CN1162545C - Cathepsin B gene of bollworm and its clone, recombination and expression techniques - Google Patents
Cathepsin B gene of bollworm and its clone, recombination and expression techniques Download PDFInfo
- Publication number
- CN1162545C CN1162545C CNB011274549A CN01127454A CN1162545C CN 1162545 C CN1162545 C CN 1162545C CN B011274549 A CNB011274549 A CN B011274549A CN 01127454 A CN01127454 A CN 01127454A CN 1162545 C CN1162545 C CN 1162545C
- Authority
- CN
- China
- Prior art keywords
- cathepsin
- cdna
- bollworm
- gene
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Landscapes
- Enzymes And Modification Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a cotton bollworm cathepsin BcDNA gene, the cloning and a recombined expression technology thereof, which belongs to the field of molecular biology and biotechnology. Total RNA is extracted from cotton bollworm, and then 5 to 10 mcg of the total RAN is reversely transcribed to synthesize cDNA, a polymerase chain reaction is carried out according to a purified proteinase amino acid sequence and a conserved sequence design primer of cathepsin B, and a product is enlarged and purified, so a purified product can be cloned on a pGEM-T Easy carrier, a DH5 alpha cell is converted and is used for sequence determination, and 1310 bp of full-length cDNA is obtained by 3'/5' tail end fast enlargement. An expression primer is designed according to the sequence, proteinase can be expressed in prokaryotic organisms and eukaryotes, the cathepsin B with proteolytic activity is generated, and proteinase with the value of medicine, pesticide and industry, a gene recombination prokaryotic organism expression system and a eukaryote expression system can be obtained.
Description
(1) technical field
The present invention relates to a kind of bollworm cDNA of cathepsin B gene and clone, recombination and expression techniques, belong to molecular biology and biological technical field.
(2) background technology
Proteolytic enzyme can the cracking peptide bond, protein hydrolysate, is divided into to be serine stretch protein enzyme, metalloprotein enzyme, 4 big classes such as asparagicacid proteinases and L-Cysteine HCL Anhydrous class.Play a significant role in the proteolytic enzyme various vital movements in vivo, except general proteolysis, also participate in the various important vital movements such as proteolysis under proenzyme modification, antigen activation, apoptosis, the pathological conditions.Many cause of disease insecticidal microorganisms also are by release protease hydrolysis insect cuticle, enter polypide, or release proteolytic enzyme cause the polypide vacuolization and festers and death after entering polypide.Cathepsin B belongs to the L-Cysteine HCL Anhydrous class in the proteolytic enzyme, numbering EC3.4.22.1.The L-Cysteine HCL Anhydrous class is the very high proteinoid enzyme of activity in vivo, mainly be present in the lysosome, comprise cathepsin B, L, H, M, N, S, T etc., the essential cysteine residues in active centre, generally like condition of acidic pH, major function is to decompose the external foreign matter of being engulfed by lysosome.Studies show that people's cathepsin B participates in tumour cell and shifts, Aedes aegypti cathepsin B participates in the vitellin(Vt) hydrolysis.The cathepsin B of having cloned animals such as people, ox, rat, Aedes aegypti, flesh fly, fruit bat in the world at present, but recombinant expressed not appearing in the newspapers do not have the research of bollworm cathepsin B to report yet.Domestic do not have unit to carry out cathepsin B's research.At home and abroad only we study in the laboratory in bollworm cathepsin B.
The inventor is purified to cathepsin B's L-Cysteine HCL Anhydrous from bollworm, and character, synthesising part and the tissue distribution etc. of proteolytic enzyme have been carried out systematic study.The result shows, bollworm cathepsin B can the multiple animal and plant albumen of hydrolysis, and substrate is not had specificity, can Collagen Hydrolysate, and the suitableeest action pH is 3-4.This proteolytic enzyme is expressed adult, mainly is distributed in fatty body, ovary, does not detect this proteolytic enzyme distribution and active larva.The synthesising part of this proteolytic enzyme is at adult fatty body and ovary.The major function of having illustrated is to participate in vitellin(Vt) hydrolysis in the fetal development, and the protein synthesis new for embryoid body provides amino acid.Other function of this proteolytic enzyme waits further research.On this basis, we have cloned the cDNA of bollworm cathepsin B, and the result shows that the kethepsin of bollworm cathepsin B and animals such as the people that reported, ox, rat, Aedes aegypti, flesh fly, fruit bat has only the similarity about 50%.
(3) summary of the invention
The present invention is directed to the deficiency of prior art, on the basis of bollworm cathepsin B separation and purification, clone the cDNA of this proteolytic enzyme, at prokaryotic organism, eukaryote expression in vivo, product is used for medicine, industry and agricultural insect pests control with this gene.
The cloning process of the bollworm cDNA of cathepsin B gene of the present invention is to extract total RNA from bollworm, utilizes the synthetic cDNA of the total RNA reverse transcription of about 5-10 microgram then.Design primer according to the proteolytic enzyme aminoacid sequence of purifying and the conserved sequence of cathepsin B:
Forward primer: 5 '-AATACATATGGCCGCTTCGC-3 '
Reverse primer: 5 '-ACTTGGATCCTCTACACGAC-3 '
Carry out conventional polymerase chain reaction, the product amplification purification is got 3 μ l purified products and is cloned into pGEM-T Easy carrier, transforms DH5 α cell, is used for sequencing, and obtaining full-length cDNA through 3 '/5 ' terminal rapid amplifying is 1310bp.
Concrete polymerase chain reaction (PCR) reagent and condition:
At first following reagent is mixed:
10xTaq dna polymerase buffer liquid 5 microlitres (μ l)
Template cDNA 1 μ l
Forward primer (1.25 μ g/ μ l) 1 μ l
Reverse primer (1.25 μ g/ μ l) 1 μ l
Deoxynucleoside acid mixture (dNTP) 4 μ l
Taq archaeal dna polymerase 0.25 μ l
Aqua sterilisa 37.75 μ l
Cumulative volume 50 μ l
The PCR reaction conditions is: at first 94 ℃ of sex change are 2 minutes, enter following circulation then: 94 ℃ 30 seconds, 53 ℃ 45 seconds, 72 ℃ 45 seconds, carry out 30 circulations altogether, last 72 ℃ were extended 10 minutes.
Result's dna fragmentation that increases.With the amplified production purifying, get 3 μ l purified products and be cloned into pGEM-T Easy carrier (Promega company product), transform DH5 α cell (common carrier host cell), dull and stereotyped incubated overnight.3 hickies of picking extract plasmid, are used for sequencing.
Obtaining full-length cDNA through 3 '/5 ' terminal rapid amplifying is 1310bp, comprises that upstream sequence and the poly A tract before the initiation codon clings to.Open reading frame partly is 1017bp, push away thus 338 amino acid whose one section sequences of tool, this sequence is put into international gene pool to be retrieved, prove cathepsin B, with the sequence of the cathepsin Bs of animals such as the people who has delivered, ox, rat, Aedes aegypti, flesh fly, fruit bat relatively, the result shows that similarity is about 50%, therefore can determine that this gene is a kind of new cathepsin B gene.Obtained following gene through above-mentioned clone's step.
Sequence table
(1) information of SEQ ID NO 1
(a) sequence signature:
* length: 1310 base pairs
* type: nucleic acid
* chain: two strands
* topological framework: linearity
(b) molecule type: cDNA
(c) suppose: not
(d) antisense: not
(e) initial source: bollworm (Helicoverpa armigera)
(f) sequence description: SEQ ID NO.1
GAAGACCACATCAGGGCTGAGTTATTTAAGAACGGCCCAGTTGAAGGTGCAGCTCAGTCG-60
TCGCGCCACATTCGCTCCGAATACACATCCATTAACCACTCAGCTGTGAAAAAGAAAATA-120
AAGAAGTGAATAATGGCCGCTTCGCGTGCAACGTTTGTTGCGCTCGTGTGCGCTCTCGCG-180
CTCGCCGCCGCCGATGTGCAGAATCCGCTCAGTGACGATTTCATCAATCTCATCAACACA-240
AAGCAAAACTCTTGGAAAGCTGGTAGGAACTTCCCAGAGCACACGCCCTTCGCACACATC-300
AAGAGATTAGCGGGTGTCCTGCCAGATTACCATTTGTCTAAATTAAGCAAAGTTGAACAT-360
GAAGATGAATTGATTGCGAGTTTACCGGAGAACTTTGACCCGAGGGACAAATGGCCGAAC-420
TGCCCTACTTTGAACGAAGTCAGGGACCAGGGATCTTGTGGTAGCTGCTGGGCGTTCGGT-480
GCTGTGGAGGCCATGACCGACCGGTACTGTACATACTCCAATGGAACTCAACACTTCCAT-540
TTCTCCGCTGAAGATCTCTTAAGCTGCTGCCCAATCTGTGGTCTGGGATGTAACGGAGGT-600
ATGCCAACGTTAGCTTGGGAGTACTGGAAGCATTTCGGGCTTGTGTCTGGTGGTAGCTAC-660
AACTCAAGCCAGGGCTGCAGACCCTACGAGATTCCTCCGTGTGAACATCACGTACCCGGT-720
AATAGAATGCCTTGCAATGGTGATTCTAAGACCCCAAAATGCGAAAAAACCTGCGAATCA-780
AACTACAATGTTGACTACCGCAAAGATAAGCGGTACGGCAAACATGTTTTCTCAGTGTCA-840
AGTAAGGAAGACCATATCAGGGCTGAGTTATTTAAGAACGGCCCAGTTGAAGGTGCGTTT-900
ACAGTGTACTCGGACTTGCTGAATTACAAGACCGGTGTTTACAAGCACACTATTGGCGAC-960
GCTCTCGGTGGCCACGCTGTTAAGATCCTGGGCTGGGGCGTGGAGAATGGAAACAAGTAC-1020
TGGCTCATCGCTAACTCATGGAACAGTGACTGGGGTGACAATGGATTCTTTAAAATCCTT-1080
CGTGGTGAGGATCACTGCGGTATCGAAAGCTCTATAGTAGCCGGTGAGCCAATGTTCGTT-1140
GAATATTAGTTAAAGTTTAATTCTCTAAGCTTCTGTAAATAGTGTCGTGTAGATTATCCA-1200
AGTACCATATTGCTAAGTTAATGTTAAAAATATGAGCAACGATACTTTTAAACCAAATAA-1260
ATATTTTGTACCTTAATAAAAACTTATTTTGTTTATAAAAAAAAAAAAAA-1310
(2) information of SEQ ID NO.2
(a) sequence signature
* length: 338 amino acid
* type: amino acid
* chain: strand
* topological framework: linearity
(b) molecule type: protein
(c) sequence description
1 MAASRATFVA?LVCALALAAA?DVQNPLSDDF?INLINTKQNS?WKAGRNFPEH
TPFAHIKRLA 60
61 GVLPDYHLSK?LSKVEHEDEL?IASLPENFDP?RDKWPNCPTL?NEVRDQGSCG
SCWAFGAVEA?120
121?MTDRYCTYSN?GTQHFHFSAE?DLLSCCPICG?LGCNGGMPTL?AWEYWKHFGL
VSGGSYNSSQ?180
181?GCRPYEIPPC?EHHVPGNRMP?CNGDSKTPKC?EKTCESNYNV?DYRKDKRYGK
HVFSVSSKED?240
241?HIRAELFKNG?PVEGAFTVYS?DLLNYKTGVY?KHTIGDALGG?HAVKILGWGV
ENGNKYWLIA?300
301?NSWNSDWGDN?GFFKILRGED?HCGIESSIVA?GEPMFVEY
338
According to above-mentioned sequence, primer is expressed in design:
Forward HCBpGEXF 5 ' AATAGAATTCATGGCCGCTTCGCG 3 '
Reverse HCBpGEXR 5 ' TCGGCTCGAGCTAATATTCAACG 3 '
This proteolytic enzyme is expressed in prokaryotic organism and eukaryote, produce the cathepsin B that proteolytic activity is arranged, obtain gene recombination prokaryotic expression system and eukaryotic expression system, and the proteolytic enzyme with medicine, agricultural chemicals, industrial value.The host who expresses can be colibacillus, yeast, insect viruses.
According to above-mentioned technology, be cloned into the cDNA of bollworm cathepsin B, in prokaryotic organism and eukaryote, express, obtain activated bollworm cathepsin B, acquisition can suitability for industrialized production reorganization prokaryotic organism and eukaryote expression system, by genetically engineered mass production bollworm cathepsin B, production has the reorganization prokaryotic organism and the eukaryote of medicine, agricultural chemicals, industrial value, is used for productions such as medical treatment, health care, food-processing, washing composition, insecticidal microorganism, bio-reactor.
(4) embodiment
Embodiment 1: a kind of clone's the cDNA of bollworm cathepsin B gene has following sequence:
(1) information of SEQ ID NO 1
(a) sequence signature:
* length: 1310 base pairs
* type: nucleic acid
* chain: two strands
* topological framework: linearity
(b) molecule type: cDNA
(c) suppose: not
(d) antisense: not
(e) initial source: bollworm (Helicoverpa armigera)
(f) sequence description: SEQ ID NO.1
GAAGACCACATCAGGGCTGAGTTATTTAAGAACGGCCCAGTTGAAGGTGCAGCTCAGTCG-60
TCGCGCCACATTCGCTCCGAATACACATCCATTAACCACTCAGCTGTGAAAAAGAAAATA-120
AAGAAGTGAATAATGGCCGCTTCGCGTGCAACGTTTGTTGCGCTCGTGTGCGCTCTCGCG-180
CTCGCCGCCGCCGATGTGCAGAATCCGCTCAGTGACGATTTCATCAATCTCATCAACACA-240
AAGCAAAACTCTTGGAAAGCTGGTAGGAACTTCCCAGAGCACACGCCCTTCGCACACATC-300
AAGAGATTAGCGGGTGTCCTGCCAGATTACCATTTGTCTAAATTAAGCAAAGTTGAACAT-360
GAAGATGAATTGATTGCGAGTTTACCGGAGAACTTTGACCCGAGGGACAAATGGCCGAAC-420
TGCCCTACTTTGAACGAAGTCAGGGACCAGGGATCTTGTGGTAGCTGCTGGGCGTTCGGT-480
GCTGTGGAGGCCATGACCGACCGGTACTGTACATACTCCAATGGAACTCAACACTTCCAT-540
TTCTCCGCTGAAGATCTCTTAAGCTGCTGCCCAATCTGTGGTCTGGGATGTAACGGAGGT-600
ATGCCAACGTTAGCTTGGGAGTACTGGAAGCATTTCGGGCTTGTGTCTGGTGGTAGCTAC-660
AACTCAAGCCAGGGCTGCAGACCCTACGAGATTCCTCCGTGTGAACATCACGTACCCGGT-720
AATAGAATGCCTTGCAATGGTGATTCTAAGACCCCAAAATGCGAAAAAACCTGCGAATCA-780
AACTACAATGTTGACTACCGCAAAGATAAGCGGTACGGCAAACATGTTTTCTCAGTGTCA-840
AGTAAGGAAGACCATATCAGGGCTGAGTTATTTAAGAACGGCCCAGTTGAAGGTGCGTTT-900
ACAGTGTACTCGGACTTGCTGAATTACAAGACCGGTGTTTACAAGCACACTATTGGCGAC-960
GCTCTCGGTGGCCACGCTGTTAAGATCCTGGGCTGGGGCGTGGAGAATGGAAACAAGTAC-1020
TGGCTCATCGCTAACTCATGGAACAGTGACTGGGGTGACAATGGATTCTTTAAAATCCTT-1080
CGTGGTGAGGATCACTGCGGTATCGAAAGCTCTATAGTAGCCGGTGAGCCAATGTTCGTT-1140
GAATATTAGTTAAAGTTTAATTCTCTAAGCTTCTGTAAATAGTGTCGTGTAGATTATCCA-1200
AGTACCATATTGCTAAGTTAATGTTAAAAATATGAGCAACGATACTTTTAAACCAAATAA-1260
ATATTTTGTACCTTAATAAAAACTTATTTTGTTTATAAAAAAAAAAAAAA-1310
(2) information of SEQ ID NO.2
(a) sequence signature
* length: 338 amino acid
* type: amino acid
* chain: strand
* topological framework: linearity
(b) molecule type: protein
(c) sequence description
1 MAASRATFVA?LVCALALAAA?DVQNPLSDDF?INLINTKQNS?WKAGRNFPEH
TPFAHIKRLA?60
61 GVLPDYHLSK?LSKVEHEDEL?IASLPENFDP?RDKWPNCPTL?NEVRDQGSCG
SCWAFGAVEA?120
121?MTDRYCTYSN?GTQHFHFSAE?DLLSCCPICG?LGCNGGMPTL?AWEYWKHFGL
VSGGSYNSSQ?180
181?GCRPYEIPPC?EHHVPGNRMP?CNGDSKTPKC?EKTCESNYNV?DYRKDKRYGK
HVFSVSSKED?240
241?HIRAELFKNG?PVEGAFTVYS?DLLNYKTGVY?KHTIGDALGG?HAVKILGWGV
ENGNKYWLIA?300
301?NSWNSDWGDN?GFFKILRGED?HCGIESSIVA?GEPMFVEY
338
The cloning process of embodiment 2. cDNA of bollworm cathepsin B genes
Bollworm (Helicoverpa armigera), gather or artificial breeding in the field.
1. total RNA or mRNA extract: adopt single stage method or RNA kit to extract total RNA or with mRNA kit separation and Extraction mRNA
2.cDNA first chain is synthetic: the total RNA of 5-10 microgram, add reaction solution 20 microlitres (50 mmole Repone K, 3 mmole magnesium chlorides), 10 mmole tris-HCI buffer (Tris-HCl) pH8.3,1 mmole dithiothreitol (DTT) (DTT), 5 micromole's oligomerization dT acid (Oligod (T)
17), 500 micromole's deoxyribonucleotide mixtures (dNTP), 25 RNA of unit enzyme inhibitorss, 8 AMV of unit reversed transcriptive enzymes) 42 ℃ of reactions 90 minutes.70 ℃ of 10 minutes termination reactions.
3.PCR reaction: polymerase chain reaction (PCR) reagent and condition:
At first following reagent is mixed:
10xTaq dna polymerase buffer liquid 5 microlitres (μ l)
Template cDNA 1 μ l
Forward primer (1.25 μ g/ μ l) 1 μ l
Reverse primer (1.25 μ g/ μ l) 1 μ l
Deoxynucleoside acid mixture (dNTP) 4 μ l
Taq archaeal dna polymerase 0.25 μ l
Aqua sterilisa 37.75 μ l
Cumulative volume 50 μ l
The PCR reaction conditions is: at first 94 ℃ of sex change are 2 minutes, enter following circulation then: 94 ℃ 30 seconds, 53 ℃ 45 seconds, 72 ℃ 45 seconds, carry out 30 circulations altogether, last 72 ℃ were extended 10 minutes.
4. reaction product purifying: utilize Germany's card strength (QIAGEN) company's product (QIAquick Gel ExtractionKit), operation steps is undertaken by product description.
5. proteolytic enzyme cDNA clones: get purified product 3 microlitres, be connected in pGEM-T Easy carrier (Promega company product).Be transformed into e.colistraindh5, in the dull and stereotyped grow overnight that contains penbritin (100 mcg/ml) and 5-bromo-4-chloro-3-indoles-β-D-galactoside (X-gal 0.2 mcg/ml), 3 hickies of picking, overnight incubation in LB liquid nutrient medium (5 milliliters contain 100 mcg/ml peace penicillin G).
6. plasmid purification: collect incubated overnight bacterium liquid 1-2 milliliter, centrifugal (10000 change 1 minute) collecting cell.With minim DNA purification kit (Wizard plus SV Minipreps DNA Purification System, the U.S. general Lip river wheat Promega company) plasmid purification, purification step is undertaken by product description.
7. sequencing and homology retrieval: get plasmid purification 2-5 microlitre, with carrier primer T7 automatically check order (originally being operated in Shanghai life worker company finishes).Institute's calling sequence and gene pool sequence are compared.
Embodiment 3. cDNA of bollworm cathepsin B expression of gene methods
Express primer:
Forward HCBpGEXF 5 ' AATAGAATTCATGGCCGCTTCGCG 3 '
Reverse HCBpGEXR 5 ' TCGGCTCGAGCTAATATTCAACG 3 '
Cathepsin B gene of bollworm is put into intestinal bacteria or other prokaryotic organism are expressed, obtain activated proteolytic enzyme, be used for medicine, health care, industrial production or as sterilant.
Embodiment 4. is as embodiment 3, and different is
Cathepsin B gene of bollworm is put into yeast express, be used for medicine, health care, industrial production.
Embodiment 5. is as embodiment 3, and different is
Change cathepsin B gene of bollworm over to the insect nuclear polyhedrosis virus,, produce the proteolytic enzyme product, or produce gene recombined virus with insecticidal function at insect cell or insect expression in vivo.
Sequence table
＜110〉Shandong University
＜120〉cathepsin B gene of bollworm and clone thereof, recombination and expression techniques
<140>01127454.9
<141>2001-09-30
<160>2
<170>Patent?In3.1
<210>1
<211>1310
<212>cDNA
＜213〉bollworm (Helicoverpa armigera)
<221>CDS，133-1149
<400>1
gaagaccaca?tcagggctga?gttatttaag?aacggcccag?ttgaaggtgc?agctcagtcg 60
tcgcgccaca?ttcgctccga?atacacatcc?attaaccact?cagctgtgaa?aaagaaaata 120
aagaagtgaa?taatggccgc?ttcgcgtgca?acgtttgttg?cgctcgtgtg?cgctctcgcg 180
ctcgccgccg?ccgatgtgca?gaatccgctc?agtgacgatt?tcatcaatct?catcaacaca 240
aagcaaaact?cttggaaagc?tggtaggaac?ttcccagagc?acacgccctt?cgcacacatc 300
aagagattag?cgggtgtcct?gccagattac?catttgtcta?aattaagcaa?agttgaacat 360
gaagatgaat?tgattgcgag?tttaccggag?aactttgacc?cgagggacaa?atggccgaac 420
tgccctactt?tgaacgaagt?cagggaccag?ggatcttgtg?gtagctgctg?ggcgttcggt 480
gctgtggagg?ccatgaccga?ccggtactgt?acatactcca?atggaactca?acacttccat 540
ttctccgctg?aagatctctt?aagctgctgc?ccaatctgtg?gtctgggatg?taacggaggt 600
atgccaacgt?tagcttggga?gtactggaag?catttcgggc?ttgtgtctgg?tggtagctac 660
aactcaagcc?agggctgcag?accctacgag?attcctccgt?gtgaacatca?cgtacccggt 720
aatagaatgc?cttgcaatgg?tgattctaag?accccaaaat?gcgaaaaaac?ctgcgaatca 780
aactacaatg?ttgactaccg?caaagataag?cggtacggca?aacatgtttt?ctcagtgtca 840
agtaaggaag?accatatcag?ggctgagtta?tttaagaacg?gcccagttga?aggtgcgttt 900
acagtgtact?cggacttgct?gaattacaag?accggtgttt?acaagcacac?tattggcgac 960
gctctcggtg?gccacgctgt?taagatcctg?ggctggggcg?tggagaatgg?aaacaagtac 1020
tggctcatcg?ctaactcatg?gaacagtgac?tggggtgaca?atggattctt?taaaatcctt 1080
cgtggtgagg?atcactgcgg?tatcgaaagc?tctatagtag?ccggtgagcc?aatgttcgtt 1140
gaatattagt?taaagtttaa?ttctctaagc?ttctgtaaat?agtgtcgtgt?agattatcca 1200
agtaccatat?tgctaagtta?atgttaaaaa?tatgagcaac?gatactttta?aaccaaataa 1260
atattttgta?ccttaataaa?aacttatttt?gtttataaaa?aaaaaaaaaa 1310
<210>2
<211>338
<212>PRT
＜213〉bollworm (Helicoverpa armigera)
<400>2Met?Ala?Ala?Ser?Arg?Ala?Thr?Phe?Val?Ala?Leu?Val?Cys?Ala?Leu
5 10 15Ala?Leu?Ala?Ala?Ala?Asp?Val?Gln?Asn?Pro?Leu?Ser?Asp?Asp?Phe
20 25 30Ile?Asn?Leu?Ile?Asn?Thr?Lys?Gln?Asn?Ser?Trp?Lys?Ala?Gly?Arg
35 40 45Asn?Phe?Pro?Glu?His?Thr?Pro?Phe?Ala?His?Ile?Lys?Arg?Leu?Ala
50 55 60Gly?Val?Leu?Pro?Asp?Tyr?His?Leu?Ser?Lys?Leu?Ser?Lys?Val?Glu
65 70 75His?Glu?Asp?Glu?Leu?Ile?Ala?Ser?Leu?Pro?Glu?Asn?Phe?Asp?Pro
80 85 90Arg?Asp?Lys?Trp?Pro?Asn?Cys?Pro?Thr?Leu?Asn?Glu?Val?Arg?Asp
95 100 105Gln?Gly?Ser?Cys?Gly?Ser?Cys?Trp?Ala?Phe?Gly?Ala?Val?Glu?Ala
110 115 120Met?Thr?Asp?Arg?Tyr?Cys?Thr?Tyr?Ser?Asn?Gly?Thr?Gln?His?Phe
125 130 135His?Phe?Ser?Ala?Glu?Asp?Leu?Leu?Ser?Cys?Cys?Pro?Ile?Cys?Gly
140 145 150Leu?Gly?Cys?Asn?Gly?Gly?Met?Pro?Thr?Leu?Ala?Trp?Glu?Tyr?Trp
155 160 165Lys?His?Phe?Gly?Leu?Val?Ser?Gly?Gly?Ser?Tyr?Asn?Ser?Ser?Gln
170 175 180Gly?Cys?Arg?Pro?Tyr?Glu?Ile?Pro?Pro?Cys?Glu?His?His?Val?Pro
185 190 195Gly?Asn?Arg?Met?Pro?Cys?Asn?Gly?Asp?Ser?Lys?Thr?Pro?Lys?Cys
200 205 210Glu?Lys?Thr?Cys?Glu?Ser?Asn?Tyr?Asn?Val?Asp?Tyr?Arg?Lys?Asp
215 220 225Lys?Arg?Tyr?Gly?Lys?His?Val?Phe?Ser?Val?Ser?Ser?Lys?Glu?Asp
230 235 240His?Ile?Arg?Ala?Glu?Leu?Phe?Lys?Asn?Gly?Pro?Val?Glu?Gly?Ala
245 250 255Phe?Thr?Val?Tyr?Ser?Asp?Leu?Leu?Asn?Tyr?Lys?Thr?Gly?Val?Tyr
260 265 270Lys?His?Thr?Ile?Gly?Asp?Ala?Leu?Gly?Gly?His?Ala?Val?Lys?Ile
275 280 285Leu?Gly?Trp?Gly?Val?Glu?Asn?Gly?Asn?Lys?Tyr?Trp?Leu?Ile?Ala
290 295 300Asn?Ser?Trp?Asn?Ser?Asp?Trp?Gly?Asp?Asn?Gly?Phe?Phe?Lys?Ile
305 310 315Leu?Arg?Gly?Glu?Asp?His?Cys?Gly?Ile?Glu?Ser?Ser?Ile?Val?Ala
320 325 330Gly?Glu?Pro?Met?Phe?Val?Glu?Tyr
335
Claims (4)
1. a clone the cDNA of bollworm cathepsin B gene is characterized in that, it has the sequence shown in the SEQ ID NO 1:
GAAGACCACATCAGGGCTGAGTTATTTAAGAACGGCCCAGTTGAAGGTGCAGCTCAGTCG-?60
TCGCGCCACATTCGCTCCGAATACACATCCATTAACCACTCAGCTGTGAAAAAGAAAATA-120
AAGAAGTGAATAATGGCCGCTTCGCGTGCAACGTTTGTTGCGCTCGTGTGCGCTCTCGCG-180
CTCGCCGCCGCCGATGTGCAGAATCCGCTCAGTGACGATTTCATCAATCTCATCAACACA-240
AAGCAAAACTCTTGGAAAGCTGGTAGGAACTTCCCAGAGCACACGCCCTTCGCACACATC-300
AAGAGATTAGCGGGTGTCCTGCCAGATTACCATTTGTCTAAATTAAGCAAAGTTGAACAT-360
GAAGATGAATTGATTGCGAGTTTACCGGAGAACTTTGACCCGAGGGACAAATGGCCGAAC-420
TGCCCTACTTTGAACGAAGTCAGGGACCAGGGATCTTGTGGTAGCTGCTGGGCGTTCGGT-480
GCTGTGGAGGCCATGACCGACCGGTACTGTACATACTCCAATGGAACTCAACACTTCCAT-540
TTCTCCGCTGAAGATCTCTTAAGCTGCTGCCCAATCTGTGGTCTGGGATGTAACGGAGGT-600
ATGCCAACGTTAGCTTGGGAGTACTGGAAGCATTTCGGGCTTGTGTCTGGTGGTAGCTAC-660
AACTCAAGCCAGGGCTGCAGACCCTACGAGATTCCTCCGTGTGAACATCACGTACCCGGT-720
AATAGAATGCCTTGCAATGGTGATTCTAAGACCCCAAAATGCGAAAAAACCTGCGAATCA-780
AACTACAATGTTGACTACCGCAAAGATAAGCGGTACGGCAAACATGTTTTCTCAGTGTCA-840
AGTAAGGAAGACCATATCAGGGCTGAGTTATTTAAGAACGGCCCAGTTGAAGGTGCGTTT-900
ACAGTGTACTCGGACTTGCTGAATTACAAGACCGGTGTTTACAAGCACACTATTGGCGAC-960
GCTCTCGGTGGCCACGCTGTTAAGATCCTGGGCTGGGGCGTGGAGAATGGAAACAAGTAC-1020
TGGCTCATCGCTAACTCATGGAACAGTGACTGGGGTGACAATGGATTCTTTAAAATCCTT-1080
CGTGGTGAGGATCACTGCGGTATCGAAAGCTCTATAGTAGCCGGTGAGCCAATGTTCGTT-1140
GAATATTAGTTAAAGTTTAATTCTCTAAGCTTCTGTAAATAGTGTCGTGTAGATTATCCA-1200
AGTACCATATTGCTAAGTTAATGTTAAAAATATGAGCAACGATACTTTTAAACCAAATAA-1260
ATATTTTGTACCTTAATAAAAACTTATTTTGTTTATAAAAAAAAAAAAAA-1310
2. the cloning process of the described bollworm of claim 1 cDNA of a cathepsin B gene, it is characterized in that, extract total RNA from bollworm, utilize the total RNA reverse transcription of 5-10 microgram to synthesize cDNA then, design primer according to the proteolytic enzyme aminoacid sequence of purifying and the conserved sequence of cathepsin B:
Forward primer: 5 '-AATACATATGGCCGCTTCGC-3 '
Reverse primer: 5 '-ACTTGGATCCTCTACACGAC-3 '
Carry out conventional polymerase chain reaction, the product amplification purification is got 3 μ l purified products and is cloned into pGEM-T Easy carrier, transforms DH5 α cell, is used for sequencing, and obtaining full-length cDNA through 3 '/5 ' terminal rapid amplifying is 1310bp.
3. the cloning process of the described bollworm of claim 2 cDNA of a cathepsin B gene is characterized in that,
Concrete operations are as follows:
Chain polymerization enzyme reaction reagent and condition are as follows:
At first following reagent is mixed,
10xTaq dna polymerase buffer liquid 5 microlitres
Template cDNA 1 μ l
1.25 μ g/ μ l forward primer 1 μ l
1.25 μ g/ μ l reverse primer 1 μ l
Deoxynucleoside acid mixture dNTP 4 μ l
Taq archaeal dna polymerase 0.25 μ l
Aqua sterilisa 37.75 μ l
Cumulative volume 50 μ l
The PCR reaction conditions is: at first 94 ℃ of C sex change are 2 minutes, enter following circulation then: 94 ℃ 30 seconds, 53 ℃ 45 seconds, 72 ℃ 45 seconds, carry out 30 circulations altogether, last 72 ℃ were extended 10 minutes; Result's dna fragmentation that increases with the amplified production purifying, is got 3 μ l purified products and is cloned into pGEM-T Easy carrier, transform DH5 α cell, be the common carrier host cell, dull and stereotyped incubated overnight, 3 hickies of picking, extract plasmid, be used for sequencing, obtaining full-length cDNA through 3 '/5 ' terminal rapid amplifying is 1310bp, comprises that upstream sequence and the poly A tract before the initiation codon clings to, open reading frame partly is 1017bp, obtains 338 amino acid whose one section sequences of tool thus.
4. the cDNA of the bollworm cathepsin B expression of gene method of the described isolated or purified of claim 1 is characterized in that, according to the expression primer of described sequences Design is:
Forward HCBpGEXF 5 ' AATAGAATTCATGGCCGCTTCGCG 3 '
Oppositely HCBpGEXR 5 ' TCGGCTCGAGCTAATATTCAACG 3 ' expresses proteolytic enzyme in prokaryotic organism and eukaryote, produces the cathepsin B that proteolytic activity is arranged.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB011274549A CN1162545C (en) | 2001-09-30 | 2001-09-30 | Cathepsin B gene of bollworm and its clone, recombination and expression techniques |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB011274549A CN1162545C (en) | 2001-09-30 | 2001-09-30 | Cathepsin B gene of bollworm and its clone, recombination and expression techniques |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1373223A CN1373223A (en) | 2002-10-09 |
| CN1162545C true CN1162545C (en) | 2004-08-18 |
Family
ID=4667408
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB011274549A Expired - Lifetime CN1162545C (en) | 2001-09-30 | 2001-09-30 | Cathepsin B gene of bollworm and its clone, recombination and expression techniques |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1162545C (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101070533B (en) * | 2006-05-11 | 2011-09-28 | 中国科学院动物研究所 | American cotton bollworm yong-insect fatbody cell line of high yield stab-like virus, its constitution and use |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087621A (en) * | 2015-05-12 | 2015-11-25 | 浙江大学舟山海洋研究中心 | Prokaryotic expression method of sea cucumber cathepsin |
| CN110079515A (en) * | 2019-05-16 | 2019-08-02 | 南京农业大学 | The prokaryotic expression method of intestines serine protease gene in a kind of bollworm |
| CN110331191A (en) * | 2019-08-27 | 2019-10-15 | 贵州大学 | Using the method for Real-Time Fluorescent Quantitative PCR Technique detection Qian Beimayang CTSB gene organization express spectra |
| CN113564174B (en) * | 2021-07-16 | 2023-07-25 | 山西大学 | Aphis citricola Cat-B gene and preparation method and application of nucleic acid interfering agent thereof |
-
2001
- 2001-09-30 CN CNB011274549A patent/CN1162545C/en not_active Expired - Lifetime
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101070533B (en) * | 2006-05-11 | 2011-09-28 | 中国科学院动物研究所 | American cotton bollworm yong-insect fatbody cell line of high yield stab-like virus, its constitution and use |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1373223A (en) | 2002-10-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1871351A (en) | Novel fungal proteins and nucleic acids encoding same | |
| CN1324140C (en) | Preparation of biologically active molecules | |
| CN1058597A (en) | The method of enzymatic preparation of basic fibroblast growth factor | |
| CN1530373A (en) | Yeast extracted liquid for cell-free protein synthesis, preparation thereof, and cell-free protein synthesis therewith | |
| CN1162545C (en) | Cathepsin B gene of bollworm and its clone, recombination and expression techniques | |
| CN1766107A (en) | Recombinant human keratinized cell growth factor production method | |
| CN1766109A (en) | Chinese prawn C-type agglutinin gene and its coded C-type agglutinin peptide and uses | |
| CN1487080A (en) | Alkaline protease | |
| CN101045933A (en) | Cryophilous proteinase gene mcp01 and its prepn process | |
| CN1171998C (en) | Antibacterial peptide gene of Chinese prawn and its colon technique | |
| CN1800398A (en) | Prunus necrotic ring spot virus coat protein gene and its special primer for checking | |
| CN100347298C (en) | Clone of fish muscle growth inhibit or MSTN gene, and establishment of said gene targeting carrier | |
| CN1295248C (en) | Small salt mustard sodium hydrogen pump protein gene TNHX1 and its anti salt application | |
| CN1807609A (en) | Thermostable lactase preparation method | |
| CN1371423A (en) | Gene coding cyclic lipopeptide acrylase and expression of the same | |
| CN1084565A (en) | Have the active novel protein of Nitrile hydratase and this proteic gene of coding | |
| CN1803194A (en) | Immunity regulating type DNA vaccine for preventing and treating chicken coccidiosis | |
| CN1194091C (en) | Cotton bollworm molt-regulating transcription factor cDNA and cloning method and recombination application thereof | |
| CN1814755A (en) | High-temperature neutral protease and preparing method | |
| CN1306574A (en) | Attenuated virus oka strain gene 62 and method for identifying virus strain for attenuated live vaccine by using same | |
| CN101058818A (en) | Hydantoinase gene, coded amino acid and application thereof | |
| CN1506375A (en) | Azurin as bacterial protein with wide-spectrum antitumor function and its use and medicinal composition | |
| CN1308446C (en) | Earthworm plasmin multi-component and the separating, purifying and preparing technology thereof | |
| CN1858211A (en) | Serine proteinase gene coming from new nematophagous fungi and its use | |
| CN1699570A (en) | Cytoplasmic male sterility gene in leaf mustard and clone method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| AV01 | Patent right actively abandoned | ||
| C20 | Patent right or utility model deemed to be abandoned or is abandoned |