CN1230598A - Telomere repeated cloning-porous plate hybridization process to determine the activity of telomere enzyme - Google Patents
Telomere repeated cloning-porous plate hybridization process to determine the activity of telomere enzyme Download PDFInfo
- Publication number
- CN1230598A CN1230598A CN 98111646 CN98111646A CN1230598A CN 1230598 A CN1230598 A CN 1230598A CN 98111646 CN98111646 CN 98111646 CN 98111646 A CN98111646 A CN 98111646A CN 1230598 A CN1230598 A CN 1230598A
- Authority
- CN
- China
- Prior art keywords
- hybridization
- add
- mensuration
- telomeric repeat
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The process includes successively the steps of sample treatment, amplification, encapsulation, denatuation, hybridization, coloration, etc. Using the process in determining the activity of telomerase has the advantages of being simple, fast, low in cost, high in repeatability and high in sensitivity. The process is especially suitable for judging benign and malignant thoracic and ascitic fluid.
Description
The present invention relates to the method for a kind of people's of mensuration tissue, body fluid Telomerase Activity.
The early stage method of measuring telomerase activation is to carry out radioautograph by measuring after cell extract is added to a synthetic oligonucleotide, polyacrylamide gel electrophoresis with the telomere repeated fragment, and this method susceptibility is extremely low, is eliminated.Kim in 1994 etc. set up telomeric repeat amplifcation protocol, and this method is used a large amount of amplifications of polymeric enzyme reaction (PCR) with the reaction product of Telomerase, make the mensuration susceptibility improve 10
4Doubly, be the method that is generally adopted by the whole world in recent years, but this method need be carried out radioautograph with amplified production behind polyacrylamide gel electrophoresis, method is very numerous and diverse.Domestic have the author to replace isotropic substance to develop with argentation, but method is still numerous and diverse, and detection sensitivity but descends to some extent.German Boehringer company in 1996 is with mark digoxigenin-probe detecting end granzyme amplified production, released Telomerase-ELISA detection kit, this method has greatly been simplified PCR product detecting operation step, can draw detected result in 4 hours, but in testing process, find digoxigenin labeled system instability, often occur between the different lot numbers of the test kit that provides, and the reagent price is very expensive, can't conventionally use than big-difference.
The object of the present invention is to provide a kind of have measure susceptibility and repeatability preferably, easy fast, the telomeric repeat amplification-micropore plate hybridization method of mensuration telomerase activation that cost is low.
The object of the present invention is achieved like this:
A kind of telomeric repeat amplification-micropore plate hybridization method of measuring telomerase activation, the difference of itself and prior art is: comprise the following steps: successively
1. sample process, dissolved cell: the tissue slice mill is even, and be suspended in freezing cracking in the cold lysate, supernatant is got in centrifugation;
2. reverse transcription, amplification: with CX primer reverse transcription, to the processing of increasing of above-mentioned supernatant liquor, the CX primer is 5 ' CCCT TACCCTTACCCTTACCCTTA with the PCR reaction solution that contains the Ts primer, and the Ts primer sequence is 5 ' Biotin AATCCGTCGAGCAGCGTT;
3. solid phase and hybridization:
A) bag quilt: Streptavidin is fixed on the microwell plate;
B) sex change: with amplified production NaOH denaturing treatment;
C) hybridization and colour generation: will on microwell plate, mix through the sex change mixed solution of denaturing treatment with the hybridization solution that contains the CF probe, carry out hybridization, add enzyme labelled antibody then, and with colour generation liquid colour generation, use the microplate reader colorimetric, probe CF is 5 ' FITC-CCCTAACCCTAACCCTAACCCTAAA.
During sample process, the cold lysate of employing is: 1Ommol/L Tris-HCl, PH7.5,1mmol/L MgCl
2, 1mmol/L EGTA, 0.1mmol/L PMSF, 5mmol/L beta-mercaptoethanol, 5g/L CHAPS, 100g/L glycerine.
During amplification, used PCR reaction solution is 10XBuffer5 μ l, 1.5mmol/L MgCl
2, 0.1g/L gelatin, 200 μ mol/L dNTP, μ mol/L TS primer O.23,2 μ Taq enzymes.
The concrete steps of bag quilt are: Streptavidin is dissolved in the PH10.0 carbonate buffer solution, and 10mg/L adds 100 μ l in the every hole of microwell plate, and 4 ℃ are spent the night, and PH7.4PBS washes, and to placing clean filter paper, makes driedly, and 4 ℃ of storages are standby.
The concrete steps of sex change are: get O.6mol/LNaOH and amplified production balanced mix, room temperature 10 minutes.
Hybridization solution is 0.25gFicoll400,0.25gBSA, 0.25gPVP, 0.0625g ox DNA, adds 20XSSC31.25ml, 1mol/L HCl375ml, adds H
2O to 1000ml contains CF probe 50mmol/L.
Hybridization with the concrete steps of colour generation is: in microwell plate, add 100 μ l hybridization solutions, 25 μ l sex change mixed solutions, 37 ℃ 1 hour, PH7.4PBS gives a baby a bath on the third day after its birth time, add enzyme labelled antibody 100 μ l, 37 ℃ 30 minutes, wash plate, add TMB colour generation liquid 100 μ l, 37 ℃ 10 minutes, add 2mol/L H
2SO
4100 μ l are respectively at microplate reader 450nm and 690nm colorimetric.
The present invention has set up the micropore plate hybridization method with fluorescein-anti-luciferin system, is used for telomerase activity and has easy quick, with low cost, good reproducibility susceptibility advantages of higher, is particularly useful for judging good, pernicious ascites pleural fluid.
The invention will be further described below in conjunction with embodiment:
A kind of telomeric repeat amplification-micropore plate hybridization method of measuring telomerase activation comprises the following steps: successively
1. sample process: get tissue 50～100mg and thinly slice, grind evenly with knife blade, fragment of tissue is suspended in cold lysate (10mmol/L Tris-HCl, PH7.5,1mmol/L MgCl
2, 1mmol/L EGTA, 0.1mmol/L PMSF, 5mmol/L beta-mercaptoethanol, 5g/L CHAPS, 100g/L glycerine) in, ice-water bath 30 minutes, centrifugal 30 minutes of 12000rpm, gets supernatant and puts-30 ℃ rapidly by 4 ℃.
2. reverse transcription, amplification: at the bottom of the 0.2ml centrifuge tube, add 5.75 μ mol/L CX primers (5 ' CCCTTACCCTTACCCTTACCCTTA), 2 μ l, add 10 μ l low melt point paraffins, (Paraffin wax, Aldrich), after solidifying, paraffin adds 46 μ l PCR reaction solutions, its final concentration is 10XBuffer5 μ l, 1.5mmol/L MgCl
2, 0.1g/L gelatin, 200 μ mol/L dNTP, 0.23 μ mol/L TS primer, 2 μ Taq enzymes.Wherein the TS primer sequence is 5 ' Biotin AATCCGTCGAGCAGCGTT.Add sample process supernatant liquor 2 μ l during mensuration, 25 ℃ 30 minutes, 94 ℃ 5 minutes, 94 ℃ 30 seconds, 50 ℃ 30 seconds, 72 ℃ 90 seconds, 30 circulations, 72 ℃ 10 minutes.
3. solid phase and hybridization:
A) bag quilt: Streptavidin is dissolved in the PH10.0 carbonate buffer solution, and 10mg/L adds 100 μ l in the every hole of microwell plate, and 4 ℃ are spent the night, and PH7.4PBS gives a baby a bath on the third day after its birth time, is inverted in clean filter paper, makes driedly, and 4 ℃ of storages are standby.
B) sex change: get 0.6mol/LNaOH and amplified production balanced mix, room temperature 10 minutes.
C) hybridization and colour generation: (0.25gFicoll400,0.25gBSA, 0.25gPVP, 0.0625g ox DNA add 20XSSC31.25ml, 1mol/L HCl375ml, add H to add 100 μ l hybridization solutions in microwell plate
2O to 1000ml, contain CF probe 50mmol/L, probe CF is 5 ' FITC-CCCTAACCCTAACCCTAACCCTAAA), 25 μ l sex change mixed solutions, 37 ℃ 1 hour, PH7.4PBS gives a baby a bath on the third day after its birth time, adds enzyme labelled antibody (face with preceding and dilute with PH7.4PBS1:1000) 100 μ l, 37 ℃ 30 minutes, wash plate three times, add TMB colour generation liquid 100 μ l, 37 ℃ 10 minutes, add 2mol/L H
2SO
4100 μ l are respectively at microplate reader 450nm and 690nm colorimetric.
Claims (7)
1, a kind of telomeric repeat amplification-micropore plate hybridization method of measuring telomerase activation is characterized in that: comprise the following steps: successively
1. sample process, dissolved cell: the tissue slice mill is even, and be suspended in freezing cracking in the cold lysate, supernatant is got in centrifugation;
2. reverse transcription, amplification: with CX primer reverse transcription, to the processing of increasing of above-mentioned supernatant liquor, the CX primer is 5 ' CCCT TACCCTTACCCTTACCCTTA with the PCR reaction solution that contains the Ts primer, and the Ts primer sequence is 5 ' Biotin AATCCGTCGAGCAGCGTT;
3. solid phase and hybridization:
A) bag quilt: Streptavidin is fixed on the microwell plate;
B) sex change: with amplified production NaOH denaturing treatment;
C) hybridization and colour generation: will on microwell plate, mix through the sex change mixed solution of denaturing treatment with the hybridization solution that contains the CF probe, carry out hybridization, add enzyme labelled antibody then, and with colour generation liquid colour generation, use the microplate reader colorimetric, the CF probe is pin CF5 ' FITC-CCCTAACCCTAACCCTAACCCTAAA.
2, the telomeric repeat amplification of mensuration telomerase activation according to claim 1-micropore plate hybridization method is characterized in that: during sample process, the cold lysate of employing is: 10mmol/L Tris-HCl, PH7.5,1mmol/L MgCl
2, 1mmol/L EGTA, 0.1mmol/L PMSF, 5mmol/L B-mercaptoethanol, 5g/LCHAPS, 100g/L glycerine.
3, the telomeric repeat amplification of mensuration telomerase activation according to claim 1 and 2-micropore plate hybridization method is characterized in that: during amplification, used PCR reaction solution is 10XBuffer5 μ l, 1.5mmol/L MgCl
2, 0.1g/L gelatin, 200 μ mol/L dNTP, 0.23 μ mol/L TS primer, 2 μ Taq enzymes.
4, the telomeric repeat amplification of mensuration telomerase activation according to claim 1 and 2-micropore plate hybridization method, it is characterized in that: the concrete steps of bag quilt are: Streptavidin is dissolved in the PH10.0 carbonate buffer solution, 10mg/L, add 100 μ l in the every hole of microwell plate, 4 ℃ are spent the night, and PH7.4PBS washes, to placing clean filter paper, make driedly, 4 ℃ of storages are standby.
5, the telomeric repeat amplification of mensuration telomerase activation according to claim 1 and 2-micropore plate hybridization method, it is characterized in that: the concrete steps of sex change are: get 0.6mol/LNaOH and amplified production balanced mix, room temperature 10 minutes.
6, the telomeric repeat amplification of mensuration telomerase activation according to claim 1-micropore plate hybridization method, it is characterized in that: hybridization solution is 0.25gFicoll400,0.25gBSA, 0.25gPVP, 0.0625g ox DNA, add 20XSSC31.25ml, 1mol/L HCl375ml, add H
2O to 1000ml contains CF probe 50mmol/L.
7, according to the telomeric repeat amplification-micropore plate hybridization method of claim 1 or 6 described mensuration telomerase activations, it is characterized in that: hybridization with the concrete steps of colour generation is: add 100 μ l hybridization solutions, 25 μ l sex change mixed solutions in microwell plate, 37 ℃ 1 hour, PH7.4PBS gives a baby a bath on the third day after its birth time, adds enzyme labelled antibody 100 μ l, 37 ℃ 30 minutes, wash plate, add TMB colour generation liquid 100 μ l, 37 ℃ 10 minutes, add 2mol/L H
2SO
4100 μ l are respectively at microplate reader 450nm and 690nm colorimetric.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN98111646A CN1087033C (en) | 1998-12-29 | 1998-12-29 | Telomere repeated cloning-porous plate hybridization process to determine the activity of telomere enzyme |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN98111646A CN1087033C (en) | 1998-12-29 | 1998-12-29 | Telomere repeated cloning-porous plate hybridization process to determine the activity of telomere enzyme |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1230598A true CN1230598A (en) | 1999-10-06 |
| CN1087033C CN1087033C (en) | 2002-07-03 |
Family
ID=5221611
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN98111646A Expired - Fee Related CN1087033C (en) | 1998-12-29 | 1998-12-29 | Telomere repeated cloning-porous plate hybridization process to determine the activity of telomere enzyme |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1087033C (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101705277B (en) * | 2009-11-13 | 2012-05-23 | 南开大学 | Primers for detecting activity of telomerase |
| CN106811524A (en) * | 2017-01-19 | 2017-06-09 | 陕西师范大学 | A kind of telomerase activation colorimetric detection method |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE19644302A1 (en) * | 1995-11-28 | 1997-06-05 | Boehringer Mannheim Gmbh | Method for the detection of telomerase activity |
| JPH10215900A (en) * | 1997-02-04 | 1998-08-18 | Dai Ichi Seiyaku Co Ltd | Measurement of enzyme activity |
-
1998
- 1998-12-29 CN CN98111646A patent/CN1087033C/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101705277B (en) * | 2009-11-13 | 2012-05-23 | 南开大学 | Primers for detecting activity of telomerase |
| CN106811524A (en) * | 2017-01-19 | 2017-06-09 | 陕西师范大学 | A kind of telomerase activation colorimetric detection method |
| CN106811524B (en) * | 2017-01-19 | 2020-04-24 | 陕西师范大学 | Telomerase activity colorimetric detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1087033C (en) | 2002-07-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tao et al. | A new mode for highly sensitive and specific detection of DNA based on exonuclease III-assisted target recycling amplification and mismatched catalytic hairpin assembly | |
| CN106244698B (en) | A kind of animal derived materials detection kit | |
| US9297047B2 (en) | Molecular beacon based assay for the detection of biomarkers for breast cancer metastasis | |
| CA2321185A1 (en) | Method for detection of target nucleic acids using pcr | |
| EP1977002A1 (en) | Method for the quantification of nucleic acids, in particular bisulfite treated dna | |
| EP1241266A1 (en) | Method of detecting nucleotide polymorphism | |
| WO2007081791A2 (en) | Compare-ms:method rapid, sensitive and accurate detection of dna methylation | |
| CA3059288C (en) | Novel colorimetric sensing method for dual pathogen | |
| CA2268753A1 (en) | Nucleic acid primers and probes for detecting oncogenic human papillomaviruses | |
| Ge et al. | Sensitive and label-free T4 polynucleotide kinase/phosphatase detection based on poly (thymine)-templated copper nanoparticles coupled with nicking enzyme-assisted signal amplification | |
| Walker et al. | Detection of Mycobacterium tuberculosis DNA with thermophilic strand displacement amplification and fluorescence polarization | |
| Xu et al. | Isothermal cycling and cascade signal amplification strategy for ultrasensitive colorimetric detection of nucleic acids | |
| IE910559A1 (en) | Quantitative determination of a dna polymerase and a test¹kit useful in same | |
| CN1087033C (en) | Telomere repeated cloning-porous plate hybridization process to determine the activity of telomere enzyme | |
| CN109402128A (en) | Aflatoxin B1Aptamer, the aflatoxin B containing the aptamer1Detection kit and detection method | |
| CA3059246A1 (en) | New method for visual quantitative detection of dual heavy metal ions | |
| CN105018606A (en) | DNA quality based method for evaluation of milk freshness | |
| CN101443457B (en) | Method for production of pcr amplification product and use thereof | |
| Prescott et al. | Clinical sensitivity of p53 mutation detection in matched bladder tumor, bladder wash, and voided urine specimens | |
| CN102605084B (en) | Fluorescence in situ hybridization (FISH) method for detecting bacillus cereus and bacillus subtitles | |
| CN104328209A (en) | Primer and kit for fast detection method of leukemia minimal residual disease WT1 gene | |
| WO2001011078A8 (en) | Amplification method for detection of target nucleic acids involving fluorescence energy transfer | |
| JPH01196300A (en) | Identification of bacteria using chromosome dna and kit for said identification | |
| WO2007039101A1 (en) | Method for the quantification of nucleic acids, in particular bisulfite treated dna | |
| WO2019224731A1 (en) | Kit and method for the colorimetric detection of a target nucleic acid in a sample |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CI01 | Correction of invention patent gazette |
Correction item: Applicant Correct: Affiliated Hospital of Nantong Medical College False: Hospital Attached to Nanjing Medical College Number: 40 Page: 46 Volume: 15 |
|
| ERR | Gazette correction |
Free format text: CORRECT: APPLICANT; FROM: HOSPITAL ATTACHED TO NANJING MEDICAL COLLEGE TO: NANTONG MEDICAL COLLEGE AFFILIATED HOSPITAL |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: GR Ref document number: 1062191 Country of ref document: HK |