CN1239103A - Process for preparing recombined human serum albumin - Google Patents

Abstract

The present invention relates to a process for producing human serum albumin by recombinant DNA technique, especially to the synthetic human serum albumin gene composed of yeast biased sex codons and modified properly, the recombinant expression vector, the yeast host cells carrying the recombinant expression vector of said gene and obtained by transforming said vector, and the process for producing human serum albumin with said yeast host, expecially the methyl nutritive yeast host in secretory mode.

Description

The production method of recombination human serum albumin

The present invention relates to produce the method for human serum albumin with recombinant DNA technology, particularly relate to synthetic and human serum albumin gene through suitably modify molecular by yeast bias password, carry the recombinant expression vector of said gene and the yeast host cell that transforms with said carrier, and by said yeast host, but the methylotrophic yeast host method of producing human serum albumin with secreted form particularly.

Human serum albumin (HSA) is the main composition protein of human plasma, and its content accounts for more than 50% of blood plasma gross protein.Under people's normal physiological conditions, the Plasbumin-25 has the effect of keeping plasma colloid osmotic pressure, nutrition and promotion wound healing, and it is as carrier substance, participates in many hydrophobicity biomolecules such as the transportations in blood such as hormone, biological active agents and medicine.These important physiologic functions based on human serum albumin, this protein has crucial treatment using value clinically, can be used for treating and variously lose or the synthetic disease that is reduced to one of essential characteristic of albumin with plasma albumin, for example treat in various wounds, burn, the surgical procedures or after the operation and lose blood, and many chronic wasting diseases.

Up to now, HSA that uses clinically and related preparations mainly are to be the source with blood donor's blood or placenta tissue, prepare through extracting with separating.Use the main drawback of the HSA of natural extract to be, be subjected to the restriction of the limited supply of blood on the one hand, promptly limited blood source is difficult to satisfy the needs of mass production HSA and its correlated product; On the other hand, improper owing to the blood donor is selected, usually may cause the blood source to pollute, for example, hepatitis virus, even the pollution of HIV (human immunodeficiency virus).Therefore, people are attempting to set up commercialization production HSA alternative always.Along with the progress of recombinant DNA technology, have at present and may produce HSA in enormous quantities with this technology.

People (Proc.Natl.Acad.Sci.USA79:71, (1982)) such as people such as Lawn (Nucleic Acids Research9:6105, (1981)) and Dugaiczyk have separated the gene of coding human serum albumin respectively and have measured its nucleotide sequence.According to the HSA aminoacid sequence that measured nucleotide sequence is inferred, sophisticated HSA is made up of 585 amino acid, about 66000 dalton of molecular weight, and iso-electric point is the strand non-glycosylated protein matter of Ip4.7.When this protein produces at first be before the form of crude protein exist, in by the emiocytosis and the course of processing, remove signal peptide and preceding former sequence respectively, obtain sophisticated HSA molecule.Sophisticated HSA molecule ovalize three-D space structure, and contain a plurality of disulfide linkage.Obtain the dna encoding sequence of HSA in separation after, many researchists attempt to utilize the HSA that relative higher degree is arranged with the recombinant DNA technology production in enormous quantities in the various expression system.For example, Barns has described the mRNA that separates HSA from the normal liver cell, and use this mRNA as template, by the full-length cDNA (referring to european patent application 0206733) of HSA before ThermoScript II, Klenow fragment and the SI nuclease composite coding, and the plasmid that carries this cCDA and the expression in intestinal bacteria thereof have been described.Yet, because the molecular weight of human serum albumin is bigger, the configuration complexity is so use prokaryotic organism intestinal bacteria (Latta, M.etal., Bio/Technology, 5:1309-1314, (1987)) and withered grass bud pole bacterium (Saunders, C.W.et al, J.Bacteriol.169:2917-2925, (1987)) etc. prokaryotic expression system be difficult to obtain the expression product of correct folding.In addition, owing to often have thalline intracellular toxin and other protein pollutants that is difficult to remove, so also be difficult to obtain being suitable for HSA product with heavy dose of clinical application at the secreting, expressing product.

Use mammalian cell such as Chinese hamster ovary celI, COS cell and insect cell expression system, though can produce the protein of correct sterie configuration, but the nutritional condition of cultivating these cells is had relatively high expectations, its generation time is long more than microorganism, so that must reach sufficiently high cell concn through cultivating one's ability for a long time, and also be difficult to generally speaking these cells are carried out necessary improvement.Therefore, consider that it is unfavorable using these most eukaryotes to produce HSA from economic angle.

Because all most eukaryotes all have the mechanism of expressing genetic information, so be expected can be than more effectively express eukaryotic gene in prokaryotic organism body (for example intestinal bacteria) in eucaryon host.In recent years, the lower eukaryotes body is used in some laboratories, and particularly the yeast expression human serum albumin has been obtained breakthrough.For example european patent application 0344459 has been described and has been made up the plasmid that contains transcriptional units, this is carried the plasmid that is in the following HSA gene of AOXI promotor control import suitable host, particularly the AOX1 gene regions of Pichia pastoris yeast strain (GTS115) is to obtain the transformant cell, in the substratum that contains proper concn (0.1-5%) first ferment, cultivate this transformant cell then, obtain with methyl alcohol being the mutants which had of sole carbon source and producing HSA in the substratum secretion.Someone has carried out a series of comparative experimentss to physico-chemical property, space structure and pharmacological characteristics and the natural HSA of the reorganization HSA that Pichia anomala expression produces, the result show that both are almost completely identical (referring to KazuoIKegayc, Anal, Chem, 69:1986-1991, (1997)).In addition, european patent application 0339455,0123544,0248637 and 0251744 also discloses sero-abluminous method of yeast host expressing human and the corresponding product purification method utilized respectively.Therefore, these achievements in research make people utilize recombinant DNA technology to become possibility with high yield production high purity HSA.

In order further to improve the expression productive rate of HSA in yeast cell, some laboratories are also to signal peptide, the promoter sequence of HSA, and the shellfish number etc. examined of HSA gene has carried out a series of further investigations.For example, european patent application 0329127 and 0319641 discloses synthetic HSA signal peptide nucleotide coding sequence respectively.These signal peptide nucleotide coding sequences are connected between the dna sequence dna of former HSA before promotor (for example AOX1, AOX2 or GAL1,10) sequence and the coding, yeast host is expressed and the ability of secretion HSA to improve.European patent application 0506040 discloses in natural A OX2 promotor base sequence and has caused excalation or replacement, or adds the resulting mutant AOX2 of new base sequence promotor therein.

On the other hand, when effort improved yeast cell or other host systems expression effectiveness, also the purification process of the HSA that produces with regard to recombinating had emphatically carried out in depth studying.For example, aspect cultivation HSA production bacterium, also disclose and in substratum, added lipid acid (european patent application 0504823), glucose (the open JP-A219561/1989 of Japanese Patent), Histidine (United States Patent (USP) 5612197) to improve growth velocity of producing bacterium and the method for improving the HSA productive rate; In the presence of acetyltryptophan (1-100mM) or other carboxylate salts, heating (50-70 ℃) is handled and is contained the method (United States Patent (USP) 5132404) of the culture supernatant of HSA with purifying HSA; Unite and use ultrafiltration, heat treated, acid treatment and ultrafiltration, and then handle, and obtain the method (United States Patent (USP) 5440018) of pure HSA through saltouing with cationite, hydrophobic chromatography carrier and anionite.In addition, the recombinant host cell of culture expression HSA in the presence of aminated compounds is disclosed also, the method (United States Patent (USP) 5369020) that generates with the color that suppresses reorganization HSA (rHSA) product; And with reductive agent (as sulfhydryl compound), or remove free polysaccharide with cationite, and then through thermal treatment so that the method (european patent application 0658569) of rHSA decolouring.

As previously mentioned, yeast cell to express system, particularly methylotrophic yeast expression system are the preferred expression systems that is used for fermentative production HSA in enormous quantities.Although done many-sided improvement at the structure of recombinant vectors, the modification of controlling element that is used for genetic expression and culture condition of recombinant cell etc. in the prior art, but that does not see as yet so far relevantly carries out necessary modification to the HSA encoding sequence, by changing the report of HSA gene structure with its expression efficiency and level in methylotrophic yeast of further raising.

Therefore, an object of the present invention is to provide nucleotide sequence and the function equivalent thereof of forming by yeast bias codon basically and passing through the synthetic coding human serum albumin of suitably modifying.

This purpose preferred embodiment according to the present invention wherein comprises the transcription termination sequence of intron splice site to the HSA encoding sequence, non-transcribed terminator, the modification of long tumor-necrosis factor glycoproteins, internal promoter sequence and ribosome bind site to said modification.

This purpose preferred version according to the present invention, the HSA encoding sequence of wherein saying is through synthesizing three groups of each 8 nucleotide chains respectively, be spliced into three nucleotide fragments with synthetic technology then based on polymerase chain reaction, again through the clone with correct indivedual base mistakes after be one another in series to be connected and obtain.

This purpose preferred version according to the present invention, wherein said HSA encoding sequence have the nucleotide sequence shown in Figure 1A (SEQ ID NO1).

Another object of the present invention provides the recombinant expression vector that comprises above-mentioned HSA encoding sequence.

This purpose preferred version according to the present invention, wherein said recombinant expression vector comprises the promoter region of one or more methyl alcohol reactive groups by (1) methylotrophy yeast, (2) nucleotide sequence of preceding former sequence of coding cereuisiae fermentum α mating factor (AMF) and coding HSA, (3) the active transcription terminator of function is arranged in methylotrophic yeast, and (4) but expression cassette that at least one selected marker gene and bacterium replication origin are formed.

A further object of the present invention provides the methylotrophic yeast cell with the recombinant expression vector conversion of the above-mentioned HSA of carrying encoding sequence.

This purpose preferred embodiment according to the present invention, wherein said methylotrophic yeast is the pichia pastoris phaff cell.

This purpose preferred version according to the present invention, wherein said yeast cell can be to have Mut ⁺Or Mut ^-Phenotype.

A further object of the present invention provides the method for producing human serum albumin with recombinant DNA technology, this method is included in to be suitable for expressing cultivates the yeast host cell of the nucleotide sequence that comprises the human serum albumin of encoding of preparation as stated above under the required proteinic condition, reclaim and the required human serum albumin of purifying from culture then.

A further object of the present invention provides production as stated above, has the human serum albumin of aminoacid sequence shown in the SEQ IDNo:2 basically.

Figure 1A show synthetic coding overall length human serum albumin nucleotide sequence and by deduction

The aminoacid sequence of human serum albumin;

Figure 1B shows single in the human serum albumin of overall length shown in Figure 1A nucleotide coding sequence

The endonuclease restriction enzyme site:

The synthesis strategy of the nucleotide sequence of Fig. 2 code displaying human serum albumin;

Fig. 3 show the segmental nucleotide sequences of HSA-I (up) and by deduction aminoacid sequence (down

OK);

Fig. 4 shows the structure of recombinant plasmid pBKS/HSA-I;

Fig. 5 shows segmental nucleotide sequence of HSA-II (up) and the aminoacid sequence of inferring thus

(descending);

Fig. 6 shows the structure of recombinant plasmid pBKS/HSA-II;

Fig. 7 show the segmental nucleotide sequence of HSA-III (up) and by the amino acid preface of deduction

Row (descending);

Fig. 8 shows the structure of recombinant plasmid pBKS/HSA-III;

Fig. 9 shows the structure of recombinant expression vector pBKS/HSA;

Figure 10 shows the structure of recombinant expression vector pPIC9/HSA;

Figure 11 shows the joining region sequence that the HSA nucleotide coding sequence is connected with expression vector pPIC9;

Figure 12 shows HSA-I, HSA-II, HSA-III fragment and overall length HSA dna fragmentation

1% agarose gel electrophoretogram;

Figure 13 shows the time that synthetic HSA gene expresses in pichia pastoris phaff bacterial strain GS115

Between process, wherein swimming lane 1-8 is presented at respectively and cultivates pichia spp and transform somatic

Add in the substratum methanol induction HSA express back 0,24,24,48,72,96,

120 and 148 hours collection culture supernatants also carry out on 10% polyacrylamide gel

The result who analyzes;

Figure 14 shows the result of the immunoblotting assay that the HSA expression product is done, wherein each swimming lane

The application of sample material is respectively A: natural HSA; B: the GS115 that does not carry recombinant plasmid

The culture supernatant of yeast cell; C: with the GS115 yeast of pPIC9/HSA conversion

The culture supernatant of cell.

Just produce heterologous protein with the DNA recombinant technique, particularly in and the molecule high to purity requirement Be rich in the human serum albumins of sulfydryl, one of the most outstanding advantage of yeast is that it can be to cultivation Secretion heterogenous protein product in the base. Therefore, use the yeast expression system can be with higher initial pure Degree obtains the product secreted, thereby can simplify purification step. Particularly for the HSA that is rich in sulfydryl , foundation can have to another of the yeast expression system of secreting, expressing product in the culture medium The reason that takes power is that the HSA product is easier to form to keep its accurately four-dimensional knot by disulfide bond Structure. The secretory pathway of cell and extracellular medium is the oxidation environment that can support that disulfide bond forms (Smith, et al., Science229:1219 (1985)). On the contrary, endochylema then is one and can not forms two The reducing environment of sulfide linkage. After the clasmatosis, too fast if disulfide bond forms, can cause at random disulfide bond Generation. Therefore, preferably be rich in the protein of disulfide bond by secretory pathway production, such as HSA.

In order to overcome some problem relevant with brewer's yeast, for example the plasmid selection marker lose and The problems such as plasmid distribution, copy number and stability under the high density fermentation condition, and then set up base In methylotrophic yeast, such as the yeast expression system of pichia pastoris phaff. A pass of this system The key feature is the alcohol oxidase-1 that its utilization is derived from the methyl alcohol adjusting of pichia pastoris phaff (AOX1) gene drives the expression of foreign gene (referring to european patent application as promoter 183071). Another feature of this expression system be can with expression cassette stable be incorporated into cell dyeing In the body, thereby reduce significantly the chance that carrier is lost.

Before the present invention, not only used the pichia pastoris phaff success production B-mode liver for example Scorching surface antigen (Cregg et al., Bio/Technology5:479 (1987)), lysozyme and invertase (Digan et al.Developmetsin Industrial Microbiology29:59 (1988); Tschopp et Al., Bio/Technology5:1305 (1987)), and EGF (international monopoly WO90/10697), and at methylotrophic yeast, particularly success in the pichia pastoris phaff Expressed human serum albumins (european patent application 0344459). Employed in the prior art The HSA gene order is based on basically separates before the people such as Lawn and the people such as Dugaiczyk and checks order The HSA gene order. Yet the inventor's early stage research is found, although the HSA gene is more suitable for Most eukaryotes is included in the yeast and expresses, but considers people's cell and lower eukaryotes body such as yeast Cell is the biosynthesis mechanism of structure and protein opening of codon usage frequency, genetic transcription for example Moving and transcribe the shearing of efficient, RNA and the aspects such as secretion of translation efficiency and translation product exists very Big-difference, thereby be necessary natural HSA gene is carried out some modification, make it to be more suitable at yeast be System particularly stably exists in the Pichia pastoris, and more effectively transcribes and translate.

In addition, some studies show that there is very big-difference in different organisms at codon usage frequency, Thereby directly efficient and expression are translated in impact. If heterologous gene is carried out suitable transformation, makes The codon of gene to be expressed is more suitable for the codon usage frequency in selected expression system, will Be conducive to improve the overall expression efficiency of foreign gene. People (the Bio/Technology such as Kerlak 8:939-42, (1990)) modify bacillus thuringiensis according to the codon usage frequency of dicotyledon (B.t) β endotoxin genes, and this genetic transformation expressed knot in dicotyledon such as cotton cells Tab phenolphthaleinum causes the expression of B.t endotoxin genes in cotton of this modification than natural B .t endotoxin genes Expression improve 50-100 doubly. On the contrary, the people such as Hoekeman restrains the phosphoglycerokinase gene Swell in Yeast expression carrier, and part yeast bias codon of its 5 ' end is got with rare codon In generation, the expression efficiency that the result makes it in yeast cells has reduced about 10 times.

The inventor has taken into full account impact and the natural HSA volume of codon usage frequency to gene expression The unfavorable factor that may exist of code sequence is modified comprehensively and has also again been synthesized the HSA gene. For this reason, At first according to the codon of the brewer's yeast identical with Pichia pastoris basically on codon usage frequency Frequency of utilization redesigns and has synthesized overall length human serum albumins nucleotide coding sequence. With the sky Right HSA gene order is compared, and 155 bases is arranged by other alkali in the gene order that the present invention synthesizes Base replaces, and therefore causes the change of 141 codons. The HSA gene that the present invention synthesizes Shown in the following tabulation 1 of codon usage frequency.

Table 1: the codon usage frequency of synthetic HSA gene

Codon	Amino acid	Frequency of utilization	Codon	Amino acid	Frequency of utilization	Codon	Amino acid	Frequency of utilization	Codon	Amino acid	Frequency of utilization
												TTT  TTC  TTA  TTG  CTT  CTC  CTA  CTG  ATT  ATC  ATA  ATG  GTT  GTC  GTA  GTG	phe  phe  leu  leu  leu  leu  leu  leu  ile  ile  ile  met  val  val  val  val	19     13     12     18     10     1     10     11     4     4     1     6     15     9     6     11	TCT  TCC  TCA  TCG  CCT  CCC  CCA  CCG  ACT  ACC  ACA  ACG  GCT  GCC  GCA  GCG	ser  ser  ser  ser  pro  pro  pro  pro  thr  thr  thr  thr  ala  ala  ala  ala	8     5     4     1     8     3     11     2     11     7     7     3     27     15     16     4	TAT  TAC  TAA  TAG  CAT  CAC  CAA  CAG  AAT  AAC  AAA  AAG  GAT  GAC  GAA  GAG	tyr  tyr  OCH  AMB  his  his  gln  gln  asn  asn  lys  lys  asp  asp  glu  glu	9  9  1  1  11  5  14  6  9  8  32  28  26  11  42  21	TGT  TGC  TGA  TGG  CGT  CGC  CGA  CGG  AGT  AGC  AGA  AGG  GGT  GGC  GGA  GGG	cys  cys  OPA  trp  arg  arg  arg  arg  ser  ser  arg  arg  gly  gly  gly  gly	22     13     -     1     3     1     2     1     5     2     14     5     9     2     3     -

For the ease of synthetic HSA gene of the present invention is connected to variant cloning vector or expression On the carrier, we add respectively two single restriction enzyme sites at its 5 ' and 3 ' end, and namely 5 ' end adds the BamH I With Xho I restriction enzyme site, 3 ' end adds EcoR I and Cla I restriction enzyme site, wherein BamH I and Cla I The point of contact is used for connecting cloning vector, and the Xho I is connected with the EcoR I and is used for connecting expression vector. In addition, for Guarantee effective utilization of restriction enzyme site, we hold at the 5 ' end and 3 ' of synthetic gene order respectively and add Enter 3 protectiveness bases (being respectively GGC and AGG). Moreover, for the ease of the HSA that will synthesize Gene is connected on the C end of signal peptide, has also added the amino acid sequence work at the N of this gene end Be signal peptide identification and cleavage site. As the necessary controlling element of HSA gene, its C end with The termination codon subsequence of a repetition is translated the correct termination of process so as to guaranteeing mRNA. Above-mentioned The HSA gene order total length that these modifications cause the present invention to synthesize is about 1797bp.

On the other hand, in order further to improve HSA gene that the present invention synthesizes at methylotrophy type ferment Expression efficiency among the mother, particularly pichia pastoris phaff, also following to the nucleotide sequence of gene Severally may and/or translate efficient and bring the sequence of adverse effect or other parts to carry out genetic transcription Necessary modification is changed, displacement or deletion.

1, introne montage sequence: eucaryote has gene transcript is carried out montage processing with shape Become not the ability with the mRNA of introne. Know that now the montage of introne is to be situated between by special sequence Lead, if there is corresponding splice site in the dna sequence dna, then such sequence can be turned at gene Be used as introne in the record process and from sequence, cut away, so that produce incomplete transcription product. Therefore, The design of gene and synthetic in, be necessary to check and get rid of such base sequence.

2, transcription terminator: have volume if stop the position at the inner non-transcribed of overall length gene order Outer transcription terminator, just might cause transcribing in advance or error ending so that cannot produce completely Whole mRNA. In yeast expression system, the known sequence relevant with tanscription termination comprises: (1) ATTATTTTAT; (2) TTTTTATA; (3) TAG ... (being rich in T) ... TA (T) GT ... (being rich in AT) ... TTT. Therefore, when designing and synthesizing the HSA gene, must get rid of These sequences are rich in the sequence of AT especially.

3, long repetitive sequence: repetitive sequence, particularly long repetitive sequence (comprise forward and reverse Repetitive sequence) might form strong secondary structure, thus be unfavorable for genetic transcription and translate smoothly Carry out, and cause difficulty might for the splicing of full-length gene. Therefore, in sequence, occur seven During the repetitive sequence of above base, need not change under its coded amino acid whose prerequisite by changing The codon that involves and get rid of it.

4, internal promoter sequence and ribosome bind site: the promoter sequence of not expecting the driving gene internal transcription process that exists may be contained in the inside of gene order, and these sequences might be disturbed the normal transcription of overall length gene, therefore must be removed.In addition, there is unnecessary ribosome bind site as fruit gene inside, the process of translating that also might promotor gene inside, so that produce incomplete protein expression product.Therefore, in synthetic HSA gene order of the present invention, TATA frame promoter sequence and GGAGG ribosome bind site have been got rid of.

In addition, for the ease of splicing pre-synthetic polynucleotide passage, and be convenient to the overall length gene order of series connection splicing also to be necessary several restriction enzyme sites of adding or joint sequence on the nucleotide position suitable in gene order in suitable restriction enzyme site place and other genetic transcriptions and/or translate the controlling element splicing or be inserted into easily in the expression vector of selection.Therefore, remove the BamH I and the Xho I restriction enzyme site of 5 ' end mentioned above, and outside 3 ' end EcoR I and the Cla I restriction enzyme site, also added Hind III and Pst I site (Figure 1B) respectively at nucleotide position 509 and 1109 places.

Therefore, first purpose of the present invention provides the nucleotide sequence by mentioned above principle synthetic coding human serum albumin.In order to obtain the overall length nucleotide sequence of the coding human serum albumin as shown in Figure 1A, synthesized 3 length of nucleotides and be respectively 612bp, 562bp and 705bp and name fragment respectively into HSA-I, HSA-II and HSA-III.Wherein each fragment is formed by connecting by 8 short oligonucleotide, and each segmental two ends has BamH I and the Cla I restriction enzyme site that is used for directly restraining at suitable cloning vector connection and clone respectively.

Can distinguish the chemosynthesis complementary strand of short oligonucleotide sequence relatively according to ordinary method well known by persons skilled in the art, and obtain corresponding double chain DNA molecule through the sex change after annealing.But, preferably adopt the synthetic HSA gene order of the present invention (referring to embodiment 1) of dna sequence dna synthetic method of the improved PCR-based technology of the inventor from economic and angle consideration easily.According to the method, overlapping complementary a district that keeps≤20 base pairs between two complementary strands promptly can be based on a template strand, the synthetic bifilar oligonucleotide sequence that reaches 120 bases.Like this, the dna fragmentation that reaches about 900bp that can correctly be connected through once splicing.

Because when utilizing each oligonucleotide chain of Oligo4.0 computer software design, fully analyzed the overlap sequence on adjacent two oligonucleotide chains, thereby effectively avoided hairpin structure and the formation of secondary structure by force in the said overlap, increased the specific intramolecule stability of overlap sequence.In general, can be by changing the indivedual bases in the overlap or causing the displacement of overall overlap to reach this purpose.

Fig. 2 diagram has shown the synthesis strategy of HSA nucleotide coding sequence of the present invention.Briefly, at first synthesize 3 and name the dna fragmentation (referring to Fig. 3,5 and 7) that is respectively 612bp, 362bp and 705bp for the length of HSA-I, HSA-II and HSA-III respectively.These fragments are formed by 8 oligonucleotide sequences separately.Then these three fragments are cloned into respectively and carry M13 phage DNA replication origin, ampicillin resistance gene and multiple clone site, and contain respectively in the pBKS plasmid vector of T3 and T7 phage promoter in the multiple clone site both sides, named 3 recombinant plasmids (referring to Fig. 4,6 and 8) respectively into pBKS/HSA-I, pBKS/HSA-II and pBKS/HSA-III.After from these plasmids, extracting DNA and measuring nucleotide sequence respectively, correct the mistake of indivedual bases with proper method by mentioned above principle.Behind each segmental base sequence to be determined, utilize predefined Hind III in each fragment two ends and Pst I restriction enzyme site that they are connected to and utilize among BamH I and the Cla I cutting linearizing plasmid pPKS in back, at T ₄Obtain recombinant plasmid pBKS/HSA (Fig. 9) under the effect of DNA enzyme behind the recirculation.Be transformed into repeatedly go down to posterity in the bacillus coli DH 5 alpha after, from the bacterial cell of propagation, extract DNA, and with the nucleotide sequences of double deoxidating chain termination measuring overall length HSA gene, the result shows that synthetic HSA of the present invention can stablize in the Bacillus coli cells that is retained in succeeding transfer culture and any series jump and/or disappearance do not take place.

Being used for expressing synthetic HSA expression carrier of the present invention can be to carry the expression regulation element that is suitable at the yeast expression alien gene, and any carrier that can particularly insert with high copy number in the methylotrophic yeast at yeast, for example pPIC9 (Invitrogen), pPIC3 (Invitrogen), pHIL-D2 (Invitrogen), yYJ32 (NRRL B-15891), pJDB207 (Amershan), pJDB219 (Amershan), PG4.0 (NRRL B-15868), be purpose of the present invention, pPIC9 preferably wherein.

The two enzymic digestions of for example available EcoR I and Xho I are cut into linearity with the pPIC9 plasmid, and with is connected with the HSA gene fragment that from pBKS/HSA, obtains behind the same double digestion, then with the suitable Bacillus coli cells of gained connection mixture conversion.After 37 ℃ of cultivations on the LB culture medium flat plate and screening the recombinant cell that is transformed, therefrom extract plasmid DNA and identify recombinant plasmid according to clip size.

Therefore, the invention further relates to the recombinant expression vector that contains an expression cassette at least, wherein said expression cassette contains following dna sequence dna successively on the frame direction of transcribing:

(ⅰ) promoter region of the methyl alcohol reactive group of methylotrophic yeast;

(ⅱ) dna sequence dna of preceding former sequence of coding cereuisiae fermentum α mating factor (AMF) and coding HSA peptide sequence, and

(ⅲ) the active transcription terminator of function is arranged in the methylotrophy yeast.

This dna fragmentation can be connected to the linear fragment that the dna sequence dna of enough homologys is arranged with target gene as flank, be transformed in methylotrophic yeast such as the pichia pastoris phaff, to realize the integration of said dna fragmentation in yeast chromosomal.In this case, integration is to realize by the suitable site and the yeast target gene group generation homologous recombination of the homologous sequence in the recombinant expression vector in yeast target gene group.Perhaps said dna fragmentation can be the part of circular plasmids, can be cut into linear to integrate helping, and can add this fragment in the homology site between host and plasmid sequence and then realize its integration in host genome.The linearizing of carrier will help the integration of foreign gene, and usually in the linearizing site is inserted host chromosome.

Be used to transform the expression cassette of methylotrophic yeast cell, except that containing reactive promotor of methylotrophic yeast methyl alcohol and HSA DNA sequences encoding (HSA gene), also contain coding and read the preceding former sequence cutting recognition site (being the Glu-Lys-Arg encoding sequence) of yard interior cereuisiae fermentum, and the Transcription Termination subsequence that can in methylotrophic yeast, bring into play function.

The preferred promoter district that is used to drive HSA genetic expression is derived from the methanol induction of pichia pastoris phaff or the alcohol oxidase of adjusting (AOX) gene.Known pichia pastoris phaff contains alcohol oxidase 1 (AOX1) and alcohol oxidase II (AOX II) gene.The encoding part of two AOX genes has very big homology on the amino acid sequence level of DNA and deduction, and has the common restriction enzyme site.By two gene promoter expressed protein similar zymologic property is arranged, but wherein the promotor of AOX1 gene is more effective.Therefore, for expressing the HSA purpose, preferably use AOX1 (Ellis etal., Mol.Cell.Biol.5:1111 (1985)).

Yeast α mating factor or title alpha factor are 13 the amino acid whose peptides that contain by the emiocytosis of " α " mating type.It acts on the cell of " a " mating type relatively, to promote the effective joint between two types the cell, thereby form " α-a " diploid cell (Thorner et al., The MolecularBiology of The Yeast Saccharomyces, Cold Spring Harbor Laboratory, ColdSpring Harbor, 143 (1981)).The preceding former sequence of AMF is included in the leader sequence in the AMF precursor and includes proteolysis processing and secrete required Glu-Lys-Arg encoding sequence.Former sequence (comprising the Leu-Lys-Arg encoding sequence) is the fragment of a 258bp before the AMF.

The expression cassette of expressing HSA according to the present invention in methylotrophic yeast also contains transcription terminator, it has the subfragment in coding polyadenylic acid signal and a polyadenylation site, and/or for from the initial subfragment that transcription termination signal is provided of transcribing of promotor.

Above-mentionedly be used for that HSA of the present invention expresses and the functional regulating and controlling sequence of excretory (nonstructural gene controlling element) generally all has been included in the present invention and is the selected expression vector pPIC9 (Invitrogen) of expression HSA purpose, and wherein the source of transcription terminator and promotor can be identical or different.

According to expression vector of the present invention, wherein also can comprise can be in methylotrophic yeast such as pichia pastoris phaff the selected marker gene of performance function.For this reason, said selected marker gene can be any methylotrophic yeast such as saccharomyces pastorianus given with certain phenotype, thereby identified them and make it to obtain not by the gene of the energy for growth that cell transformed did not have.For example, the appropriate selection marker gene comprises the selection marker system that is made up of auxotrophic mutation body pichia pastoris phaff host strain and the wild-type biology synthetic gene that remedies host's defective.For example when transforming HIS4 ^-During the pichia pastoris phaff bacterial strain, can utilize cereuisiae fermentum or pichia pastoris phaff HIS4 gene.

If be in the linear DNA fragment transformed yeast host that the pichia pastoris phaff gene promoter is regulated the required AMF sequence of following HSA gene and processing and secretion with containing, then above-mentioned expression cassette will by a known step or two step replacement techniques (as referring to Rothstein, Methods Enzymol.101:202 (1983); Sherer and Davis, Proc.Natl.Acad.Sci., USA, 76:4951 (1979)) be integrated in the host genome, can be by the flanking DNA sequence that enough homologys is arranged with target gene with the linear DNA fragment specific seat that leads, to realize dna fragmentation integration therein.

Be included in expression vector such as the circular plasmids if contain the dna fragmentation of synthetic HSA encoding sequence of the present invention, then can on genomic identical or different seat, integrate one or more plasmid copies.After the dna fragmentation that contains synthetic HSA encoding sequence of the present invention was integrated preceding or integrates, wherein the each several part of expression cassette was operably connected each other.For the dna sequence dna and the transcription terminator in promotor, coding cereuisiae fermentum AMF processing site, the dna sequence dna of coding HSA is positioned on its functional position and the direction.Therefore, the HSA encoding sequence can be transcribed into the transcript that can produce required HSA after translating under the control of promoter region.Because have the preceding former sequence of AMF in the expression vector, obtain conduct by the HSA product of excretory integral body so can from substratum, separate.Because comprising, the dna fragmentation that contains synthetic HSA gene order of the present invention allows its sequence of particularly duplicating in the intestinal bacteria, so can in bacterium, produce this dna fragmentation in a large number on bacterium.

This purpose preferred embodiment according to the present invention, dna sequence dna by aforesaid method synthetic of the present invention coding HSA can be operably connected to and be commercially available, carry and be suitable in methylotrophic yeast expressing and the expression vector of the functional regulating and controlling sequence (nonstructural gene controlling element) of secretion exogenous protein, for example can pPIC9 available from Invitrogen company in.This plasmid contains 5 ' AOX1 promoter fragment, α-factor secretion signal, multiple clone site district, 3 ' AOX1 Transcription Termination fragment, HIS4 ORF, 3 ' AOX1 fragment, COLE1 replication origin and ampicillin resistance gene.Transform for example method of pichia pastoris phaff of methylotrophic yeast, and be used for cultivating the methylotrophy yeast that its genome contains the gene of encoding exogenous protein, for example the method for pichia pastoris phaff is known in the art.According to the present invention, people such as available Cregg (Mol.Cell.Biol.55:3376 (1985)), described Protoplast Technique or the full cell chlorination reason yeast conversion (ITO of system, et al, Agric.Biol.Chem.48:341 (1984)) and electroporation technology expression vector is transformed in the methylotrophic yeast cell.Under the situation of using single transcription unit, better select the electroporation transformation technology for use.

With Southern engram analysis method (Sambrook et al., Molecular Cloning, 2nded., Chapter9, Cold Spring Harborlaboratory Press, Cold Spring, NY, USA, 1989) analyzing DNA integration site, and with Northern blotting (people such as Sambrook, above-mentioned document, the 7th chapter) analyzes the reactive HSA genetic expression of methyl alcohol, with further evaluation positive transformant cell.

The present invention further provides the method for utilizing methylotrophic yeast expression system production reorganization HSA, this method is included in to be suitable for expressing cultivates the yeast host cell of the nucleotide sequence that comprises the HSA that encodes of preparation as stated above under the required proteinic condition, reclaim and the said HSA of purifying from culture then.For this reason, in fermentation container, cultivate phenotype and the genotypic bacterial strain that is transformed that has expection.For by methylotrophic yeast such as Pasteur pichia scale operation product based on recombinant DNA technology, generally can adopt three the stage high-density batch fermentation system.Fs is that growth phase is to cultivate host cell in the substratum of excess of glycerol as carbon source.When growing on this carbon source, the expression of heterologous genes in the yeast host is restricted, thereby cell is bred under the situation that does not produce heterologous protein.Be the glycerine limiting growth stage of short period then.After the glycerine limiting growth stage, add the expression of the required heterologous protein of methanol induction, be the production phase (phase III).Figure 13 has shown the time course that synthetic HSA gene of the present invention is expressed in Pasteur pichia.

According to a preferred embodiment of the invention, the heterologous protein expression system that is used to produce HSA has utilized the promotor of the AOX1 gene of the methyl alcohol adjusting that is derived from pichia pastoris phaff.This promotor is the expression and the strict adjusting of accepting the exogenous nutrition factor of promotor gene effectively.Said gene also can be the source of transcription terminator.The preferred expression cassette of the present invention comprise former sequence (or claiming alpha factor) before pichia pastoris phaff AOX1 promotor operationally connected to one another, the coding cereuisiae fermentum AMF DNA, press the dna sequence dna of the complete synthesis encoding mature HSA of the aforementioned principle of this paper, and be derived from pichia pastoris phaff AOX1 gene transcription terminator.On a dna fragmentation, preferably contain two or more such expression cassettes that are end-to-end, on single continuous dna fragmentation, to produce many expression cassettes.

As previously mentioned, in order to improve expression efficiency and the expression level of HSA gene order in pichia pastoris phaff, the inventor has taken into full account some constitutional features of naturally occurring HSA encoding sequence and the disadvantageous effect to expression efficiency that may exist thereof, and modifies comprehensively and has also synthesized said HSA gene again.These modifications comprise that the suitable fragment of being convenient to of all non-yeast bias codons, adding that replaces in the natural HSA gene with yeast bias codon connects and the endonuclease site of reorganization, protectiveness base and signal peptide recognition sequence and the cleavage site that cohesive end adds necessity, and additional terminator codon.On the other hand, the present invention also may and/or translate efficient and bring the part of disadvantageous effect to carry out necessary base modification, change and displacement at tumor-necrosis factor glycoproteins, internal promoter sequence and ribosome bind site etc. long in the intron montage sequence in the HSA gene order, the transcription termination sequence genetic transcription.

Can insert among suitable expression such as the pPIC9 by mentioned above principle synthetic HSA gene order of the present invention, and transform suitable Bacillus coli cells with the gained recombinant vectors.From by isolated plasmid dna the intestinal bacteria that transform and carry out sequential analysis.Analytical results shows that synthetic HSA of the present invention correctly is connected between the 5 ' promoter sequence and 3 ' Transcription Termination subsequence of the entrained AOX1 gene of expression vector, and holds on the 3 ' encoding sequence that is directly connected to the proteolysis processing site Glu-Lys-Arg that comprises the preceding former sequence (alpha factor encoding sequence) of AMF (referring to Figure 11) with 5 '.

Above-mentioned synthetic gene to the modification of natural HSA encoding sequence with change with and correct connection in suitable expression vector, fully guarantee the effectively start of genetic expression, transcribed and Transcription Termination smoothly, also guaranteed the carrying out smoothly of the process of translating of transcription product simultaneously.

The preferred host cell that available above-mentioned expression cassette transforms is the pichia pastoris phaff cell with at least a sudden change that the available marker gene that is present on the transfering DNA fragment remedies, and preferably utilizes HIS4-(GS115) or ARG4-(GS190) auxotrophic mutation body pasteur to finish red yeast-like fungi strain.The dna fragmentation that will contain one or more expression cassettes is inserted in the plasmid of the marker gene that contains the defective that remedies the host.The preferred expression vector of the present invention is plasmid PAO815 or pPIC9, particularly pPIC9.

In order to set up the Mut of pichia pastoris phaff ^-Expression strain, the transfering DNA that an available step gene substitution technique will contain expression cassette is incorporated in the host genome, and is terminal with the linear DNA fragment (by the flank homologous sequence) that comes from the AOX1 seat to produce two with suitable endonuclease enzymic digestion expression vector.Promptly obtain Mut through such gene substitution ³Bacterial strain.Here said Mut is meant that methyl alcohol utilizes phenotype.At Mut ³In the bacterial strain, the AOX gene is replaced by expression cassette, thereby has reduced the ability that bacterial strain utilizes methyl alcohol.In this case, yeast strain is just kept its slow growth on methyl alcohol by the expression of AOX2 gene product.Can identify that expression cassette wherein is incorporated into transformant in the AOXI seat by the locus specificity reorganization according to the existence of compensator gene.

In order to set up the Mut that expresses HSA ⁺Bacterial strain, the most handy circular plasmids transformed host cell that comprises expression cassette is incorporated in the host genome dna fragmentation that comprises one or more expression cassettes.In this case, integration be by with conversion carrier on one or more sequences have to add on the seat of homology and realize.In order to identify positive transformant, can analyze the reactive HSA expression of gene of methyl alcohol with the Northern blotting, and confirm the HSA protein secretion expression with the site of Southern blotting analyzing DNA integration by the HSA product that detects in the substratum.Available Southern blotting is identified the pichia pastoris phaff bacterial strain of having integrated one or more expression cassettes in the site of expection.Available Northern blotting and protein analytical method are identified the yeast strain (referring to Figure 14) of having improved HSA secretion productive rate.

In fermentor tank, for example in the YNB or YPD liquid nutrient medium of improvement, under about 30 ℃ temperature, cultivate and proved the genotype with expection and the methylotrophic yeast transformant of phenotype.Can use typical three stage production method fermentative production HSA, at first make cell be grown in the inhibition carbon source, preferably on excess of glycerol.This stage is not have to produce cell colony under the situation about expressing.Cell is grown under restriction glycerine supply condition.After glycerine is consumed, in incubator, add the single methyl alcohol of people or finite quantity glycerine+methyl alcohol, to cause HSA expression of gene by the reactive promoters driven of methyl alcohol.For with high cell density fermentation and improve the expression level of product, can add a spot of high concentration sucrose and glucose to avoid the inhibition of high concentration substrate cell growth with the method for fed batch cultivation in this stage, can also in substratum, add lipid acid improves the HSA product if any the lipid acid of 6-18 carbon atom productive rate in case of necessity.

The method of separation and results HSA can comprise the above-mentioned culture supernatant of heat treated with inactivated proteases, and uses at least a material that is selected from cationite, hydrophobic carrier and activated carbon that HSA and coloring ingredient are separated, and generates with the color that suppresses product.Can in substratum, add suitable amine such as methylamine, ethamine or propylamine in the training period to suppress the color of HSA.

Can use and be selected from heat treated, ultrafiltration, affinity chromatography, cation-exchange chromatography, hydrophobic chromatography, anion-exchange chromatography, saltout and at least five kinds of combined method purifying that resin is handled obtain high purity HSA.For suitable simplification purification step, under the prerequisite that guarantees the HSA product purity, reduce production costs as much as possible, better select the process for continuous purification of heat treated, ultrafiltration, hydrophobic chromatography and anion-exchange chromatography successively or high pressure liquid chromatography (HPLC) for use.The HSA productive rate of producing by the inventive method generally is about 3.5g/ and rises nutrient solution, and product purity can reach 99.99% substantially.

The following example is intended to further describe for example the present invention, but these embodiment all constitute the await the reply restriction of scope of claim to the present invention never in any form.Synthetic and the clone of embodiment 1:HSA full length gene sequence

Synthesizing of the overall length nucleotide sequence of present embodiment description coding HSA.Longer relatively in view of the nucleotide sequence of total length HSA gene, once syntheticly may run into operational difficulty, it is synthetic respectively therefore full-length gene order to be divided into three bigger nucleotide fragments.These three fragments are called HSA-I (612bp), HSA-II (562bp) and HSA-III (705bp), and they each all be spliced by 8 oligonucleotide fragments.1.HSA-the segmental synthetic and clone of I

( 1 ) 612bpHSA5’HSA-Ⅰ,ABI394DNA ( Appiled Biosystem Inc. ) 10008：OA-1GGCGGATCCCTCGAGAAAAGAGATGCACACAAGAGTGAGGTTGCTCATCGGTTTAAAGATTTGGGTGAGGAAAATTTCAAAGCCTTAGTGTTAATOA-2GCGAACTCAGTGACCTCGTTAACCAACTTTACATGATCCTCAAATGGACATTGCTGAAGATATTGGGCAAAAGCAATTAACACTAAGGCTTTGOA-3CGAGGTCACTGAGTTCGCTAAAACTTGTGTTGCAGACGAATCTGCTGAAAATTGTGATAAGTCTCTGCATACCCTATTTGGTGACAAATTGTGCOA-4 GCATTCGTTTCTGCCAGGTTCTTGCTTTGCACAGCAGTCGGCCATTTCACCGTAAGTTTCTCGAAGGGTAGCCGACTGTGCACAATTTGTCACCAAAOA-5CCTGGCAGAAACGAATGCTTTTTGCAGCACAAACATGACAACCCTAATCTTCCACGTTTAGTGAGACCTGAAGTTGATGTGATGOA-6TATGGGTGCCTTCTTGCAATTTCATATAAGTACTTCTTCAAAAAAGTTTCTTCATTATCATGGAAGGCTGTACACATCACATTCAACTTCAGGOA-7GCAAGAAGGCACCCATACTTCTATGCCCCGGAGCTACTGTTCTTTGCTAAACGTTATAAAGCTGCATTCACAGAATGTTGCCAAGCOA-8CCTATCGATGGCAGAAGAAGCTTTACCCTCATCTCTTAATTCGTCTAGCTTTGGCAACAGACAAGCTGCCTTATCGGCAGCTTGGCAACATTCTGTG

To distinguish synthetic oligonucleotide (OA-1 to OA-8) wash-out and with after containing 10% polyacrylamide gel electrophoresis purifying of 7M urea from the solid phase carrier post, reclaim it respectively.

According to synthesis strategy shown in Figure 2, use the DNA synthetic technology of PCR reaction mediation, obtain HSA-I fragment by above-mentioned 8 oligonucleotide through three step pcr amplifications.Specifically, at first in four PCR reaction tubes, add OA-1 and OA-2 (each 10 μ l), OA-3 and OA-4 (each 10 μ l), OA-5 and OA-6 (each 10 μ l) and OA-7 and OA-8 (each 10 μ l) respectively.In being each pipe of 50 μ l, total reaction volume adds about 50l1 * PCR damping fluid then respectively, 200 μ M dNTP (respectively 50 μ M), 1.5mM MgCl ₂With 2.5 Taq of unit archaeal dna polymerases.At 94 ℃, 10 seconds; 55 ℃, 30 seconds; 72 ℃, under the PCR reaction conditions of 1 fen kind, obtain 4 double chain DNA fragments that 8 oligonucleotide chains connect in twos through 15 PCR circulations: Segment A, B, C and D.Then Segment A and B, C and D are blended in respectively in two reaction vessels, carry out PCR reaction, the fragment E and the F that are further merged respectively and increase by above-mentioned condition once more.At last, use oligonucleotide OA-1 and OA-8, once more the fragment E that as above obtains and the mixture of F are carried out the PCR reaction, thereby obtain representing the fragment HSA-I of 5 ' end of HSA gene as two terminal primers.After the separation of 1.5% sepharose and this fragment of purifying, put-70 ℃ and preserve standby down.

(2) e.colistraindh5 that will carry plasmid pBKS is inoculated in the 50ml LB substratum, 37 ℃ of shaking culture 15 hours.Cultivate back centrifugal (5000rpm, 5 minutes) collecting cell, and be used to clone the segmental plasmid pBKS of synthetic HSA with the alkaline lysis preparation.For this reason, at first the cell precipitation thing is suspended in 5ml solution I (50mM sucrose, 25mM Tris, 10mMEDTA, pH8.0) in, in suspension, add then the fresh solution II of 10ml (0.2NaOH, 1%SDS), mixing is also put to place after 10 minutes in the ice-water bath and is added 7.5ml solution III (3MKAc again, pH4.8), mixing was placed in ice bath 15 minutes once more, centrifugal (12000rpm, 10 minutes) collecting precipitation thing.Washing the cell precipitation thing with 70% ethanol also is suspended in the 1ml TE damping fluid again.In gained solution, add RNA enzyme A (Promega) (200 μ g/ml) and be incubated 30 minutes in 37 ℃.Use phenol then successively; Phenol: chloroform (1: 1) and chloroform: primary isoamyl alcohol (24: 1) extracting, and the dehydrated alcohol that adds the 3M NaAc (pH4.8) of 1/10 volume and two volumes in extracting solution is to precipitate it.Centrifugal back also is dissolved in the 0.1ml TE damping fluid again with 70% washing with alcohol throw out, thereby obtains the pBKS plasmid DNA.Use restriction endonuclease BamH I and Cla I (each 2 units) to digest this plasmid DNA at last, separate and the enzyme of the 3.0Kb of recovery gained is cut product, obtain the linearizing pBKS carrier of purifying with 1% agarose electrophoresis.

(3) with the two enzymes of BamH I and Cla I (each 1 unit) enzyme cut as preceding preparation HSA-I fragment (4 μ g), the segmental enzyme of this HSA-I is cut product (1 μ g) to be mixed with the pBKS plasmid (about 4 μ g) that as above same enzyme is cut, in the presence of T4 dna ligase (3 unit), reaction is 17 hours in 16 ℃ of water-baths.Cell suspension (the OD that connects mixture transformed competence colibacillus e.colistraindh5 after reaction is finished according to a conventional method with gained ₆₀₀Be about 0.6).Use the pBKS empty plasmid as negative control in the conversion reaction.Bacterial cell suspension shop is applied on the solid LB flat board that adds penbritin (100 μ g/ml), after the 37C incubated overnight, filtered out the positive bacterium colony that is transformed, and the preparation plasmid DNA.Cut this DNA with BamH I and Cla I enzyme, be connected with the segmental recombinant plasmid pBKS/HSA-of HSA-I I with correct direction according to the big or small preliminary evaluation of gained dna fragmentation.

(3) on the solid medium that adds penbritin (100 μ g/ml), cultivate the positive strain that carries recombinant plasmid pBKS/HSA-I, and therefrom prepare DNA as stated above and with the template of this DNA as following sequencing reaction through preliminary evaluation.By currently known methods template DNA (2 μ g) is carried out denaturing treatment, then to wherein adding sequencing primer and annealing buffer (each 2 μ l) to finish annealing reaction, and by known Sanger dideoxy chain termination (Sambrook et al., MolecularCloning, 2nd Edition Chapter 13, Cold Spring Harbor laboratory Press, ColdSprng, NY, USA, 1989) nucleotide sequence of the double-stranded DNA template of detection sex change, sequencing result shows that all five clones include base deletion and the displacement that number does not wait.Utilize the restriction enzyme site that exists on the appropriate location in the HSA-I series for this reason, cut out the small segment that do not have the base mistake and with other clones in have a correct sequence small segment obtained removing the HSA-I fragment of wrong base after reconnecting.In correcting the segmental base mistake of HSA-I, the Hae III that to have selected to use two single restriction enzyme sites in inside be nucleotide position 282 places and the Sca I site at nucleotide position 431 places.2.HSA-the segmental synthetic and clone of II

1 ( 1 ) HSA-Ⅰ,8：OA-9GGCGGATCCGAGGGTAAAGCTTCTTCTGCCAAACAAAGATTGAAGTGCGCTAGTCTACAGAAATOA-10AAACTCGGCTTTGGGAAATCTCTGGCTCAGGCGAGCTACAGCCCATGCCTTAAAAGCTCTTTCTCCAAATTTCTGTAGACTAGCGOA-11TTCCCAAAGCCGAGTTTGCAGAAGTTTCCAAGTTAGTGACGGATTTGACCAAAGTCCATACGGAATGTTGCCATGAGATTTGCTTGAATGTGCOA-12CTTCAGTTTACTCGAGATCGAATCTTGATTTTCACAGATATACTTGGCCAAGTCCGCCCTGTCATCAGCACATTCAAGCAAATCTCCOA-13CGATCTCCAGTAAACTGAAGGAATGTTGTTAAAAACCTCTTTTGGAAAAATCCCACTGCATTGCCGAAGTGGAAAACGATGAGATGCCOA-14CCTTTGCCTCAGCGTAGTTTTTGCAAACATCCTTACTTTCAACAAAATCAGCAGCTAATGATGGCAAGTCAGCAGGCATCTCATCGTTTTCCOA-15CTACGCTGAGGCAAAGGATGTCTTCTTGGGCATGTTTTTGTATGAATACGCAAGAAGGCATCCAGATTACTCTGTCGTGCTGTTCCCCCGCTGAOA-16CCTATCGATACATTCATGAGGATCTGCAGCGGCACAGCACTTCTCTAGAGTGGTTTCATATGTCTTGGCAAGTCTCAGCAACAGACCACA

These 8 oligonucleotide (OA-9 to OA-16) are connected into through three pcr amplifications by the method described in 1 (1) above then and have 5 ' end BamH I and 3 ' end Cla I restriction enzyme site, length is the double-stranded HSA-II fragment of 564bp.This fragment has been represented the middle portion of HSA gene order.Equally, by above 1 (2) and described in method purifying and the clone's synthetic HSA-of institute II fragment, and prepare the recombinant cloning vector pBKS/HSA-II that contains the HSA-II.Diagram has shown the structure of the recombinant cloning vector pBKS/HSA that is used to clone and identify purpose among Fig. 6.Press the above method described in 1 (3) then, get 5 escherichia coli clonings that carry the pBKS/HSA-II equally, DNA isolation is also carried out sequential analysis.The sequencing results shows among 5 clones being analyzed to have only a clone's base sequence to have single base mistake, but should mistake cause the change of aminoacid sequence.3.HSA-the segmental synthetic and clone of III

1 ( 1 ) HSA-Ⅰ,8：OA-17CGCGGATCCGTGCCGCTGCAGATCCTCATGAATGTTATGCCAAAGTTTTCGATGAATTTAAACCTCTTGTGGAAGAGCCACAAAATTTAATTAAACAAAATTGTGAGOA-18GGAGTTGACACTTGGGGTACTTTCTTGGTGTAACGAACTAACAGCGCATTCTGGAATTTGTATTCACCAAGTTGCTCAAAAAGCTCACAATTTTGTTTAATOA-19CCCCAAGTGTCAACTCCAACTTTGGTAGAGGTCTCAAGAAACCTAGGTAAAGTGGGTAGCAAGTGTTTGTAAACATCCTGAAGCAAAAAGAATGCOA-20GACTCTGTCACTTACTGGCGTTTTCTCATGCAACACACATAACTGGTTCAGGACAACGGATAGATAGTGTTCTGCACATGGCATTCTTTTTGCTTCAGGOA-21CCAGTAAGTGACAGAGTCACCAAGTGCTGCACAGAATCTTTGGTTAACAGGCGACCATGCTTTTCAGCTCTGGAAGTCGATGAAACATACGTTCCCAAAGAGTTTAATGCOA-22GTGTTTCACTAGCTCAACTAGTGCAGTTTGTTTCTTGATTTGTCTTTCCTTCTCAGAAAGTGTACATATATCTGCATGGAAGGTGAAAGTTTCAGCATTAAACTCTTTGGGOA-23GTTGAGCTAGTGAAACACAAGCCGAAGGCGACTAAAGAACAACTGAAAGCTGTTATGGATGGATGATTTTCGCGGCTTTTGTAGAAAAGTGTTGTAATGCTGACGOA-24CCTATCGATCAAGAATTCCTATTATAAACCTAAGGCAGCTTGAGATGCAGCAACTAGTTTCTTACCTTCCTCGGCAAAGCAAGTTTCCTTATCGTCAGCCTTAGAAGAC

These 8 oligonucleotide chains (AO-17 to OA-24) are connected into through three pcr amplifications by method described in 1 (1) above then and have 5 ' end BamH I and 3 ' end Cla I restriction enzyme site, length is the double-stranded HSA-III fragment of 705bp.This fragment has been represented 3 ' end parts of HSA gene order.Same by the similarity method purifying described in above-mentioned 1 (2) and clone the synthetic HSA-of institute III fragment, and prepare the recombinant cloning vector pBKS/HSA-III that contains the HSA-III.Diagram has shown the structure of the recombinant vectors pBKS/HSA-III that is used for purifying, clone and evaluation purpose among Fig. 8.Press above method described in 1 (3) then, get 5 escherichia coli clonings that carry the pBKS/HSA-III equally, DNA isolation is also carried out sequential analysis.The sequencing results shows that all there are indivedual wrong bases in all 5 clones.For this reason, press above method described in 1 (3) replaces the fragment that has the mistake base with the subfragment that has correct base.In correcting the segmental base mistake of HSA-III, three subfragments are reconnected into complete HSA-III fragment by the Sty I site at nucleotide position 216 places and the Hap-I site at nucleotide position 373 places.4. the preparation of overall length HSA gene and clone

Basically carry the recombinant cloning vector of total length HSA gene order according to each segmental method preparation in the said clone HSA encoding sequence as mentioned.Use BamH I and Hind III at first respectively, Hind III and Pst I, and Pst I and Cla I cut out fragment HSA-I, HSA-II and HSA-III from corresponding recombinant plasmid pBKS/HSA-I in pBKS/HSA-II and the pBKS/HSA-III.After each fragment of purifying, they are mixed with the amount that equates, in each segmental mixture of gained, add with BamH I and the linear plasmid pBKS of Cla I double digestion then.Figure 12 has shown 1% agarose gel electrophoretogram of HSA-I, HSA-II, HSA-III fragment and overall length HSA dna fragmentation.Finish 4 segmental connections by above-mentioned reaction conditions, recirculation and through the screening and sequential analysis after, obtain naming recombinant plasmid into pBKS/HSA.The overall length sequential analysis shows further, and the HSA gene order of gained has overall length nucleotide sequence as shown in Figure 1.

The genetic stability experimental result shows, the DH5 α bacterial strain of the recombinant plasmid pBKS/HSA that makes as stated above is after cultivating continue formula, the plasmid DNA of carrying in 10 mono-clonals of gained has the identical dna sequence dna with original clone, shows that synthetic HSA gene order of the present invention has good genetic stability.

Embodiment 2: the structure of recombinant expression vector

Present embodiment is described the structure that is used for expressing at methylotrophic yeast the recombinant expression vector of HSA.In general, can finish the structure of the expression vector that is used for the object of the invention (as referring to Sambrook et al by standard method as known in the art, Molecular Cloning, A LaboratoryManual, 2nd ed., Cold Spring Harbor Laboratory Press, 1989).Can make up the recombinant vectors that is used to express complete synthesis HSA gene of the present invention according to the method described in european patent application 0344459 and the International Patent Application WO 90/10697.

For convenience's sake, as a kind of alternative method, we utilize the plasmid pPIC9 (Invitrogen) of the methylotrophic yeast system that is applicable to that is commercially available to make up the recombinant expression vector that is used for secreting, expressing HSA.Plasmid pPIC9 contains the necessary regulating and controlling sequence (nonstructural gene controlling element) that is suitable for expressing and secreting exogenous protein in methylotrophic yeast, comprising AOX1 promoter fragment, alpha factor secretion signal (former sequence before the AMF), multiple clone site, 3 ' AOX1 Transcription Termination fragment, HIS4-ORF, 3 ' AOX1 fragment, ColE1 replication origin and ampicillin resistance gene.Use this carrier also to have to be more convenient for checking the advantage of synthetic HSA gene of the present invention secreting, expressing in methylotrophic yeast.

For this reason, at first will carry 37 ℃ of shaking culture of intestinal bacteria 15 hours of plasmid pPIC19, and cultivate centrifugal (5000rpm, 5 minutes) the collecting cell throw out in back and prepare plasmid DNA (referring to the preparation method of embodiment 1 relevant pPKS) with alkaline lysis.Use EcoR I and Xho I (each 3 unit) to digest this plasmid DNA then.Electrophoretic separation and reclaim the linear DNA fragment of the about 8.0Kb of length on 1% sepharose.

Will be as stated above after pBKS/HSA plasmid DNA and 2 μ l of (referring to embodiment 1) preparation use enzyme cutting buffering liquid (Promega) and EcoR I and Xho I (each 3 unit) to mix to be incorporated in 37 ℃ to be incubated 1.5 hours more, electrophoretic separation and reclaim the HSA gene fragment on 1% sepharose.About 2 μ g (10 μ l) gained HSA gene fragment is cut product with the pPIC9 enzyme of cutting with same enzyme mix, exist down in T4 dna ligase (3 unit), insulation is 17 hours in 16 ℃ of water-baths, finishes ligation.

Transform CaCl with resulting connection mixture through 0.1M ₂The competence e.colidh5 of handling.Select to have amicillin resistance (Amp containing on the LB flat board of penbritin then ^R) the conversion bacterium colony, and therefrom extract plasmid DNA.With BamH I and Cla I digestion gained plasmid DNA and with after the SDS-PAGE method preliminary evaluation, filter out on the tram through dna sequence analysis again and inserted the reorganization matter pPIC9/HSA that contains the HSA gene with correct direction.Embodiment 3: the conversion of yeast host bacterial strain and the screening of positive transformant

The recombinant expression vector pPIC9/HSA that present embodiment is described with method for preparing transforms the pichia pastoris phaff cell, with the method that obtains stably express and secrete the recombinant cell of HSA.

Separate from the bacillus coli DH 5 alpha that carries the pPIC9/HSA plasmid with alkaline lysis and to obtain recombinant plasmid pPIC9/HSA.Extract through phenol/chloroform, and use the dehydrated alcohol post precipitation, obtain the purified plasmid DNA that can be used for transforming the pPIC9/HSA of pichia pastoris phaff bacterial strain.In 37 ℃ of water-baths, digest 10 μ g pPIC9/HSA with Sal I (5 unit), be cut into linear DNA.Directly transform pichia pastoris phaff GS115 (HIS with this endonuclease reaction mixture ^-) bacterial strain (NRRLY-15851).The pPIC9/HSA of Sal I cutting can be incorporated in the group ammonia alcohol dehydrogenase gene in the pichia spp karyomit(e), and does not destroy the AOX1 gene.Because pPIC9/HSA carries the HIS gene, so can be based on HIS ⁺The resulting transformant of Phenotypic Selection.

Pichia pastoris phaff GS115 (NRRL Y-15851) is inoculated in about 10ml YPD substratum (1% yeast extract, 2% peptone, 2% glucose), and 30 ℃ of shaking culture are spent the night.Get the 1ml overnight culture then, in the fresh YPD substratum of 500ml, cultivated about 12-14 hour, to OD ₆₀₀=1.3-1.5 centrifugal (3000rpm, 5 minutes, 4 ℃) collecting cell, and be suspended in again in the sterilized water of using the ice bath precooling.With sterilized water cell again after the washed twice, is suspended in the 1M Sorbitol Solution USP again.

The linearizing pPIC9/HSA plasmid DNA of 10 μ g is added in the above-mentioned GS115 cell suspension of 80 μ l, behind the mixing, transfer in the pre-cooled electrotransfer groove ice bath 5 minutes.Use electroporation apparatus (Invitrogen), press 10 milliseconds of conditions (strength of electric field 1500V/cm) that apparatus manufacturer recommends with electroporation conversion pichia spp cell.After applying electricimpulse, in the electrotransfer groove, add the 1M Sorbitol Solution USP of 1ml immediately, and content is transferred in the Eppendorf tube with the ice bath precooling.Get 200ul cell suspension shop and spread on MD flat board (1.34%YNB, 4 * 10 ^-5The % vitamin H, 0.5% methyl alcohol) and MD (1.34%YNB, 4 * 10 ^-5% vitamin H, 1% dextrose) on the dull and stereotyped same position.On MD and MM flat board, inoculate the GS115-Albumin (HIS+Mut that carries the HSA gene simultaneously respectively ^s) GS115 (the GS115-β-gal) and carry (HIS of tilactase ⁺Mut ⁺) bacterial strain has HIS with screening in contrast ⁺Mut ⁺The positive transformant that has the pPIC9/HSA recombinant plasmid of phenotype.The flat board of above-mentioned preparation was cultivated two days in 30C for this reason, wherein had HIS ⁺Mut ⁺The bacterial strain of phenotype is equal energy normal growth on MM substratum and MD substratum, and the obtained strains size is similar to control strain.Has HIS ⁺Mut ⁵The bacterial strain of phenotype can be on the MD substratum normal growth, but growth is very slow or almost can not grow on the MM substratum.

With 50 HIS that screen as stated above ⁺Mut ⁺The mono-clonal bacterial strain is inoculated respectively in the 3mlYPD liquid nutrient medium, 30 ℃ of shaking culture 24 hours, centrifugal collecting cell then.Cell precipitation is suspended in the 120 μ l sterilized waters again, respectively adds the granulated glass sphere of 0.4g, 3 minutes smudge cellses of thermal agitation through aseptically process.Behind the centrifugal removal cell precipitation, use phenol/chloroform (1: 1, cumulative volume 100 μ l) and chloroform/primary isoamyl alcohol (24: 1, cumulative volume 100 μ l) successively, extract chromosomal DNA by preceding method.

Available PCR method detects the chromosomal DNA as above-mentioned preparation, further to filter out the positive transformant that carries synthetic HSA gene of the present invention.For this reason, joined in the PCR reaction system of forming by following ingredients respectively by the genomic dna of transformant with 1 μ g (5 μ l) is above-mentioned: 10XPCR reaction buffer (5 μ l), the about 5ul of genomic dna (1 μ g); 100mM dNTPs (1 μ l); 5 ' AOX1 primer (the about 5 μ l of 0.1 μ g/ μ l); 3 ' AOX1 primer (the about 5 μ l of 0.1 μ g/ μ l); Adding sterilized water to cumulative volume is 50 μ l.Add 0.25 μ l Taq archaeal dna polymerase (5U/ μ l) again, 5 ' AOX1 primer wherein, 3 ' AOX1 primer is all available from Invitrogen company.

The PCR reaction conditions is: 94 ℃ of thermally denatures 2 minutes, carry out 25 circulations by following condition then: 94 ℃ of sex change (40 seconds), 55 ℃ of renaturation (90 seconds), 72 ℃ of extension (1 minute), last 72 ℃ of extensions 7 minutes.After the PCR reaction is finished,, observe the HSA gene fragment whether amplification is arranged, further to filter out the transformant that contains the HSA gene with PCR reaction product electrophoresis on 1% agarose gel electrophoresis.This cell strain is according to the regulation of the internationally recognized microbial preservation budapest treaty that is used for patented procedure, the pichia GS115 bacterial strain that carries recombinant plasmid pPIC9/HSA will be preserved in China Committee for Culture Collection of Microorganisms common micro-organisms preservation center (CGMCC), and its preservation registration number is CGMCC NO.0354.The expression of embodiment 4:HSA gene in the GS115 yeast and the immunoblotting assay of protein

Present embodiment is described expression and the secretion of synthetic HSA gene of the present invention in pichia pastoris phaff GS115 bacterial strain, and to the immunoblotting assay of the expression product in the culture supernatant.To be inoculated in BMG substratum (100mM potassiumphosphate, 1.34%YNB, 4 * 10 by the positive strain that method described in the embodiment 3 is identified ^-5% vitamin H, 1% glycerine) in, 30 ℃ of shaking culture 18 hours.Again be suspended in BMM substratum (100mM potassiumphosphate, 1.34%YNB, 4 * 10 behind the centrifugal collecting cell ^-5% vitamin H, 0.5% methyl alcohol) 30 ℃ are continued shaking culture in, respectively at sampling in 0,24,48,96,120,144 hour, all samples is carried out SDS-PAGE analyze.The result shows that except that 0 hour, the sample of all the other each times all shows the band of the about 66KD of molecular weight, and prolongs band from light to dark with expression time at this moment, shows that expression amount increases (Figure 13) gradually.

Detect the HSA protein of pressing above-mentioned force method preparation and purifying with the Western immunoblotting, and use commercially available reorganization HSA (the Shanghai institute of Biological Products provides) as positive control, with carrying 48 hours fermentation culture supernatant liquors of GS115 cell of pPIC9 plasmid as negative control.

Laboratory sample and control sample are carried out sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) to be separated, then with the protein electrotransfer on the gel to nitrocellulose, with this cellulose nitrate membranogen film with the PBS solution that contains 5% skim-milk in sealing 2 hours under the room temperature and after with PBS washing 3 times, filter membrane and goat-anti HSA antiserum(antisera) (magnificent company) (dilution in 1: 50) are incubated 1.5 hours for 37 ℃.After sealing with filter membrane washing 3 times and with skim-milk with PBS once more, make mixed 37 ℃ of following incubations 1.5 hours that are incorporated in of the anti-sheep second antibody of monkey (Cooper Biomedical Inc.) (dilution in 1: 3000) of filter membrane and horseradish peroxidase.Use 50mM Tris-HCl then, pH6.8 solution washing 3 times adds substrate solution O-Phenylene Diamine (DNB) colour developing after 5-10 minute at last, occurs brown band on the filter membrane.From result shown in Figure 14 as can be seen, synthetic HSA gene of the present invention can be finished at pasteur and expresses the protein that justacrine and natural HSA have identical amynologic characteristic among the red host.The purifying of embodiment 5:HSA expression product

The GS115 bacterial strain that pPIC9/HSA is transformed contains in the culturing bottle of BMGY substratum of improvement about 48 hours of 30 ℃ of shaking culture at 50ml, makes the OD of cell culture ₆₀₀Value reaches 4.0.Collecting cell and under aseptic condition, being inoculated in two liters of fermentor tanks that contain 700ml BMGY substratum, then in 30 ℃ of following aerobic fermentations.Make a jar interior dissolved oxygen remain on 20% above air saturation by regulating ventilation speed (5 liters/minute) and stirring velocity (1500rpm).In whole fermentation process, regularly add commercially available Struktol J673 defoamer and generate to control too much bubble.After glycerine consumes gradually, in jar, pump into and contain 0.5% methyl alcohol but not glycerinated BMMY substratum (700ml), proceed fed batch cultivation under 30 ℃.Methanol concentration in this cultivation stage in the fermentor tank remains at 0.3%-0.7%.Fermenting began to collect culture in back 20 hours, with natural HSA standard substance in contrast, detected optical density(OD) after 10% polyacrylamide gel electrophoresis and dyeing, and the concentration of estimation fermenting culture HSA is 4.5g/L.After fermentation is finished, centrifugal (10,000rpm, 15 minutes) the collection culture supernatants, in 70 ℃ of heat treated 20 minutes, be cooled fast to 15 ℃ then, centrifugal (15,000rpm, 20 minutes) remove that to make centrifuged supernatant behind the thermally denature impurity that comprises the trace of albumin enzyme be that the millipore filtration (Millipore) of 0.45 μ filters by the aperture.After the filtration again with molecular weight cut-off be 30,000 ultra-filtration membrane (Millipore) with this supernatant liquor to being concentrated into about 0.5L volume.With acetate pH value of solution is adjusted to about 4.5 then, by the RBO2 decolorizing resin (5 * 25cm that uses 50mM sodium-acetate buffer (pH4.5) balance to cross in advance, the about 500ml of column volume) decolours, in gained clear elutant, add ammonium sulfate, making its final concentration is 10%, uses 50mM phosphoric acid salt+10% (NH then through in advance ₄) ₂SO ₄The phenyl Sepharose post absorption that PH6.8 damping fluid balance is crossed, with the one times of above-mentioned pre-equilibration damping fluid of column volume equilibrated washing column, use elution buffer (200mM PB+30% Virahol damping fluid, pH6.8) wash-out and the wash-out part of collecting the 280nM absorption peak at last.Further this elutriant is suitable for basically the high purity HSA product of clinical application after the desalination of G-25 gel chromatography column.

Sequence table (1), general information (I) applicant: Haiji Bioengineering Co., Ltd., Shanghai's (II) denomination of invention: the production method of recombination human serum albumin (III) sequence number: 2 (IV) address:

(A) contact person: Li Shaoji

(B) street: No. 192, Taiyuan road

(C) city: Shanghai

(D) country: the People's Republic of China (PRC)

(E) postcode: 200031 (V) computer-reader form:

(A) amboceptor type: 3.5 inches floppy disks

(B) computer: AST Pentium III+4/66d

(C) operating system: Windows95

(D) software: Word97 (VI) telecommunication information:

(A) phone: 86-21-64735898

(B) information (I) sequence signature of fax: 86-21-64674742 (2) SEQ ID NO:1:

(A) length: 1758 base pairs

(B) type: nucleic acid

(C) chain: two strands

( D ) ： ( Ⅱ ) ： DNA ( Ⅲ ) ： SEQ ID NO:11GATGCACACA AGAGTGAGGT GCTCATCGG TTTAAAGATT TGGGTGAGGA51AAATTTCAAA GCCTTAGTGT TAATTGCTTT TGCCCAATAT CTTCAGCAAT101GTCCATTTGA GGATCATGTA AAGTTGGTTA ACGAGGTCAC TGAGTTCGCT151AAAACTTGTG TTGCAGACGA ATCTGCTGAA AATTGTGATA AGTCTCTGCA201TACCCTATTT GGTGACAAAT TGTGCACAGT CGCTACCCTT CGAGAAACTT251ACGGTGAAAT GGCCGACTGC TGTGCAAAGC AAGAACCTGA GAGAAACGAA301TGCTTTTTGC AGCACAAAGA TGACAACCCT AATCTTCCAC GTTTAGTGAG351ACCTGAAGTT GATGTAATGT GTACAGCCTT CCATGATAAT GAAGAAACTT401TTTTGAAGAA GTACTTATAT GAAATTGCAA GAAGGCACCC ATACTTCTAT451GCCCCGGAGC TACTGTTCTT TGCTAAACGT TATAAAGCTG CATTCACAGA501ATGTTGCCAA GCTGCCGATA AGGCAGCTTG TCTGTTGCCA AAGCTAGACG551AATTAAGAGA TGAGGGTAAA GCTTCTTCTG CCAAACAAAG ATTGAAGTGC601GCTAGTCTAC AGAAATTTGG AGAAAGAGCT TTTAAGGCAT GGGCTGTAGC651GCGCCTGAGC CAGAGATTTC CCAAAGCCGA GTTTGCAGAA GTTTCCAAGT701TAGTGACGGA TTTGACCAAA GTCCATACGG AATGTTGCCA TGGAGATTTG751CTTGAATGTG CTGATGACAG GGCGGACTTG GCCAAGTATA TCTGTGAAAA801TCAAGATTCG ATCTCCAGTA AACTGAAGGA ATGTTGTGAA AAACCTCTTT851TGGAAAAATC CCACTGCATT GCCGAAGTGG AAAACGATGA GATGCCTGCT901GACTTGCCAT CATTAGCTGC TGATTTTGTT GAAAGTAAGG ATGTTTGCAA951AAACTACGCT GAGGCAAAGG ATGTCTTCTT GGGCATGTTT TTGTATGAAT1001ACGCAAGAAG GCATCCAGAT TACTCTGTCG TGCTGTTGCT GAGACTTGCC1051AAGACATATG AAACCACTCT AGAGAAGTGC TGTGCCGCTG CAGATCCTCA1101TGAATGTTAT GCCAAAGTTT TCGATGAATT TAAACCTCTT GTGGAAGAGC1151CACAAAATTT AATTAAACAA AATTGTGAGC TTTTTGAGCA ACTTGGTGAA1201TACAAATTCC AGAATGCGCT GTTAGTTCGT TACACCAAGA AAGTACCCCA1251AGTGTCAACT CCAACTTTGG TAGAGGTCTC AAGAAACCTA GGTAAAGTGG1301GTACCAAGTG TTGTAAACAT CCTGAAGCAA AAAGAATGCC ATGTGCAGAA1351GACTATCTAT CCGTTGTCCT GAACCAGTTA TGTGTGTTGC ATGAGAAAAC1401GCCAGTAAGT GACAGAGTCA CCAAGTGCTG CACAGAATCT TTGGTTAACA1451GGCGACCATG CTTTTCAGCT CTGGAAGTCG ATGAAACATA CGTTCCCAAA1501GAGTTTAATG CTGAAACTTT CACCTTCCAT GCAGATATAT GTACACTTTC1551TGAGAAGGAA AGACAAATCA AGAAACAAAC TGCACTAGTT GAGCTAGTGA1601AACACAAGCC GAAGGCGACT AAAGAACAAC TGAAAGCTGT TATGGATGAT1651TTCGCGGCTT TTGTAGAAAA GTGTTGTAAG GCTGACGATA AGGAAACTTG1701CTTTGCCGAG GAAGGTAAGA AACTAGTTGC TGCATCTCAA GCTGCCTTAG1751GTTTATAA ( 3 ) SEQ ID NO:2 ( Ⅰ ) ：

(A) length: 585 amino acid

(B) type: amino acid

(C) chain: strand

( D ) ： ( Ⅱ ) ： ( Ⅲ ) ： SEQ ID NO:21Asp Ala His Lys Ser Glu Val Ala His Arg Phe Lys Asp Leu Gly Glu Glu18Ash Phe Lys Ala Leu Val Leu Ile Ala Phe Ala Gln Tyr Leu Gln Gln Cys35pro Phe Glu Asp His Val Lys Leu Val Asn Glu Val Tlu Glu Phe Ala Lys52Thr Cys Val Ala Asp Glu Ser Ala Glu Asn Cys Asp Lys Ser Leu His Thr69Leu Phe Gly Asp Lys Leu Cys Thr Val Ala Thr Leu Arg Glu Thr Tyr Gly86Glu Met Ala Asp Cys Cys Ala Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe103Leu Gln His Lys Asp Asp Asn Pro Asn Leu Pro Arg Leu Val Arg Pro Glu120Val Asp Val Met Cys Tlr Ala Phe His Asp Asn Glu Glu Thr Phe Leu Lys137Lys Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro Glu154Leu Leu Phe Phe Ala Lys Arg Tyr Lys Ala Ala Phe Thr Glu Cys Cys Gln171Ala Ala Asp Lys Ala Ala Cys Leu Leu Pro Lys Leu Asp Glu Leu Arg Asp188Glu Gly Lys Ala Ser Ser Ala Lys Ghn Arg Leu Lys Cys Ala Ser Leu Gln205Lys Phe Gly Glu Arg Ala Phe Lys Ala Trp Ala Val Ala Arg Leu Ser Gln222Arg Phe Pro Lys Ala Glu Phe Ala Glu Val Ser Lys Leu Val Thu Asp Leu239Thu Lys Val His Thr Glu Cys Cys His Gly Asp Leu Leu Glu Cys Ala Asp256Asp Arg Ala Asp Lcu Ala Lys Tyr Ilc Cys Glu Asn Gln Asp Ser Ilc Ser273Ser Lys Leu Lys Glu Cys Cys Glu Lys Pro Leu Leu Glu Lys Ser His Cys290Ile Ala Glu Val Glu Asn Asp Glu Met Pro Ala Asp Leu Pro Ser Leu Ala307Ala Asp Phe Val Glu Ser Lys Asp Val Cys Lys Asn Tyr Ala Glu Ala Lys324Asp Val Phe Leu Gly Met Phe Leu Tyr Glu Tyr Ala Arg Arg His Pro Asp341Tyr Ser Val Val Leu Leu Leu Arg Leu Ala Lys Thr Tyr Glu Thr Thr Leu358Glu Lys Cys Cys Ala Ala Ala Asp Pro His Glu Cys Tyr Ala Lys Val Phe375Asp Glu Phe Lys Pro Leu Val Glu Glu Pro Gln Asn Leu Ile Lys Gln Asn392Cys Glu Leu Phe Glu Gln Leu Gly Glu tyr Lys Phe Gln Asn Ala Leu Leu409Val Arg Tyr Thn Lys Lys Val Pro Gln Val Ser Thr Pro Thr Leu Val Glu426Val Ser Arg Asn Leu Gly Lys Val Gly Ser Lys Cys Cys Lys His Pro Glu443Ala Lys Arg Met Pro Cys Ala Glu Asp Tyr Lcu Ser Val Val Lcu Asn Gln460Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Asp Arg Val Thr Lys Cys477Cys Thr Glu Ser Leu Val Asn Arg Arg Pro Cys Phe Ser Ala Leu Glu Val494Asp Glu Thr Tyr Val Pro Lys Glu Phe Asn Ala Glu Thr Phe Thr Phe His511Ala Asp Ile Cys Thr Leu Ser Glu Lys Glu Arg Gln Ile Lys Lys Gln Thr528Ala Leu Val Glu Leu Val Lys His Lys Pro Lys Ala Thr Lys Ghu Gln Leu545Lys Ala Val Met Asp Asp Phc Ala Ala Phe Val Glu Lys cys Cys Lys Ala562Asp Asp Lys Glu Thr Cys Phe Ala Glu Glu Gly Lys Lys Leu Val Ala Ala579 585Ser Gln Ala Ala Leu Gly Leu

Claims (10)

1. form by yeast bias password basically, and through the nucleotide sequence and the function equivalent thereof of the synthetic coding human serum albumin suitably modified.

2. according to the nucleotide sequence of claim 1, wherein said modification is comprised the transcription termination sequence of intron splice site to the nucleotide sequence of coding human serum albumin, non-transcribed terminator, the modification of long tumor-necrosis factor glycoproteins, internal promoter sequence and ribosome bind site.

3. according to the nucleotide sequence of claim 1, the nucleotide sequence of wherein said coding human serum albumin is synthetic respectively three groups of each 8 nucleotide chains, and then be spliced into three nucleotide fragments with synthetic technology based on polymerase chain reaction, being one another in series through the clone with after correcting indivedual base mistakes obtains again.

4. according to the nucleotide sequence of claim 1, wherein said human serum albumin encoding sequence is had as scheming the nucleotide sequence shown in the SEQ ID NO:1.

5. comprise recombinant expression vector according to the nucleotide sequence of the coding human serum albumin of any one in the claim 1 to 4.

6. according to the recombinant expression vector of claim 5, promoter region comprising one or more methyl alcohol reactive groups by (1) methylotrophy yeast, (2) nucleotide sequence of preceding former sequence of coding cereuisiae fermentum α mating factor (AMF) and coding HSA, (3) the active transcription terminator of function is arranged in methylotrophic yeast, and (4) but expression cassette that at least one selected marker gene and bacterium replication origin are formed.

7. use methylotrophic yeast cell according to the recombinant expression vector conversion of claim 5 or 6.

8. according to the methylotrophic yeast cell of claim 7, it is the pichia pastoris phaff cell.

9. according to the methylotrophic yeast cell of claim 7, wherein said cell is to have Mut ⁺Or Mut ^-Phenotype.

10. produce the method for human serum albumin with the DNA recombinant technology, this method is included in to be suitable for expressing cultivates the yeast host cell of the nucleotide sequence that comprises the human serum albumin of encoding of preparation as stated above under the required proteinic condition, reclaim and the required human serum albumin of purifying from culture then.

Images