The invention provides a kind of new isolating nucleotide sequence---coding pichia spp Δ
12The nucleotide sequence of-fatty acid dehydrogenase, it is made up of nucleotide sequence shown in the SEQ ID NO:1 basically, it is characterized in that: this sequence is long to be 1394bp (base), and wherein 85-1347 is a coded delta
12The open reading frame of-fatty acid dehydrogenase mature polypeptide SEQ ID NO:2; 1bp-84bp is the non-region sequence of translating of 5`, and 1348bp-1394bp is the non-region sequence of translating of 3`.
The invention provides isolating nucleotide sequence, this nucleotide sequence is made up of the nucleotide sequence that coding has an active polypeptide of SEQ ID NO:2 aminoacid sequence substantially.Particularly, nucleotide sequence of the present invention has the nucleotide sequence of SEQ ID NO:1.
The nucleotide sequence of coding SEQ ID NO:2 active polypeptide comprises: the encoding sequence that has only mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " coding pichia spp Δ
12The nucleotide sequence of-fatty acid dehydrogenase " be meant comprise coding pichia spp Δ-
12The nucleotide sequence of fatty acid dehydrogenase polypeptide and comprise additional code and/or noncoding nucleotide sequence.
Nucleotide sequence of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can with the identical or varient of degeneracy of coding region sequence shown in the SEQ ID NO:2.As used herein, " varient of degeneracy " are meant that in the present invention coding has protein or the polypeptide of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The present invention also comprises coding pichia spp Δ
12The fragment of the nucleotide sequence of-fatty acid dehydrogenase, analogue or derivative.As used herein, term " fragment ", " analogue " are meant to encode with " derivative " and keep the natural identical biological function of the present invention or the nucleotide sequence of active polypeptide basically.
By the elaboration of this paper, such fragment, analogue or derivative are considered within those skilled in the art's ken.
The fragment of nucleotide sequence of the present invention, derived sequence or similar sequence can be that wherein one or more Nucleotide replace, the nucleotide sequence of disappearance, insertion, inversion, i.e. the artificial mutant of original separation sequence, and it also has required enzymatic functions.It can also be other gene Fusion sequence of described nucleotide sequence and fatty acid biological synthetic.
The allelic variant that derivative shown in SEQ ID NO:1 or functional derivatives are represented, it has at least 75% homology at the deutero-amino acid levels, preferred at least 80% homology, preferred especially 85% homology, very special preferably 90% homology.Described homology is based on complete amino acid fragment calculating.Shown in SEQ ID NO:2, homology is represented identity by described nucleotide sequence coded aminoacid sequence, and aminoacid sequence at least 70% is identical in other words.Described new nucleotide sequence has 65% homology at least on nucleic acid level, preferred at least 70% homology, preferred especially 75% homology, very special preferably 80% homology.
Derivative is also represented the homologue of sequence shown in the SEQ ID NO:1, as the sequence of eucaryon homologue, brachymemma, but still have required function, have this proteic enzymatic activity in other words, therefore, functionally equivalent comprise above-mentioned sequence natural variant and artificial sequence oligodeoxynucleotide.
Noncoding derivative also represents to can be used for suppressing the biosynthetic antisense DNA of described novel protein.Described antisense DNA belongs to no function derivative of the present invention.As not possessing the derivative of enzymatic activity.Available those skilled in the art knows other method of producing no function derivative has common inhibition, the use of ribozyme and intron.
The invention still further relates to and the nucleotide sequence of above-mentioned sequence hybridization (has at least 50% homology between two sequences, preferred at least 70% homology), and interfertile nucleotide sequence coded polypeptide has identical biological function with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with sequence hybridization described above.As used herein, the length of " nucleic acid fragment " contain 10 Nucleotide at least, 20-30 Nucleotide at least preferably, and 50-60 Nucleotide at least especially preferably is very especially preferably more than at least 100 Nucleotide.Nucleotide fragments also can be used for the amplification technique (as PCR) of nucleic acid to determine and/or the separation nucleotide sequence coding.
Polypeptide among the present invention and nucleotide sequence preferably provide with isolating form, more preferably are purified to homogeneous.
Specific nucleotide sequence can obtain with several different methods among the present invention.For example, with hybridization technique separating nucleotide sequence well known in the art.These technology including, but not limited to: (1) with probe and genome or the hybridization of cDNA library to detect the homologous nucleotide sequence; (2) antibody screening of expression library is to detect the nucleotide sequence fragment of the clone with common structure feature.
Sequence dna fragment of the present invention also can obtain with following method: (1) separates double chain DNA sequence from genomic dna; (2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.
In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of dna sequence dna.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, also can obtain from commercial channels with test kit.And the construction cDNA library also is a usual method.When in conjunction with polymerase chain reaction technology (PCR), even few expression product also can be cloned.
Available ordinary method is screened gene of the present invention from these cDNA libraries, these methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or disappearance; (3) level of the transcript of Ce Dinging; (4) measure biologic activity by immunological technique, detect the protein product of genetic expression.Aforesaid method can singly be used, but also several different methods combined utilization.In (1) in the method, hybridize used probe and be any a part of homology with nucleotide sequence of the present invention, at least 10 Nucleotide of its length, preferably at least 30 Nucleotide, especially preferably at least 50 Nucleotide, very especially preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.The normally dna sequence dna of chemosynthesis on the basis of gene order information of the present invention of probe that gets used herein.Gene of the present invention itself or fragment are certainly as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.
The method of application round pcr DNA amplification/RNA (Saiki et al., 1985, Science 230:1350-1354) is optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can be according to nucleotide sequence information appropriate selection of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The present invention also provides a kind of new peptide sequence-pichia spp Δ
12The aminoacid sequence of-fatty acid dehydrogenase, it is made up of the aminoacid sequence shown in the SEQ ID NO:2 basically.Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology (for example, to produce in bacterium, yeast, higher plant, insect and the mammalian cell from protokaryon or eucaryon host.
The Δ that polypeptide of the present invention comprises
12The fragment of-fatty acid dehydrogenase, derivative and analogue.As used herein, term " fragment ", " analogue " are meant with " derivative " and keep natural identical biological function of the present invention or active polypeptide basically.The fragment of polypeptide of the present invention, derivative or analogue can be: (I) a kind of like this, wherein one or more amino-acid residues are by conservative or non-conservative amino acid residues (preferably conservative amino acid residues) replacement, inversion, insertion or disappearance; Perhaps (II) is a kind of like this, and certain group on wherein one or more amino-acid residues is replaced by other group and comprises substituting group; Perhaps (III) is a kind of like this, and wherein mature polypeptide and another kind of compound (such as the compound that prolongs the polypeptide transformation period, for example polyoxyethylene glycol) merge; Perhaps (IV) is a kind of like this, and wherein additional aminoacid sequence is integrated into mature polypeptide and the peptide sequence that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying).
The present invention also relates to contain coding pichia spp Δ
12The nucleotide sequence of-fatty acid dehydrogenase and exogenous adjusting sequential element are in conjunction with the recombinant expression vector that carries out functional expression.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The sequential element that can influence gene expression product includes replication origin, promotor, marker gene and translational control element.
Available method well-known to those having ordinary skill in the art makes up and contains coding pichia spp Δ
12The expression vector of the nucleotide sequence of-fatty acid dehydrogenase and suitable transcribing/translational control element.These methods comprise [Sambroook, et al., Molecular Cloning, a LaboratoryManual, Cold Spring Harbor Laboratory, New York, 1989] such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described coding pichia spp Δ
12The nucleotide sequence of-fatty acid dehydrogenase can effectively be connected on the appropriate promotor of expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; The PL promotor of lambda particles phage: eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and common nearly 10-300bp acts on promotor transcribing with enhancing gene.As the adenovirus enhanser.
The invention still further relates to containing the present invention's pichia spp Δ of encoding
12The recombinant vectors of the nucleotide sequence of-fatty acid dehydrogenase or directly with coding pichia spp Δ
12The host cell that the nucleotide sequence of-fatty acid dehydrogenase produces through genetically engineered.Among the present invention, coding pichia spp Δ
12The nucleotide sequence of-fatty acid dehydrogenase or the recombinant vectors that contains this nucleotide sequence can transform or transduce into host cell, contain the genetically engineered host cell of this nucleotide sequence or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.The representative example of host cell has: intestinal bacteria; Fungal cell such as yeast; Vegetable cell such as rape, tobacco, soybean; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.
Can carry out with method well-known to those having ordinary skill in the art with nucleotide sequence of the present invention or the recombinant vectors transformed host cell that contains nucleotide sequence.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be collected thalline in exponential phase of growth, uses CaCl
2Method is handled, and used step is well known in the art.Also available MgCl
2, methods such as electroporation are carried out.When the host is an eukaryote, can select methods such as DNA infection protocol, microinjection, electroporation, liposome packing for use.
The invention still further relates to above-mentioned genetically modified host cell production, according to host cell, with those skilled in the art method growth or cultivation in common knowledge.Normally at 0-100 ℃, preferred 10-60 ℃, also want oxygen simultaneously such as microorganism cells.Contain carbon source in the substratum, as glucose, nitrogenous source, the form of organonitrogen normally, as yeast extract, amino acid, or salt, as ammonium sulfate, trace element as iron, magnesium salts, also has VITAMIN if necessary.The pH of the substratum value that can be maintained fixed in other words, is controlled in the training period or is not controlled during this period.Cultivation can batch culture, half discontinuous cultivation or cultured continuously form are carried out.After cultivating, collecting cell is smashed to pieces or directly use, extracts lipid acid by method well known to those skilled in the art from cell.
The invention still further relates to a kind of method for preparing unsaturated fatty acids, this method is achieved in that to have saturated or the unsaturated fatty acids triglyceride level is cultivated with SEQ ID NO:2.This method is preferably carried out under by the compound existence condition that can absorb or discharge the reductibility equivalent.Then, can release fat acid from triglyceride level.Aforesaid method preferably can synthesize the lipid acid with 12 two keys.
The invention still further relates to and use the method for preparing unsaturated fatty acids, and be applied to produce human food prods, animal-feed, makeup or medicine purposes.
Description of drawings
The pichia spp Δ that Fig. 1, demonstration are inferred
12The hydrophobic figure of-fatty acid dehydrogenase, two solid lines represent two hydrophobic domains inferring.
Fig. 2, demonstration pichia spp Δ of the present invention
12-fatty acid dehydrogenase and Ke Shi yeast (Saccharomyceskluyveri) Δ
12The amino acid sequence homology comparison diagram of-fatty acid dehydrogenase (AB115968.1).
Fig. 3, the constructed yeast saccharomyces cerevisiae expression vector pYPPD12 of demonstration.
The gas chromatogram of Fig. 4 A, demonstration linolic acid methyl ester standard substance.
Fig. 4 B, contain the gas chromatogram of the transgenic yeast of pYES2.0 empty carrier.
Fig. 4 C, contain the gas chromatogram of the transgenic yeast of recombinant plasmid pYPPD12.
Embodiment
Further set forth the present invention below in conjunction with specific embodiment.Should understand these embodiment only is used to the present invention is described rather than limit the scope of the invention.
Embodiment 1 separates Δ from pichia spp
12The nucleotide sequence of-fatty acid dehydrogenase
According to (Liu Xiaoyong etc., 1997, the SDS-CTAB improved method of extraction plant and microbial DNA, Beijing Forestry University's journal, 100-103 such as Liu Xiaoyong.) method that provides extracts total DNA from cultivate 48 hours pichia spp mycelium, getting 5 μ g is that template is carried out the polymerase chain reaction.According to the Δ of being delivered
12The Histidine conserved regions I of-fatty acid dehydrogenase homologous sequence and III region amino acid sequence design degenerate primer (primer 1 and primer 2), DNA with said extracted is that template increases at the enterprising performing PCR of T-Gradient PCR instrument (Biometra company), and reaction the primer, component and amplification condition are as follows: primer 1:5-CA (TC) GA (AG) TG (TC) GG (I) CA (TC) CA (CAG)-3`
Primer 2: 5`-(AG) TG (AG) TGIGCIAC (GA) TGIGT-3`
Reactive component add-on final concentration
Template DNA 5 μ l
Damping fluid (10 *)
(contain 20mmol/L MgCl
2) 5 μ l 1 *
dNTP(2.5mmol/L) 4μl 0.4mmol/L
Primer 1 (10 μ mol/L) 1 μ l 0.2 μ mol/L
Primer 2 (10 μ mol/L) 1 μ l 0.2 μ mol/L
Taqase (5u/ μ l) 0.5 μ l 2.5u/ reaction
H
2O 33.5μl
Cumulative volume 50 μ l
Amplification condition: 94 ℃ of sex change 3min, use 94 ℃ of 1min again; 55 ℃ of 1min → 72 ℃ 1min carry out 30 circulations, last 72 ℃ of 10min.The agarose gel electrophoresis detected result shows, amplification obtains the fragment of the about 750bp of size, reclaim with UNIQ-10 pillar PCR product purification test kit (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd's product), reclaiming the fragment subclone in sequencing vector pGEM-T (Promega company product); The connection product is transformed into uses CaCl
2The bacillus coli DH 5 alpha that method is handled, overnight incubation on the LB solid medium that contains penbritin (final concentration is 100 μ g/ml); The white colony of growing on the picking flat board, access contains overnight incubation in the LB liquid nutrient medium of penbritin (final concentration is 100 μ g/ml), centrifugal collection thalline is pressed alkaline lysis [Sambroook, et al., 1989, Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory, New York, p19-21] extract plasmid, identify through NcoI and SacI double digestion and pcr amplification correct, order-checking (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd).Sequencing result shows that the clip size that obtains that increases is 681bp, in the Genbank database, use Blast program (Basic local Alignment seatch tool) [Altschul SFet al by its amino acid sequence coded, 1997, Nucleic Acids Res.25:3389-3402] carry out the homology retrieval, result for retrieval shows that the homologous fragment the most similar to this fragment is Δ
12Fatty acid dehydrogenase, but and incomplete same, prove that institute's amplified fragments is the fragment of new potential dehydrogenase gene.
According to the partial sequence design gene-specific primer (primer 3 and primer 4) that is obtained, (Rapid Amplification of cDNA ends, RACE) acquisition comprises the 3` and the 5` end sequence of above-mentioned segmental gene to utilize the terminal amplification technique of cDNA.Extract cell total rna earlier, use SMRT
TMArticle one cDNA is synthesized in ACER cDNA Amplification Kit (Clontech company product) reverse transcription, with the joint primer that gene-specific primer and test kit provide, carry out the PCR of 3` and 5` end sequence respectively by pcr amplification test kit (Clontech company product).
Primer 3 (3`RACE): 5`-TGACCTGGGTATCTTGGCAC-3`, (SEQ ID NO:3)
Primer 4 (5`RACE): 5`-AACTTCTCCTTTGTGGCAGG-3` (SEQ ID NO:4)
Template cDNA 2.5 μ l, damping fluid (10 *) 5 μ l, dNTP (50 *) 1 μ l, primer 3 (10 μ mol/L) 1 μ l, primer 4 (10 μ mol/L) 1 μ l, Advantage2 Polymeerase Mix 1 μ l, H2O 34.5 μ l amplification conditions: 95 ℃ of sex change 2min of elder generation enter 95 ℃ of 30sec; 68 ℃ of 3min carry out 30 circulations altogether.Pcr amplification product adopts above-mentioned identical method to identify, check order.Be total to the sequence information of 531bp before The sequencing results demonstration 3`RACE amplification obtains from primer 3 sequences to polyA, and 5`RACE obtains from primer 4 sequences to the sequence information that is total to 641bp the end fitting sequence.With sequence analysis software (DNAMAN Version4.0, Lynnon BioSoft) three fragments is spliced and analyze, obtain the nucleotide sequence shown in SEQ ID NO:1, wherein 85bp-1347bp (ATG----TAG) is the potential open reading frame, 420 amino acid of encoding.Both sides are respectively non-district (84bp) and the non-district (47bp) that translates of 3` of translating of 5`.According to two end sequences, design gene-specific primer (primer 5 and primer 6) press 3` and 5`RACE condition pcr amplification, order-checking, the result with to splice the result consistent.
Primer 5:5`-AGGAGATTACTGTTAATAAAAGTAGGGTAC-3` (SEQ ID NO:5);
Primer 6:5`-AAAATTTAAACATAACTTAATCTAC-3` (SEQ ID NO:6);
Embodiment 2: the homology search of institute's separating nucleotide sequence
To infer Δ
12The aminoacid sequence of-fatty acid dehydrogenase carries out the homology search on Genbank, gained homologous sequence major part is a coded delta
12The sequence of-fatty acid dehydrogenase, the minority coded delta
15The sequence of-fatty acid dehydrogenase and other desaturase and other enzyme, wherein with come Ke Shi yeast (Saccharomyces kluyveri) homology the highest: homogeny 64%, (accompanying drawing 2, accompanying drawing 2 shows pichia spp Δ of the present invention
12-fatty acid dehydrogenase and Ke Shi yeast (Saccharomyces kluyveri) Δ
12The amino acid sequence homology comparison diagram of-fatty acid dehydrogenase (AB115968.1), PPD12: pichia spp Δ of the present invention
12-fatty acid dehydrogenase, SKD12: come Ke Shi yeast Δ
12-fatty acid dehydrogenase.(identical amino acid is represented with monocase amino acid between two sequences).This illustrates that the new coded enzyme of nucleotide sequence of the present invention has potential Δ
12The function of-fatty acid dehydrogenase.
Embodiment 3: the structure of yeast saccharomyces cerevisiae recombinant expression vector
According to coding region sequence shown in the SEQ ID NO:1, design a pair of gene specific amplimer (primer 7 and primer 8) and separate its potential open reading frame sequence:
Primer 7:5-CC
GGACCATGTCTGCCGTCACAGTTACAG G-3` (SEQ ID NO:7);
Primer 8:5`-GGCT
TCTAGACTATTTCTCACCGGTTC-3` (SEQ ID NO:8);
The 5` end black matrix of these two primers contains BamH I and Xba I restriction enzyme site respectively.Used amplification condition is identical with 5`RACE with 3` with reactive component, and the sequencing result of amplified production shows consistent with the sequence of 85bp-1347bp shown in the SEQ ID NO:1.Get 50 μ l PCR products then and 1 μ l pYES2.0 carries out double digestion respectively, reclaim enzyme and cut big fragment, and with the T4 ligase enzyme in 4 degree refrigerator overnight connections.Connect product transformed into escherichia coli DH5 α, extract and the PCR screening positive clone by plasmid, and the evaluation of checking order.Plasmid construction the results are shown in accompanying drawing 3, the constructed Δ that contains
12The yeast expression called after pYPPD12 of-fatty acid dehydrogenase gene.This plasmid is to be made up by the PCR product of pYES2.0 (Invitrogen company) and primer 7 and primer 8 to form.Plasmid and respectively behind BamH I and Xba I double digestion, electrophoresis reclaims purifying, connects through T4DNA Ligase, connects product transformed into escherichia coli DH5 α, the Screening and Identification matter example that goes out to recombinate, called after pYPPD12.
Embodiment 4: recombinant expression vector transformed saccharomyces cerevisiae cell
The single bacterium colony of picking Wine brewing yeast strain INVSc1 in 10ml YEPD liquid nutrient medium, 30 ℃ of shaking table incubated overnight, detect the OD of bacterium liquid
600Value is got an amount of bacterium liquid and is diluted in 50ml, makes OD
600Be 0.4; Continue to cultivate 2 behind 4h, the 2500rpm centrifugation cell, with the resuspended thalline of 40ml 1 * TE, the 2500rpm centrifugation cell with 2ml1 * LiAc/0.5 * TE suspension cell, and is at room temperature placed 10min, and this cell is competent cell; Get the yeast competent cell that 100 μ l prepare, add 1 μ g recombinant plasmid pYPPD12 and 100 μ g sex change salmon sperm DNAs, mixing adds 700 μ l, 1 * LiAc/40%PEG-4000/1 * TE and mixing, in 30 ℃ of incubation 30min; Then, add 88 μ l DMSO mixings, heat shock 7min in 42 ℃ of water-baths; Centrifugal 10s sedimentation cell adds 1ml 1 * TE suspension cell and recentrifuge sedimentation cell, adds 100 μ l re-suspended cells at last, is laid on SC-Ura (no uridylic) entirely and selects culture medium flat plate, puts 30 ℃ and cultivates 48-72h.
Embodiment 5: the abduction delivering of Yeast engineering bacteria
The positive that picking SC-Ura (no uridylic) selects to occur on the culture medium flat plate transforms, be inoculated in 15ml SC-Ura and select substratum (containing 2% glucose), 28 ℃ are shaken the bacterium incubated overnight, inoculum size with 5% adds the 100ml SC-Ura substratum that contains 2% semi-lactosi, and 28 ℃ are continued to cultivate 72h; 2500rpm collects thalline, uses deionized water wash three times, and 50 ℃ of oven dry grind, and get the KOH-CH that 100mg adds 5ml 5%
3OH solution, 70 ℃ of reaction 2-3h; Reaction finishes, and cool to room temperature is with the pH value to 2.0 of the hydrochloric acid conditioning solution of 6mol/L, adding 4ml 14%BF
3-CH
3OH, 70 ℃ of reaction 1.5h, synthesizing fatty acid methyl ester; Add saturated NaCl solution 10ml again, the concuss mixing, and transfer in the separating funnel, use 1: 4 chloroform of 8ml: hexane extracting twice, united extraction liquid; Add an amount of anhydrous Na
2SO
4Dry extraction liquid leaves standstill 1h, removes Na
2SO
4, the supernatant liquor that contains fatty acid methyl ester is dried up with nitrogen, return molten sample with the normal hexane of 200 μ L, the back is with the filtering with microporous membrane of 0.45mm.
Embodiment 6: the lipid acid gas chromatographic analysis
Undertaken by following condition:
Instrument is Tianjin, island GC-7A, pillar: fused-silica capillary column, 0.32 * 30m, solid support: Dienthyeneglycol succinate (Poly-diethylene glycol succinate, DEGS) plated film thing: polyimide.Carrier gas: N
2, linear speed: 10cm/s.Splitting ratio: 100: 1, the vaporizer temperature: 250 ℃, column temperature: 180 ℃, tail blew: 50ml/min, detector: flame ionization ditector.The LA methyl esters of producing with Sigma company is standard substance, the sample of the methyl esterification of fatty acid of method for preparing, carries out GC and analyzes, and applied sample amount is 1 μ l; Analysis software: Anstar, the star color spectrum workstation of analysis.
Stratographic analysis the results are shown in accompanying drawing 4, and accompanying drawing 4 shows linolic acid methyl ester standard substances (4A), contain the transgenic yeast (4B) of pYES2.0 empty carrier and contain the gas chromatogram of the transgenic yeast (4C) of recombinant plasmid pYPPD12.Compare by retention time and to identify each peak with known fatty acid methyl ester standard substance.Retention time is that the peak of 14.09min correspondence is the pichia spp Δ among Fig. 4 C
12The linolic acid that-fatty acid dehydrogenase catalysis oleic acid produces.
Sequence list
SEQUENCE?LISTING
<110〉Nankai University
<120〉nucleotide sequence and the application thereof of pichia spp Δ 12-fatty acid dehydrogenase
<130>20041210
<160>8
<170>PatentIn?version?3.1
<210>1
<211>1394
<212>DNA
<213〉pichia spp (Pichia Pastoris)
<400>1
aggagattac?tgttaataaa?agtagggtac?tcttttgtgt?gatactactt?agagagctgt 60
gcatttcaac?ccaccaattc?cacaatgtct?gccgtcacag?ttacaggtaa?taatggtgat 120
gcttcaagaa?gtaacaccac?caccaccaca?aaacgtacag?gcaatgtttc?ctccttcagc 180
caatccaaag?gtttgactgc?catagacacc?tggggtaacg?tcttcaaagt?ccctgatttt 240
acaatcaagc?aaatcttgga?tgctattcca?aagcactgct?atgaacgcag?gctaaccacg 300
tcgttctact?acgtgttcag?ggacatattc?ctcattggtt?gtaccatgtt?catggggtcg 360
ttcattccca?tgattgagaa?tgttttcctt?agaggcgctg?cttacgccgc?tttggttttt 420
ctcttatctg?ttgagtacac?tggtttgtgg?gttttggccc?acgagtgcgg?tcatcaagct 480
ttctccgatt?atggttgggt?caacgacacc?gtgggatgga?ttttgcattc?ttacctgtta 540
gtcccatatt?tttcttggaa?atacagtcat?ggtaaacatc?acaaggctac?tggccacttg 600
actagagaca?tggtgtttgt?acctgccaca?aaggagaagt?tcttggaaaa?gagaaacgcc 660
agcaaacttg?gcgaactggg?agaagatgct?cccattttca?cattatatca?gttggtagcc 720
caacaattgg?gaggctggat?tttgtatttg?ttcaccaacg?ttactggtca?accctacccc 780
aacaccccta?aatggatgca?gaaccacttt?gttccctcat?ctccaatttt?cgaaaaaaag 840
gactactggt?ttatcattct?gagtgacctg?ggtatcttgg?cacagttgat?ggttttgtat 900
gtgtggagac?aacaaatggg?aaactggaac?ttatttattt?actggttcct?gccttatgtt 960
ctcaccaacc?attggctggt?gttcatcaca?ttcctgcaac?actctgatcc?aacgatgcct 1020
cactacgagg?ctgaacaatg?gacgtttgcc?agaggagctg?ccgcaaccat?cgaccgtgaa 1080
tttggattca?ttggaccttt?cttctttcac?gatatcatcg?aaactcacgt?cttgcatcac 1140
tatgtgagta?gaattccttt?ctacaacgcc?cgagaggcca?gtgaaggtat?taagaaagtt 1200
atgggggagc?attatcgcta?cagtggtgaa?aacatgtggg?tctctctttg?gaagagtgga 1260
cgttcatgtc?agtttgttga?tggagaaaac?ggggtgaaaa?tgtaccgtaa?catcaataac 1320
tggggtattg?gaaccggtga?gaaataggat?tcatctgaaa?tagagtagag?tagattaagt 1380
tatgtttaaa?tttt 1394
<210>2
<211>420
<212>PRT
<213〉pichia spp (Pichia pastoris)
<400>2
Met?Ser?Ala?Val?Thr?Val?Thr?Gly?Asn?Asn?Gly?Asp?Ala?Ser?Arg?Ser
1 5 10 15
Asn?Thr?Thr?Thr?Thr?Thr?Lys?Arg?Thr?Gly?Asn?Val?Ser?Ser?Phe?Ser
20 25 30
Gln?Ser?Lys?Gly?Leu?Thr?Ala?Ile?Asp?Thr?Trp?Gly?Asn?Val?Phe?Lys
35 40 45
Val?Pro?Asp?Phe?Thr?Ile?Lys?Gln?Ile?Leu?Asp?Ala?Ile?Pro?Lys?His
50 55 60
Cys?Tyr?Glu?Arg?Arg?Leu?Thr?Thr?Ser?Phe?Tyr?Tyr?Val?Phe?Arg?Asp
65 70 75 80
Ile?Phe?Leu?Ile?Gly?Cys?Thr?Met?Phe?Met?Gly?Ser?Phe?Ile?Pro?Met
85 90 95
Ile?Glu?Asn?Val?Phe?Leu?Arg?Gly?Ala?Ala?Tyr?Ala?Ala?Leu?Val?Phe
100 105 110
Leu?Leu?Ser?Val?Glu?Tyr?Thr?Gly?Leu?Trp?Val?Leu?Ala?His?Glu?Cys
115 120 125
Gly?His?Gln?Ala?Phe?Ser?Asp?Tyr?Gly?Trp?Val?Asn?Asp?Thr?Val?Gly
130 135 140
Trp?Ile?Leu?His?Ser?Tyr?Leu?Leu?Val?Pro?Tyr?Phe?Ser?Trp?Lys?Tyr
145 150 155 160
Ser?His?Gly?Lys?His?His?Lys?Ala?Thr?Gly?His?Leu?Thr?Arg?Asp?Met
165 170 175
Val?Phe?Val?Pro?Ala?Thr?Lys?Glu?Lys?Phe?Leu?Glu?Lys?Arg?Asn?Ala
180 185 190
Ser?Lys?Leu?Gly?Glu?Leu?Gly?Glu?Asp?Ala?Pro?Ile?Phe?Thr?Leu?Tyr
195 200 205
Gln?Leu?Val?Ala?Gln?Gln?Leu?Gly?Gly?Trp?Ile?Leu?Try?Leu?Phe?Thr
210 215 220
Asn?Val?Thr?Gly?Gln?Pro?Tyr?Pro?Asn?Thr?Pro?Lys?Trp?Met?Gln?Asn
225 230 235 240
His?Phe?Val?Pro?Ser?Ser?Pro?Ile?Phe?Glu?Lys?Lys?Asp?Tyr?Trp?Phe
245 250 255
Ile?Ile?Leu?Ser?Asp?Leu?Gly?Ile?Leu?Ala?Gln?Leu?Met?Val?Leu?Tyr
260 265 270
Val?Trp?Arg?Gln?Gln?Met?Gly?Asn?Trp?Asn?Leu?Phe?Ile?Tyr?Trp?Phe
275 280 285
Leu?Pro?Tyr?Val?Leu?Thr?Asn?His?Trp?Leu?Val?Phe?Ile?Thr?Phe?Leu
290 295 300
Gln?His?Ser?Asp?Pro?Thr?Met?Pro?His?Tyr?Glu?Ala?Glu?Gln?Trp?Thr
305 310 315 320
Phe?Ala?Arg?Gly?Ala?Ala?Ala?Thr?Ile?Asp?Arg?Glu?Phe?Gly?Phe?Ile
325 330 335
Gly?Pro?Phe?Phe?Phe?His?Asp?Ile?Ile?Glu?Thr?His?Val?Leu?His?His
340 345 350
Tyr?Val?Ser?Arg?Ile?Pro?Phe?Tyr?Asn?Ala?Arg?Glu?Ala?Ser?Glu?Gly
355 360 365
Ile?Lys?Lys?Val?Met?Gly?Glu?His?Tyr?Arg?Tyr?Ser?Gly?Glu?Asn?Met
370 375 380
Trp?Val?Ser?Leu?Trp?Lys?Ser?Gly?Arg?Ser?Cys?Gln?Phe?Val?Asp?Gly
385 390 395 400
Glu?Asn?Gly?Val?Lys?Met?Tyr?Arg?Asn?Ile?Asn?Asn?Trp?Gly?Ile?Gly
405 410 415
Thr?Gly?Glu?Lys
420
<210>3
<211>20
<212>DNA
<213〉pichia spp (Pichia Pastoris)
<400>3
tgacctgggt?atcttggcac 20
<210>4
<211>20
<212>DNA
<213〉pichia spp (Pichia pastoris)
<400>4
aacttctcct?ttgtggcagg 20
<210>5
<211>30
<212>DNA
<213〉pichia spp (Pichia pastoris)
<400>5
aggagattac?tgttaataaa?agtagggtac 30
<210>6
<211>25
<212>DNA
<213〉pichia spp (Pichia pastoris)
<400>6
aaaatttaaa?cataacttaa?tctac 25
<210>7
<211>30
<212>DNA
<213〉pichia spp (Pichia pastoris)
<400>7
ccggaccatg?tctgccgtca?cagttacagg 30
<210>8
<211>27
<212>DNA
<213〉pichia spp (Pichia pastoris)
<400>8
ggcttctaga?ctatttctca?ccggttc 27
Claims (10)
1, a kind of isolating pichia spp Δ
12The nucleotide sequence of-fatty acid dehydrogenase is characterized in that it is to be selected from:
(a) coding has the nucleotide sequence of the aminoacid sequence polypeptide shown in the SEQ ID NO:2;
(b) with (a) described in nucleotide sequence complementary nucleotide sequence.
2,, it is characterized in that it is to have the nucleotide sequence shown in the SEQ ID NO:1 according to the described nucleotide sequence of claim 1.
3,, it is characterized in that described nucleotide sequence is the nucleotide sequence that has the nucleotide sequence of 85-1347bp or have 1-1394bp according to the described nucleotide sequence of claim 2.
4, a peptide species is characterized in that it is the polypeptide with the aminoacid sequence shown in the SEQ ID NO:2.
5, a kind of recombinant expression vector is characterized in that it is by the described nucleotide sequence of claim 1 and plasmid, virus or the constructed recombinant expression vector of other expression vector.
6,, it is characterized in that it is pYPPD12 according to the described recombinant expression vector of claim 5.
7, a kind of genetically engineered host cell is characterized in that it is to be selected from:
(a) host cell that transforms or transduce with the described nucleotide sequence of claim 1;
(b) host cell that transforms or transduce with the described recombinant expression vector of claim 5.
8, according to the described host cell of claim 7, it is characterized in that described host cell is bacterial cell, fungal cell, vegetable cell or zooblast, or the offspring of these host cells.
9,, it is characterized in that described host cell is a brewing yeast cell according to the described host cell of claim 7.
10, the described pichia spp Δ of claim 1
12The nucleotide sequence of-fatty acid dehydrogenase is used to produce the application of unsaturated fatty acids.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB2004100939976A CN1269961C (en) | 2004-12-22 | 2004-12-22 | Nucleotide sequence of pichia delta12-fatty acid dehydrogenase and its use |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB2004100939976A CN1269961C (en) | 2004-12-22 | 2004-12-22 | Nucleotide sequence of pichia delta12-fatty acid dehydrogenase and its use |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1644698A CN1644698A (en) | 2005-07-27 |
CN1269961C true CN1269961C (en) | 2006-08-16 |
Family
ID=34869441
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB2004100939976A Expired - Fee Related CN1269961C (en) | 2004-12-22 | 2004-12-22 | Nucleotide sequence of pichia delta12-fatty acid dehydrogenase and its use |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1269961C (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101024840B (en) * | 2007-01-29 | 2010-09-01 | 南开大学 | Nucleotide series of Pichia yeast delta9 fatty acid dehydro genase and use |
CN103525841B (en) * | 2013-10-21 | 2015-04-22 | 昆明理工大学 | Delta<12>-fatty acid desaturases gene and recombinant expression vector thereof |
CN103525842B (en) * | 2013-10-21 | 2015-03-11 | 昆明理工大学 | Delta<12>-fatty acid desaturases gene and recombinant expression vector thereof |
-
2004
- 2004-12-22 CN CNB2004100939976A patent/CN1269961C/en not_active Expired - Fee Related
Also Published As
Publication number | Publication date |
---|---|
CN1644698A (en) | 2005-07-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1816630A (en) | Delta-12 desaturase gene suitable for altering levels of polyunsaturated fatty acids in oleaginous yeasts | |
CN1871353A (en) | Fatty acid desaturases from primula | |
CN1263857C (en) | Rhizopus arrhizus delta[12]-fatty acid dehydrogenase nucleic acid sequence and its uses | |
CN1788087A (en) | Alcohol dehydrogenase gene of acetic acid bacterium | |
CN1269961C (en) | Nucleotide sequence of pichia delta12-fatty acid dehydrogenase and its use | |
CN1286977C (en) | Nucleotide sequence of delta 6 fatty acid dehydrogenase separated from Thamnidiumelegans and application thereof | |
CN1195060C (en) | Nucleotide series of shaogengen mould delta-6 fatty acid dehydrogenase and its use | |
CN1289665C (en) | Recombined aspergillus oryzae tannase and its expression and purification | |
CN1904051A (en) | Salt algae NADP glyceral dehyde-3-phosdehydrogenase gene clone and protein expression method | |
CN101024840B (en) | Nucleotide series of Pichia yeast delta9 fatty acid dehydro genase and use | |
CN1517436A (en) | Oxide-reductase | |
CN1924019A (en) | Nucleotide sequence of Pichia pastoris omega3-fatty acid dehydrogenase and application thereof | |
CN103525842A (en) | Delta<12>-fatty acid desaturases gene and recombinant expression vector thereof | |
CN1578831A (en) | Fungal micro-organism having an increased ability to carry out biotechnological process(es) | |
CN100347294C (en) | Thermostabilized trehasynthetase, coding gene and use thereof | |
CN1800349A (en) | Synthesis of polyhydroxyalkanoates in the cytosol of yeast | |
CN103834672A (en) | Delta12-fatty acid dehydrogenase gene and application of gene | |
CN1730661A (en) | Improve the method for geldanamycin fermentation yield by the blocking-up negative regulator gene | |
CN103525841A (en) | Delta<12>-fatty acid desaturases gene and recombinant expression vector thereof | |
CN101024839A (en) | Nucle tide series of rhizopus arrhizus delta9 and use thereof | |
CN1281962C (en) | Tumor relevant secretory protein as a liver cancer marker and uses thereof | |
CN1621523A (en) | Adenosine phosphate-ribosylation-factor 1 gene in cotton and its promoter | |
CN1670197A (en) | Arginase of Japanese blood fluke, its coding nucleic acid and application | |
CN1621518A (en) | L-sorbosone dehydrogenase, gene encoding same and use thereof | |
CN100341891C (en) | Tanscription activating factor genes of candida albicans and their use |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C19 | Lapse of patent right due to non-payment of the annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |