CN1229494C - Method of activating denatured protein - Google Patents

Abstract

Proposed is a method of preparing mixed disulphides from a protein and a disulphide component. The method is characterized in that the protein, in an inactive, sparingly soluble form, is incubated with a solution of a denaturing agent at a concentration sufficient for denaturation and in the presence of a disulphide component, dissolved and converted into a derivative. The method is suitable for the high-yield preparation of renaturated recombinant proteins from prokaryotes.

Description

The method of activating denatured protein

The present invention relates to the simplified method of the metaprotein of solubilising and renaturation metaprotein, particularly recombinant production.

When producing protein in prokaryotic cell prokaryocyte such as the intestinal bacteria, often form almost insoluble inactivating proteins aggregate (inclusion body).For these albumen are changed into activated form, need these protein of solubilising and renaturation.These methods are known, and for example at EP-A 0 361 475, EP-A 0 114 506, and EP-A 0 093 619, and EP-A 0 253 823, and WO 87/02673, among EP-A 0 364 926 and the EP-A 0 241 022 narration are arranged.The important factor that in the activation process one has limited the output of recombinant protein is that metaprotein converts the competing reaction between the gathering of accurately folding intermediate product and several protein molecules to.Owing to this reason, the concentration of recombinant protein matter is the important parameter of the output of renaturation process in the renaturation solution.The concentration increase of recombinant protein helps assembling, and has the fractional yield decline (threshold concentration) of the recombinant protein of native protein configuration.

In the production of large-scale recombinant protein, treat that the proteinic amount of renaturation is more much higher than threshold concentration usually.Because usually the solubleness of protein in the activation damping fluid that uses is low,, need the time long and buffering liquid is greatly long-pending so the shortcoming of the significant of generation is to yield poorly.

From the method that WO87/02673 understands, wherein, separate reductive agent subsequently, then preparation protein and for example allos blended disulphide between the gsh from the albumen of solubilising with the soluble protein denaturing agent and the reductive agent solubilising of inactivation.Blended disulphide helps being further purified and renaturation like this, because after thiol group (thiolgruppen) is modified, protected protein not to be subjected to the oxidation of oxygen in the air, thereby be stable in bigger pH scope.Purge process has also been simplified in the variation of net charge, because this variation can separate non-modifying protein by ion exchange chromatography.

In order to form mixed disulfide, will be from reductive agent purifying, solubilising, dialysis, reduction albumen with contain denaturing agent and be used for deutero-disulphide composition (as, GSSG, Gelucystine, cystamine) solution incubation together.After separating the disulphide composition, carry out renaturation with ordinary method.Though this process is effectively, this needs the step of many indivedual methods, particularly removes reductive agent before deriving.

Can know the method for a kind of folding and purified insulin like growth factor I from WO93/19084.According to this method, solubilising inclusion body under reductive condition subsequently, adds excessive oxidising agent without removing reductive agent.Renaturation is to begin from subsequently dilution (without dialysis) and the new reductive agent (in order to make up redox system) that adds.WO91/08762 has narrated and has prepared the process that originates from the biological activity PDGF.In this course, at first when pH3, carry out solubilising when not having reductive agent, subsequently purifying under the sex change condition.After this, add oxygenant and produce derivative.According to EP-A 0 450 386, add the solubilising damping fluid, centrifugal subsequently preparation inclusion body (the solubilising NGF albumen of sex change) extract.Handle extract with reductive agent then, incubation adds the oxygenant oxidation without dialysis in advance.Subsequently, dilute and add other composition and be used for sex change.So, in fortune one process, at first carry out solubilising as an independent step and do not add the redox active material.According to the US patent No. 4,933,434, in these methods, none is suitable for the pulse renaturation.

Known other method makes the solubilising process may carry out derivatization.Sulphite cracking process (Sulficolyse) known for a long time (as, Bailey, J.L., Cole, R.D., 1967, Enzymology method, 11,206-208; EP 0 114507).In this method, the disulphide bridges with in the sulfiting protein as reaction product, forms 50% sulphur-sulfonate (RS-SO ₃ ^-) and 50% free (RS ^-) mixture of protein-SH group.The SH group that will dissociate then converts disulphide to through reoxidizing reduction (as using cupric ion, iodosobenzoate or tetrathionate preferably), can convert thiosulphate fully to by this process disulphide of recirculation.The process of transporting is quite simple, can carry out under mild condition condition (as pH neutral).Set forth as journal of biological chemistry 234,1733, shortcoming is that the thiosulphate that forms is a chemically unstable, can not detect the completeness of conversion, and most importantly tryptophan residue is reoxidized agent and partly destroyed.Another shortcoming is to be difficult to separate fully the by product that contains thiosulphate protein-SH group and oxygenant iodosobenzoate as described.Detect this point with analytical procedure requires great effort very much.Yet for getting rid of the possible side effect with the treatment reagent of non-physiology mode chemically modified, this is absolute demand for the protein that is intended for use to treat.

WO95/30686 has also narrated the sulphite cracking process of the neurotrophic factor that is used for renaturation NGF/BDNF family.People such as R.Wetzel, people such as gene 16 (1981) 63-71 and W.F.Heath, journal of biological chemistry 267 (1992) 419-425 have narrated same proinsulin human's renaturation process.

Known one similar method, this method avoid using the condition that reoxidizes (Thannhauser, T.W., Konishi, Y., Scheraga, H.A., 1984, analytical biochemistry 138, the 181-188 that destroys side chain; Thannhauser, T.W., Scheragea, H.A., 1985, biological chemistry 24,7681-7688): under the situation that this replacement reoxidizes, when the halfcystine that disulfide bond reduction is obtained is directly derived by reacting with 2-nitro-5-(sulfo group sulfo-)-benzoate, discharged 2-nitro-5-thiobenzoate in this course, this can use spectrophotometer measurement, therefore, and can be with the SH group of quantitative assay conversion.The shortcoming of this method is to have imported complicated chemical substance, and it is very consuming time separating it from last product fully, and is difficult to detect.In addition, author's (biological chemistry 24,7681) to observe the thiosulphate that obtains be stable when lacking thiol group fully only.In addition, (arginine takes off amine) in this case also observes the modification of side chain.

The objective of the invention is in order to simplify and to improve these methods and provide stable, the protein that can store, these protein on its SH group by derivatize, and can high yield ground renaturation.

It is shocking that method of the present invention allows to carry out solubilising in single step and derives and pre reduction in advance.Derivatization that surprising especially is can occur in also that (the pH value is less than 7.0 under the acidic conditions, pH3-6.5 preferably), preferably to neurotrophin such as NGF, and, with usually relatively in the reaction of pH scope 7-10 and thiol group composition, this reaction substantially influences the kinetics of reacting and performance level and carries out.Usually suppose that such reaction is only carried out when having the free sulfuric acid salt anionic, this only occurs in the effective concentration of about pH value more than 7, because the anionic high pK value of thiolate is about 9.

So the present invention relates to produce the method for the mixed disulfide that becomes to be grouped into by protein and disulphide, its feature is to have disulphide composition (mol ratio, protein: disulphide composition 1: 1 to 1: 10000, preferably 1: 1000) time, with the protein (inclusion body) of the almost insoluble form of inactivation solution incubation with the denaturing agent of sex change concentration, solubilising and deriving, and remove or do not remove the disulphide composition subsequently.By removing the disulphide composition easily as the US patent No. 4,933, the 434 described pulse renaturation of carrying out subsequently.Deutero-protein of the present invention is stable, can store in further first being processed.This is particularly advantageous, because can produce derived protein without renaturation by method of the present invention.So derived protein can be used as isolating intermediate product and is used for multiple renaturation and purge process and/or preparation.

Selectively, exist reductive agent (as, DTT, DTE, GSH, halfcystine, cystamine, sulphite) time carry out incubation so that derived protein.This can improve derivative output.In this case, according to the actual selection reductant concentration make the disulphide composition unrestricted or only a little the restriction be favourable; Reductant concentration is up to 20 molar percentages of the concentration of disulphide composition, and it is favourable preferably producing up to 10% concentration.

Can add other reagent protection free SH group, this is by heavy metal, and free radical and activation oxygen kind partially or even wholly prevent to blockade or destroy these SH groups.This class protective material for example comprises EDTA, 0.1 to 100 mmole/rise concentration or N.F,USP MANNITOL, and 1 to 1000 mmole/liter.

The disulphide composition be understood that from the material of disulfides as, GSSG, cystamine or halfcystine.The disulphide composition after cutting disulfide linkage, the SH group in can derived protein.The preferred working concentration of disulphide be at least 1 mmole/liter or higher, preferably the 1-1000 mmole/liter, particularly preferably be the 10-200 mmole/liter.

With denaturing agent is favourable, solubilising metaprotein when denaturing agent is often used under the oxidizing condition as denaturing agent.Preferably use Guanidinium hydrochloride or other guanidinesalt as, vitriol, phosphoric acid salt or thiocyanate-and urea or derivatives thereof.The mixture that uses these denaturing agents also is possible.

The concentration of denaturing agent depends on the type of denaturing agent, and those skilled in the art can easily determine this concentration.If can reach the almost insoluble proteic complete solubilising of sex change, at this moment the concentration of denaturing agent is suitable.In the situation of Guanidinium hydrochloride, these concentration are the 3-8 mol normally, preferably the 6-8 mol.In the situation of urea, this concentration is the 6-10 mol normally.

" protein of the almost insoluble form of inactivation " is the protein that for example forms by recombinant production in prokaryotic cell prokaryocyte.These protein normally form during overexpression eukaryotic cell albumen in prokaryotic cell prokaryocyte, and this albumen is not transported in pericentral siphon or the cell conditioned medium liquid (Zelluber-stand) with activated form.In this case, the protein of reorganization generation is retained in tenuigenin or the pericentral siphon with insoluble and accumulative form.Such aggregate, their separation and purifying such as Marston F.A.O., journal of biological chemistry, 214 (1986) 1-12 are described.Cracking prokaryotic cell prokaryocyte after fermentation is so that separate inclusion body.

According to common method as, by ultrasonic, high pressure separates or N,O-Diacetylmuramidase carries out lysis.Preferably in damping fluid, carry out, regulate this pH value of solution value neutral and be suitable to slightly acidic, can be used as suspension medium as 0.1 mol Tris-HCl.Behind the molten born of the same parents of cell, mode with any needs, preferably by after with reagent wash, the insoluble composition of centrifugal or filtering separation (inclusion body), these reagent are interferencing protein not, but as far as possible fully dissolve foreign cell protein,, selectively add gentle washing agent such as Brij as water or phosphoric acid buffer ^Subsequently precipitation is carried out process of the present invention, be used for solubilising and derive.

To the alkaline pH scope, preferably between pH6 and 10, particularly preferably between 7 and 8 pH scope, carry out method of the present invention in neutrality.All damping fluids commonly used are suitable for as damping fluid; When utilizing Guanidinium hydrochloride as denaturing agent, unnecessary adding damping fluid is because it has shock absorption.The damping fluid of preferred use well known by persons skilled in the art such as Tris or phosphoric acid.Surprising is, method of the present invention also can be particularly advantageous for neurotrophin, even under acidic conditions (pH3-6.5).

Add disulphide and carry out method of the present invention.Preferred disulphide composition is GSSG, cystamine and halfcystine.Because derivatization reaction is the protein of mercaptan form and the balanced reaction between the disulphide composition, or, balanced reaction between blended disulphide and the free mercaptan composition (Thiolkomponente), the former is become to be grouped into disulphide by protein, the latter is remaining protein thiol group and the mercaptan composition that is discharged by the proteins react with the mercaptan form by the disulphide composition.Therefore the derivatization reaction that needs must apply highly excessive disulphide composition.The condition of this reaction needed is very different between protein.The disulphide composition that preferably uses 10 mmoles/be raised to limit of saturation concentration range is (as at GSSG, the pH value that depends on preparation, for the ca.200-300 mmole/liter, for cystamine, the ca.700 mmole/liter), the 50-100% of disulphide composition saturation concentration is particularly preferred concentration range.

In the method for the invention, it also is preferred adding reductive agent.Reductive agent from thiol group is particularly preferred as reduced glutathione (GSH) or 2 mercapto ethanol, dithioerythritol (DTE) or dithiothreitol (DTT) (DTT), concentration range be the 0.01-50 mmole/liter, preferably the 0.1-10 mmole/liter.Preferred in addition reductive agent such as sulphite are as S-WAT.Though adding a kind of in these reductive agents is not the prerequisite of successfully reacting,, activate again when depending on the protein of processing when proteinic, add the raising that reductive agent causes output.

At 0.1-100 hour, preferably 1-24 hour, particularly preferably 2-4 hour, at room temperature preferably carry out method of the present invention.But other condition is as being heated to about 60 ℃ or to be cooled to about 0 ℃ method also be suitable.In order to prevent atmospheric oxygen to the oxidation of reductive agent and the free SH group of protection, it is favourable adding EDTA, and preferred amount is the 1-100 mol, particularly preferably be about 10 mmoles/liter.In order to suppress the free radical side reaction, this reaction can occur in the solution that contains mercaptan, during particularly quite high pH value, in the proteinic renaturation and/or the course of processing, adding free radical interceptors (quencher) is favourable as N.F,USP MANNITOL, concentration be 1 to 1000 mmole/liter, preferably concentration be 20 to 200 mmoles/liter, particularly preferably concentration be 50 mmoles/liter.

At solubilising/after deriving, preferably in the denaturing agent that contains sex change concentration, dialyse, in order to remove the disulphide composition and can to add the reductive agent that can not add.Dialysis solution advantageously contains denaturing agent, and is identical in concentration and the sex change/derivative solution.Equally preferably to the dialysis of the denaturing agent of other same volumetric molar concentration, as to ca.1 mmole/the rise acetate of HCl or dilution.In addition, it also is favourable not exclusively separating disulphide; Because having explained derivatization reaction is the balanced reaction between free mercaptan composition and (can mix can be unmixed) disulphide composition.If all protein thiol groups are not also derived fully, after separating the disulphide composition, the danger that exists is that free mercaptan composition residual in the process of storage derived protein will have reductive action to the mixed disulfide that exists, and the output of deriving will descend subsequently.For not oxidation of derivatization protected protein matter thiol group and the purpose that same destructive side reaction does not take place, handling the proteic degree of deriving must be high as much as possible and stable.This can be by in the premature termination dialysis before below the proper concn of the density loss of disulphide composition, or dialyses and reach containing the dialysis buffer liquid that needs the disulphide of concentration composition in dialyzate.The concentration that keeping the degree of deriving in storage derived protein process needs depends on relevant processing protein and particularly depends on the proteinic cysteine content of processing, this concentration can be scope be the 0-100 mmole/liter concentration.Consider that further use derived protein is used for activating reaction again, must be noted that adding the disulphide composition in activation process does not again have or have only insignificant effect to the oxidation key of the intermolecular or intramolecular disulphide bridges needs that are used for this situation.Owing to this reason, verified in derived protein about 1-10 mmole/liter the residual concentration of disulphide composition be favourable.

Another theme of the present invention is the process of producing recombinant protein in its almost insoluble form of inactivation that obtains after the recombinant production in prokaryotic organism, its feature be with inactivation almost insoluble form protein with sex change concentration with the denaturing agent incubation that has the disulphide composition, the solubilising and (the molar ratio protein: disulphide composition 1: 1 to 1: 10000 of deriving, preferably 1: 1000), solubilized protein has been taked the biologic activity configuration, method is that the intensive denaturing soln is changed over weak or non-denaturing soln, wherein add redox system and open disulfide linkage with the disulphide composition, intramolecularly newly forms disulfide linkage in protein by this way, in this mode, protein has been taked the configuration of its distinctive biologic activity.

When having reductive agent, dilute or preferably dialyse and to reach so faint sex change condition.Opposite with strong sex change condition, faint sex change condition is in such condition: under these conditions, protein is taked active configuration, and can stablize in this configuration.Under strong sex change condition, the protein instability of this form trends towards sex change, that is, lose it stable three-dimensional structure and energy on favourable disulfide linkage.The condition of strong sex change for example is present in the 4-9 mol guanidine hydrochloride solution.Faint sex change condition is present in for example 0.1-2 mol Guanidinium hydrochloride.Adding concentration in renaturation process also is favourable at the arginine of 0.1 and 1 mol.

Activity of proteins is proteinic biologic activity.If the derivative of naturally occurring protein or natural protein, can be by proteinic immunology, cytobiology or catalysis characteristics are determined its biologic activity.

GSH concentration be the 0.1-20 mmole/liter, GSSG concentration is 0.01-10 mmole/liter do not have denaturing agent or preferably activates (renaturation) when the non-sex change concentration of denaturing agent, preferably activates 1-300 hour period again.In this case, GSH concentration preferably the 0.5-10 mmole/liter and/or GSSG concentration preferably the 0.1-10 mmole/liter.

Method of the present invention is applicable to the metaprotein that renaturation is a large amount of, particularly the metaprotein of reorganization ground production.Such protein for example is proteolytic enzyme, somatomedin, proteohormone, cytokine, plasminogen activator, Xa factor, particularly neurotrophin.Neurotrophin is the protein of finding in neurocyte especially, and it supports the differentiation and the existence of neurocyte.So neurotrophin (as NGF, originates from the nerve growth factor (BDNF) of brain, neurotrophic factor 3,4/5,6) is valuable cell therapy reagent, can be used for treating neurodegenerative disease, as polyneuropathy (polyneuropathy), Alzheimer disease or brain and Spinal injury.

Growth factor of human nerve (NGF) is the protein that two subunits are formed.Have been found that the energy for growth that the β subunit has influences Sensory neurone and sympathetic neuron.Sophisticated NGF is made up of 118 amino acid, contains three disulphide bridgeses, is nonglycosylated.Biologic activity NGF is a dimer.DNA and the aminoacid sequence of NGF have been narrated among the EP-B 0 121 338 (USP 5,169,762).But the active protein that obtains it by this method is impossible.Production such as the EP-A 0 329 175 of active reorganization NGF, EP-A 0 370 171, Biochem.Biophys.Res.Commun.171 (1990) 116-122, EP-A 0 414 151, gene 70 (1988) 57-65, EP-A 0,450 386 and gene (1989), 109-114 is described.

People such as Leibrock, nature 341 (1989) 149-152 have narrated the neurotrophic factor (BDNF) that originates from brain.BDNF supports the existence of Sensory neurone in the neural system of center, and has seemingly successfully treated Parkinson's disease.Reorganization BDNF can produce in prokaryotic cell prokaryocyte in Chinese hamster ovary celI and according to WO92/22665 according to WO91/03568.

The following examples, publication and sequence solution have further been set forth the present invention, the protection scope of the present invention that is produced by the claim of patent.The method of having narrated is interpreted as illustration, even still narrates theme of the present invention after modifying.

Embodiment 1

At expression in escherichia coli NGF

A) expression plasmid

On the basis of the disclosed sequence of people such as Ullrich (natural 303:821,1983) and by particularly mixing the ngf gene that the part of encoding mature has been synthesized in some modifications in 5 ' part.The method (1991, natural 352:548-549) of Beattie and Fowle is used for said process.In order to simplify the clone, at 5 ' the terminal cleavage site that inserts Restriction Enzyme EcoRI, at 3 ' the terminal cleavage site that inserts Restriction Enzyme HindIII.Cut synthetic nucleic acid with enzyme EcoRI and HindIII, and be connected with expression vector pA27fd (EP-A-0 382 174), this carrier partly digests with EcoRI digestion with HindIII in advance.With the prepared product that connects with helper plasmid pUBS520 transform into intestinal bacteria (people such as Brinkmann, gene 85 (1989), 109-114).

Select the clone by penbritin and kalamycin resistance that plasmid transmits.The plasmid that obtains contains the littler EcoRI/HindIII segment compared with prothyl grain pA27fd, and size is about 400bp.

B) expression in escherichia coli

In order to detect expression output, when having penbritin and kantlex (each 50 mcg/ml of final concn), in the LB substratum, cultivate the intestinal bacteria that transform with plasmid pNGF23fd and pUBS520, reach the OD value of one 550 nanometer.Add 5 mmoles/liter IPTG begin to express.The incubation culture is 4 hours again.Subsequently, by centrifugal collection intestinal bacteria and in damping fluid resuspending; (50 mmoles/rise Tris-HCl, pH8,50 mmoles/rise EDTA) molten born of the same parents intestinal bacteria of sonic treatment.Collect the insoluble protein part by recentrifuge, and by sonic treatment, resuspending in the damping fluid of mentioning in front.In suspension, add 1/4th and use damping fluids (250 mmoles/rise Tris-HCl pH6.8,0.01 mol EDTA, 5%SDS, 5% mercaptoethanol, 50% glycerine and 0.005% bromjophenol blue), the auxiliary of the sds page 12.5% analyzed down.(pNGF23fd, same prepared product pUBS520) is added on the polyacrylamide gel in contrast not add the colibacillary culture of IPTG.After with 0.2% Coomassie blue R250 (being dissolved in 30% ethanol and 10% acetate) dyeing gel, see that molecular weight in the prepared product of IPTG inductive culture is about the band clearly (comparing with the standard protein mixture of Biorad " H+L ") of 14 kilodaltons.Do not find this band in the Bacillus coli cells non-inducing.

Embodiment 2

The preparation inclusion body (=IBs)

In order to prepare the IBs that contains the NGF that recombinates, 10 liters fermentation cylinder for fermentation embodiment, 1 described escherichia coli expression bacterial strain 8 hours.After beginning fermentation, the expression of inducing NGF at the interim adding of logarithmic growth IPTG.By centrifugal results 690 gram biomasss after fermenting 8 hours.This biomass is being added 0.7 N,O-Diacetylmuramidase, be suspended in behind 7 milligrams of DNase and 0.4 mmole/the rise MgSO4 among 3.5 liter of 0.1 mol Tris-HClpH7,0 ℃ of incubation 20 minutes.Carry out the molten born of the same parents of cell completely subsequently by pressing to separate at 1000 Bagaos.With DNase add again molten born of the same parents' solution to the last concentration be 0.1 mg/ml, MgSO ₄Final concn be 2 mmoles/liter, with solution 20 ℃ of incubations 30 minutes.After DNase handles, with the 6%Brij35 of half volume, 1.5 mol NaCl, 60 mmoles/rise EDTA, pH7.0 dilutes, and in ice bath incubation 20 minutes.The insoluble composition of centrifugation subsequently (IBs).Precipitation is suspended in 0.1 mol Tris-HCl of 3 times of volumes, and 20 mmoles/rise EDTA are among the pH6.5 (TE damping fluid), at 20 ℃ of incubations after 30 minutes, once more by centrifugal collection IBs.To be deposited in subsequently in the TE damping fluid of 3 times of volumes and carry out resuspending.After 30 minutes, in precipitation, obtain IBs at 20 ℃ of incubations by recentrifuge.

In order to determine the amount of rh-NGF among the IBs, with 7.5 mol Guanidinium hydrochlorides (GdmHCl) and 10 mmoles/rise EDTA, pH6.0 suspends the volume of 10 milliliters of 500 milligrams of IBs (weight in wet base) formations 2 hours.(Boehringer Mannheim, sequence number (SN) .124281) determines Protein content in the solution by the Biuret protein determination.By SDS capillary electrophoresis separation solubilising in IBs with the SDS sex change and with DTE reductive protein after, behind the sds gel electrophoresis isolated protein, by peak zone and standard N GF relatively or to the photo densitometry in sample road determined amount (as, BoeringerMannheim sequence number (SN) 1457616) with respect to the rh-NGF of total protein content.Isolating IBs contains ca.6 gram rh-NGF from 10 liters of fermenting broths.

Embodiment 3

The solubilising and the rh-NGF that derives

A) preparation solubilising product

IBs is suspended in 7.5 mol GdmHCl, 0.1 mol Tris-HCl, 10 mmoles/rise EDTA and 0.1 mol DTT are 20 to 200 gram IBs/ liters up to concentration among the pH8.5, at 20-25 ℃, stir 2 hours.With 25%HCl pH value of solution is adjusted to 3 subsequently, is cooled to 4 ℃.With the solubilising product diafiltration on ultra-filtration membrane in the cross flow filtering apparatus that obtains by this way, discharging the limit is the 7.5 mol GdmHCls of 10 kilodaltons to the 6-10 volume, 10 mmoles/rise EDTA, pH3 or in dialysis tubing to same damping fluid dialysis several times.

B) from the solubilising product, prepare derivative (this area state)

The no DTT that obtains among the embodiment 3a is dialysed the solubilising product with 20 mmoles/rising GSSG mixes, by being adjusted to pH7.5 with 1 mol Tris titration.The mixture that obtains 20-25 ℃ of incubation 2 hours, is adjusted to pH6 with 25%HCl then, is cooled to 4 ℃.With the derivative that obtains by this way at 4 ℃, in the crossing filtering device, by the ultra-filtration membrane diafiltration, discharging the limit is the 7.5 mol GdmHCls of 10 kilodaltons to the 6-10 volume, 10 mmoles/rise EDTA, pH6, or in dialysis tubing, same damping fluid is dialysed several times.

C) directly prepare derivative (the method according to this invention) from IBs

IBs is suspended in 7.5 mol GdmHCl, 0.1 mol Tris-HCl, 10-200 mmole/rise GSSG, 10 mmoles/rise EDTA, in the solution of pH6, the concentration of IBs is 20 to 200 grams per liters, stirs 3 hours at 20 to 25 ℃.The derivative that will obtain by this way is at 4 ℃, in exchanging strainer, by ultra-filtration membrane (blocking threshold is 10 kilodaltons) diafiltration subsequently, 7.5 mol GdmHCl to the 6-10 volume, 10 mmoles/rise EDTA, pH6 perhaps dialyses several times to same damping fluid in dialysis tubing.

With similar method, in derivatization process, carry out directly deriving of IBs at pH6 at pH value 3-10 with in diafiltration process, before dialysis, the pH value is adjusted to 6 with NaOH or HCl.Be lower than in the pH value under 6 the situation, GSSG concentration be increased to 300 mmoles/liter.Before beginning to derive by the centrifugal GSSG that removes the not solubilising that may exist.

Detect derivatization completely by sds gel electrophoresis and mass spectrum (MALDI-MS).Show that embodiment 3c obtains derive degree than with derivatization process in the derivatization carried out of the technology (embodiment 3b) of the front that has nothing to do of pH value much higher.

Utilize fresh material and be stored at 4 ℃ the material detection derivative and the renaturation behavior (referring to the details of embodiment 4) of solubilising product.With pH value after irrelevant 4 weeks, showed unaltered renaturation behavior according to the derivative of 3c preparation in process of production, the renaturation output of solubilising product drops to 60%, and drops to 80% according to the derivative (3b) of previous technique preparation.As expection, the data consistent of this and MALDI-MS, the stability of derivative depends on the degree of deriving.

Embodiment 4

The renaturation of rh-NGF

Rh-NGF for preparation biologically active from the solubilising product/derivative of embodiment 3 preparations, with 1 mol Tris-HCl, 0.5 mol arginine, 1 mmole/rise EDTA, 1 mmole/rise GSH, the renaturation buffer that pH9.1 forms will contain inactivation at 4 ℃, 20 to 500 times of the solution dilutions of soluble form.

In order to detect renaturation rh-NGF, by POROS R1/H post (2.1 * 100 millimeters, Perseptive Biosystems, Freiburg Germany) goes up reversed phase chromatography, at incubation quantitative mixture after 24 hours.The acetonitrile (0.1%TEA) of 5% in the water as initial damping fluid, is used up to the acetonitrile in 80% water (0.1%TEA) gradient and carried out wash-out at 20 minutes flow velocitys with 1 ml/min.Partly identify natural NGF by evaporation wash-out in biological assay (referring to following).

Rh-NGF stimulated the Sensory neurone of the chick embryonic dorsal root ganglion that comes self-decomposition so as to produce dendron ability (test of=DRG test=dorsal root ganglion, Levi-Montalcini, R., Meyer, H. and Hamburger, V.1954, cancer summarizes 14,49-57; Varon, S., Nomura, J., Perez-Polo, J.R. and Shooter, E.M., 1972, Meth. neurochemistry, 3,203-229; EP-A0335673,14-15, embodiment c) be used for determining in the HPLC part or directly in the concentration that bioactive rh-NGF is arranged of the renaturation of renaturation solution.

In the flat board in 48 holes, in 1: 2 step, in the dilution series of c=100 pg/ml concentration, test the HPLC part with the c=100 nanograms/milliliter.In this course, with 300 microlitre substratum (F14 substratum; Coon, M.G. with Wei β, M.G., 1969, U.S.'s nucleic acid resistance process 62,862-859) add that with 100 microlitre cell suspending liquids telling the 100 microlitre diluents of stating (=final concn c=20 nanograms/milliliter is to 20 pg/ml) in person mixes in the cell cultures flat board from Falcon company, and at 37 ℃ and 3.5%CO ₂Shi Wenyu 48 hours.As the bioactive cell number that has quantitatively formed dendron of measuring.With concentration known is that the NGF solution from the mouse submaxillary gland (Boeringer Mannheim company) of 2.5S is with for referencial use.Centrifugal and with the F14 substratum selectively in advance the dilution after detect the renaturation prepared product similarly.

Embodiment 5

The catalytic domain of clone FX proteinase gene

(plasmid: pFX-CD)

Method

The preparation dna technique

As molecular cloning: laboratory manual, cold spring harbor laboratory publishes, the cold spring port, New York, Sambrook, the standard method of people such as J. (1989) narration is used to operate DNA.Molecular biology reagent is used in guidance according to manufacturers.

Protein determination

The molar extinction coefficient that utilization is calculated according to aminoacid sequence (ε=43490 centimetre ²/ mole) determine the optical density(OD) of 280 nanometers to determine the protein concn of protease mutant fFX-EGF2-AP-CD.

Expression vector

The basis that is used to express the carrier of blood coagulation protease mutant is the expression vector pSAM-CORE of core streptavidin.Kopetzki, people such as E. have narrated preparation and the explanation of plasmid p-SAM-CORE in WO93/09144.

In the pSAM-CORE carrier, the mutant proteinase gene substitution that needs core streptavidin gene.

The clone

According to Mullis, K.B. and Faloona, F.A. (Enzymology method, 155, (1987) 350-355) utilizes PCR primer N1 (SEQ ID NO:1) and N2 (SEQ ID NO:2)

N1：5’- EcoRI?BspHI

AAAAAAGAATTCTC ATGATCGTGGTGGGAGGCCAGGAATGCAAG-3’

N2：5’-

HindIII

AAAAAAAAGCTTCATTACTTGGCCTTGGGCAAGCCCCTGGT-3’

With from (the La Jolla of Stratagene company, CA, the U.S.) the people liver cDNA gene pool that market can get is as the template FX cDNA that increases in polymerase chain reaction (PCR), this cDNA is a coding, and (cDNA nucleotide sequence and aminoacid sequence numbering are according to Kaul, people's such as R.K. publication (gene 41 (1986) 311-314) from the base pair 649 to 1362 in the FX proteolytic enzyme district of amino acid position 217 to 454.The PCR primer is imported the cleavage site of 3 ' terminal special HindIII of 5 ' terminal special BspHI cleavage site of coding region and coding region.

Utilize restriction enzyme BspHI and HindIII to digest the long PCR product of about 740bp, behind the agarose gel electrophoresis purifying, the BspHI/HindIII-FX segment that 725bp is grown connects in the NcoI/HindIII-pSAM-CORE carrier segment that into 2.55kbp grows.Detect needing plasmid pFX-CD and passing through the isolating FXcDNA sequence of PCR with dna sequencing by the estriction map evaluation.

Embodiment 6

The clone contains EGF2 district, the FX proteinase gene (plasmid: pFX-EGF2-AP-CD) of activating peptide and catalytic domain

Utilize PCR primer N3 (SEQ ID NO:3) and N2 (SEQ ID NO:2)

N3：

EcoRI

5’AAAAAAGAATCCATTAAAGAGGAGAAATTAAA ATGCGGAAGCTCTGCAGCCTGGACAAC-3’

With the people liver cDNA gene pool (carrier: λ ZAP that will can get from the market of Stratagene company (La Jolla, CA, the U.S.) ^II) pass through pcr amplification FX cDNA as template DNA, FX cDNA is from bp322 to 1362, and coding is from the EGF district of amino acid position 108 to 454, activating peptide and catalytic protein enzyme district.The PCR primer has imported the cleavage site of HindIII of 3 ' terminal uniqueness of 5 ' terminal ATG initiation codon of coding region and single EcoRI cleavage site and coding region.

Digest the long PCR product of about 1.09bp with restriction enzyme EcoRI and BstEII, behind the sepharose purifying, the EcoRI/Bs tEII-FX segment that 1.02kbp is long connects in the carrier segment (embodiment 5) of the long EcoRI/BstEII-pFX-CD of 2.58bp into.Need plasmid pFX-EGF2-AP-CD and the isolating FX cDNA of PCR sequence by what dna sequencing detection limit collection of illustrative plates was identified.

Embodiment 7

A) at the expression in escherichia coli proteinase gene

For expressing protein enzyme gene, utilize embodiment 6 described expression plasmid pFX-EGF2-AP-CD (amicillin resistance) and lacI ^qRepressor plasmid pUBS520 (kalamycin resistance, preparation and explanation are referring to Brinkmann, people such as U., gene 85 (1989) 109-114) transformed into escherichia coli K12 bacterial strain is (as UT5600 Grodberg, J. and Dunn, J.J.Bacteriol.170 (1988) 1245-1253).

At the DYT substratum that contains 50-100 mg/litre penbritin and 50 mg/litre kantlex (1% (w/v) yeast extract, 1% (w/v) Bacto tryptone, Difco and 0.5%NaCl) in, at 37 ℃, the jolting culture is cultivated the optical density(OD) (OD of the UT5600/pUBS520/pFX-EGF2-AP-CD cell of conversion up to 550 nanometers ₅₅₀) be 0.6-0.9, induce (final concn 1-5 mmole/liter) with IPTG subsequently.At 4-8 hour (h), 37 ℃ induce after, centrifugal collecting cell (Sorvall RC-5B whizzer, GS3 rotary head, 6000rpm, 15 minutes) with 7.2 washings of 50 mmoles/rise Tris-HCl pH of buffer, and is stored at-20 ℃ up to further processing.From 1 liter of jolting culture, produce 4-5 gram cell (weight in wet base).

B) expression analysis

Sedimentary cell resuspending in 1 milliliter of centrifugal substratum under the various situations in 0.25 milliliter of 10 mmole/rise Tris-HCl, among the pH7.2, is used to the Sonofier from Branson company (Heusenstamm, Germany) ^Cracker B15 is by the molten born of the same parents' cell of ultrasonication (in 50% intensity, 30 seconds 2 subpulses).Make insoluble cellular constituent precipitation (Eppendorf5415 sedimentator, 14000rpm, 5 minutes) and in supernatant liquor, add 1/5 volume, 5 * SDS sample buffer (1 * SDS sample buffer: 50 mmoles/rise Tris-HCl, pH6.8,1%SDS, 1% mercaptoethanol, 10% glycerine, 0.0001% bromjophenol blue).With insoluble cell debris part (precipitation) resuspending in 1 * SDS sample buffer of 0.3 milliliter of urea that contains the 6-8 mol, with sample at 95 ℃ of incubations 5 minutes, recentrifuge.Then, also use Coomassie brilliant blue R dyeing by sds page (PAGE) electrophoretic separation protein (Laemmli, U.K., nature 227 (1970) 680-685).

Synthetic FX-EGF2-AP-CD protease mutant is a homogeneous in intestinal bacteria, and all (inclusion body IBs) is found in insoluble cell debris part.Expressing output is 50% of total Escherichia coli protein.

Embodiment 8

Cell bacteriolyze, solubilising and the preparation of inclusion body (IBs)

Will from cell precipitation (the 15 gram weight in wet base) resuspending of 3 liters jolting culture in 75 milliliter of 50 mmole/liter Tris-HCl, pH7.2.Suspension is mixed with 0.25 mg/ml N,O-Diacetylmuramidase, 0 ℃ of incubation 30 minutes.Adding 2 mmoles/rise MgCl ₂Behind 10 mcg/ml DNase I (Boehringer Mannhein GmbH, catalog number (Cat.No.) 104159), by at French from SLM Amico company (Urabana, IL, the U.S.) ^The forcer mesohigh disperses, and mechanically decomposes cell.At room temperature subsequently, (RT) dna digestion is 30 minutes.In prepared product, add 37.5 milliliter of 50 mmole/rise Tris-HCl pH7.2,60 mmoles/rise EDTA, 1.5 mol NaCl, 6%Brij X-100, at room temperature further incubation 30 minutes is in (the GSA rotary head of Sorvall RC-5B sedimentator, 12000rpm, 15 minutes) in centrifugal.Abandon supernatant liquor, in precipitation, add 100 milliliter of 50 mmole/rise Tris-HCl, pH7.2,20 mmoles/rise EDTA 4 ℃ of incubations 30 minutes, stirs and precipitation once more.Repeat last washing step.-20 ℃ the storage purifying IBs (1.5-2.0 restrains weight in wet base, 25-30 ℃ of dry weight, 100-150 milligram proteolytic enzyme) up to further processing.

Embodiment 9

Solubilising and reduction/derive and dialyse IBs

The IBs of purifying is suspended in 6 mol Guanidinium hydrochlorides, 100 mmoles/rise Tris-HCl, 20 mmoles/rise EDTA, among the pH8.0, the sedimentary concentration of IBs is 100 milligrams (weight in wet bases), corresponding protein concn is the 5-10 mg/ml, and the solubilising aliquots containig at room temperature exists 200 mmoles/rise GSSG or 200 mmoles/stirred 1 to 3 hour when rising GSH simultaneously.Separate insoluble composition by centrifugal (Sorvall RC-5B sedimentator, SS34 rotary head, 16000rpm, 15 minutes), at 4 ℃, in 6 mol Guanidinium hydrochlorides, dialyse insoluble composition 24 hours of pH5.0.Detect derivative by SDS-PAGE.

Embodiment 10

The renaturation of FX-EGF2-AP-CD relies on reduction/deutero-

By at 5 milliliters of renaturation buffers (50 mmoles/rise Tris-HCl, 0.6 mol arginine/10 mmoles/rise CaCl ₂/ 2 mmoles/rise EDTA/2 mmole/rise GSH/0.5 mmole/rise GSSG, pH8.5) single adding 50 microlitre IB hydrotrope/derivatives in, in the time of 4 ℃, carry out renaturation to solubilising in 6 mol Guanidinium hydrochlorides with 100 mmoles/rise DTE reduction or with the GSSG/GSH deutero-FX-EGF2-AP-CD protease mutant of different concns.

To the .50 mmole of 100 times of volumes/rise Tris-HCl, 150 mmoles/rise NaCl, 5 mmoles/rise CaCl ₂, 0.1% polypropylene glycerine 8000 (PEG8000), pH8.0, at 4 ℃, the dialysis recombinant protein was twice in 8-16 hour.By protein precipitation by centrifugation matter (EPPendorf5415 sedimentator, 14000rpm, 5 minutes), limpid supernatant liquor is used for activation.

Embodiment 11

Activate the rFX-EGF2-AP-CD protease mutant with RVV-X

In all cases, with 1 milliliter of renaturation and dialysis rFIX-EGF-AP-CD sample and 10 microlitres from the Sigma Aldrich Chemie GmbH (Deisenhofen of company, GFR) (1 mg/ml lyophilized products is dissolved in 20 mmoles/rise Tris-HCl to Russel viper venom (RVV) solution, pH7.6) mix, and at 37 ℃ of incubation 1-2 days.Utilize chromogene peptide substrates Chromozym X (referring to embodiment 12) detect enzyme to the activationary time process of rFX-EGF2-AP-CD up to complete digestion (plateau, maximum activation).In this process,, determine the Fxa activity that produces from the interval sampling (20 microlitre) of reaction mixture at 4-6 hour.

Embodiment 12

The Fxa active testing

Be used to determine renaturation and activity activatory rFXa-EGF2-AP-CD from the chromogene substrate Chromozym X of Boehringer Mannheim GmbH (Mannheim, GFR, catalog number (Cat.No.) 789763).With 20 microlitre samples and 180 microlitres, 50 mmoles/rise Tris-HCl, 150 mmoles/rise NaCl, 5 mmoles/rise CaCl ₂, 0/1%PEG8000, pH8.0 and 20 microlitres, 4 mmoles/rise Chromozym X in the droplet flat board, at room temperature mix, by in ELI SA reader, determine linear initial gradient (Δ A/ minute) at 405 nano measurement light absorption values.

The test principle

Measurement signal: pNA (p-N-methyl-p-nitroaniline)

Fxa substrate: MOC-D-NleGlyArg-pNA (Chromzym X)

Test mixing thing: 180 microlitre damping fluids

+ 20 microlitre substrates (Chromozym X, 4 mmoles/liter)

+ 20 microlitre rFXa-EGF2-AP-CD samples

Embodiment 13

Determine annealing efficiency

The rFXa-EGF2-AP-CD activity (plateau value) that produces is used to calculate annealing efficiency.Maximum in will be in measuring series is set at 100% as a reference.

Relatively reducing the renaturation output that albumen causes with derived protein is 60%.

The reference table

Bailey, J.L, Cole, R.D., journal of biological chemistry 234 (1959) 1733-1739

Beattie and Fowle, nature 352 (1991) 548-549

People such as Brinkmann, gene 85 (1989) 109-114

Cole, R.D., Meth. zymetology 11 (1967) 206-208

Coon, M.G. and Wei β, M.G., U.S. nucleic acid science process 62 (1969) 852-859

EP-A?0?093?619

EP-A?0?114?506

EP-A?0?114?507

EP-A?0?253?823

EP-A?0?329?175

EP-A?0?335?673

EP-A?0?361?475

EP-A?0?364?926

EP-A?0?370?171

EP-A?0?382?174

EP-A?0?414?151

EP-A?0?450?386

EP-B?0?121?338(USP?5,169,762)

Gene 70 (1988) 57-65

Grodberg, J.; Dunn, J.J.: bacteriology magazine 170 (1988) 1245-1253

Heath, people such as W.F., journal of biological chemistry 267 (1992) 419-425

Kaul, R.K., Hildebrand, B.; Roberts, S.; Jagadeeswaran, P., gene 41 (1986) 311-314

Laemmli, U.K., nature 227 (1970) 680-685

People such as Leibrock, nature 341 (1989) 149-152Levi-Montalcini, R.Meyer, H. and Hamburger, V., cancer summary 14 (1954) 49-57

Marston F.A.0., journal of biological chemistry 214 (1986) 1-12

Mullis, K.B.; Faloora, F.A., Enzymology method 155 (1987) 350-355

Sambrook, J.; Fritsch, E.F.; Maniatis, T.: molecular cloning: laboratory manual.Cold spring port press, cold spring port, New York (1989)

Thannhauser, T.W., Konishi, Y., Sheraga, H.A., Analyt. biological chemistry 138 (1984) 181-188

Thannhauser, T.W., Scheraga, H.A., biological chemistry 24 (1985) 7681-7688

People such as Ullrich, nature 303 (1983) 821-825 United States Patent (USP)s 4,933,434

Varon, S., Nomura, J., Perez-Polo, J.R. and Shooter, E.M., Meth. neurochemistry 3 (1972) 203-229

Wetzel, people such as R., gene 16 (1981) 63-71

WO87/02673

WO91/03568

WO91/08762

WO92/22665

WO93/09144

WO95/30686

Sequence table

(1) general information:

(I) applicant:

(A) name: BOEHRINGER MANNHEIM GMBH

(B) street: Sandhofer street 116

(C) city: Mannheim

(E) country: Germany

(F) postcode (ZIP): D-68305

(G) phone: 08856/60-3446

(H) fax: 08856/60-3451

(ii) invention exercise question: the process of activating denatured protein

(iii) sequence number: 4

(iv) computer-reader form:

(A) media type: floppy disk

(B) computer: IBM PC compatible

(C) operating system: PC-DOS/MS-DOS

(D) software: PatentIn Release#1.0, #1.30B version (EPO)

(2) information of SEQ ID NO:1:

(I) sequence signature:

(A) length: 41 base pairs

(B) type: Nucleotide

(C) chain number: strand

(D) geometry: linearity

(ii) molecule type: other nucleic acid

(A) narration :/desc=" primer "

(ix) sequence description: SEQ ID NO:1

AAAAAAGAAT?TCTCATGATC?GTGGGAGGCC?AGGAATGCAA?G 41

(2) information of SEQ ID NO:2

(I) sequence signature:

(A) length: 41 base pairs

(B) type: Nucleotide

(C) chain number: strand

(D) geometry: linearity

(ii) molecule type: other nucleic acid

(A) narration :/desc=" primer "

(ix) sequence description: SEQ ID NO:2

AAAAAAAAGC?TTCATTACTT?GGCCTTGGGC?AAGCCCCTGG?T 41

(2) information of SEQ ID NO:3

(I) sequence signature:

(A) length: 59 base pairs

(B) type: Nucleotide

(C) chain number: strand

(D) geometry: linearity

(ii) molecule type: other nucleic acid

(A) narration :/desc=" primer "

(ix) sequence description: SEQ ID NO:3

AAAAAAGAAT?CCATTAAAGA?GGAGAAATTA?AAATGCGGAA?GCTCTGCAGC?CTGGACAAC 59

(2) information of SEQ ID NO:4

(I) sequence signature:

(A) length: 394 base pairs

(B) type: Nucleotide

(C) chain number: strand

(D) geometry: linearity

(ii) molecule type: cDNA

(ix) sequence description: SEQ ID NO:4

AGAATTCAAG?AAGGAGATAT?ACATATGTCA?TCATCACATC?CAATCTTCCA?CAGGGGCGAG 60

TTCTCGGTGT?GTGACAGTGT?CAGCGTGTGG?GTTGGGGATA?AGACCACCGC?CACAGATATC 120

AAGGGCAAGG?AGGTGATGGT?GTTGGGAGAG?GTGAACATTA?ACAACAGTGT?ATTCAAACAG 180

TACTTTTTTG?AGACCAAGTG?CCGGGACCCA?AATCCCGTCG?ACAGCGGGTG?CCGGGGCATT 240

GACTCAAAGC?ACTGGAACTC?ATATTGTACC?ACGACTCACA?CCTTTGTCAA?GGCGCTGACC 300

ATGGATGGCA?AGCAGGCTGC?CTGGCGGTTT?ATCCGGATAG?ATACGGCCTG?TGTGTGTGTG 360

CTCTCTAGAA?AGGCTGTGAG?ATGATAAAAG?CTTG 394

Claims (8)

1. produce the method for the mixed disulfide that becomes to be grouped into by protein and disulphide, it is characterized in that, with inactivation, the almost solution and the incubation when having the disulphide composition of the denaturing agent of the protein of insoluble form and sex change concentration, 10 mmoles/the be raised to disulphide composition of limit of saturation concentration range is wherein used in dissolving and deriving.

2. method according to claim 1 is characterized in that, removes the disulphide composition after deriving.

3. method according to claim 1 is characterized in that, derives under acidic conditions.

4. according to each described method among the claim 1-3, it is characterized in that, add the free SH on the EDTA protected protein matter.

5. according to each described method among the claim 1-3, it is characterized in that, with GSSG, cystamine, or halfcystine is as the disulphide composition.

6. according to each described method among the claim 1-3, it is characterized in that the working concentration of disulphide composition is the 50-100% of disulphide composition saturation concentration.

7. the inactivation that after recombinant production prokaryotic organism, obtains, almost produce in the protein of insoluble form bioactive method of protein is arranged, it is characterized in that, the dissolving inactivation protein of insoluble form almost in the solution of the denaturing agent of sex change concentration and when having the disulphide composition, make solubilising protein take bioactive configuration by the intensive denaturing soln being changed over non-denaturing soln or weak denaturing soln, the disulfide bonds that itself and disulphide composition are formed, again form disulfide linkage at proteinic intramolecularly, this generation type makes protein take the configuration of biologically active, wherein uses 10 mmoles/the be raised to disulphide composition of limit of saturation concentration range.

8. method according to claim 7 is characterized in that recombinant protein matter is proteolytic enzyme, somatomedin, proteohormone, neurotrophic factor or cytokine.