CN1221792A

CN1221792A - Mutational 2,5 diketo-D-gluconic acid reductase and its genetic engineering expression

Info

Publication number: CN1221792A
Application number: CN 97125210
Authority: CN
Inventors: 尹光琳; 陈策实
Original assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Current assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Priority date: 1997-12-30
Filing date: 1997-12-30
Publication date: 1999-07-07
Anticipated expiration: 2017-12-30
Also published as: CN1119414C

Abstract

A technique for biologically synthesizing 2,5 dione-D-gluconic acid (2.5 DKG) reductase features cloning by polymerase chain reaction, cloning to mutational corynebacterium 2.5 DKG reductase I gene, building up proper expression carrier, and high-efficiency expression in colibacillus and Erwinia. The 2.5 DKG reductase expressed by 2.5 DKG reductase I mutational gene has very high catalytic activity and is suitable to prepare 2-one-L-colombic acid (2-KLG) as the precursor to prepare VC with improved serial fermenting of glucose.

Description

2, the 5 diketos-maltonic acid reductase enzyme and the gene engineering expression thereof of sudden change

(2,5DKG) reductase enzyme and gene engineering expression system thereof are applicable to and improve the technology that the glucose cascade fermentation produces the ancient dragon acid of 2-ketone group-L-(2-KLG), belong to bioengineering field to the present invention relates to a kind of 2,5 diketos-maltonic acid of sudden change.

Industrial at present " Lai Shi methods " and " two-step fermenting " productions of adopting of 2-KLG, these two kinds of methods all are raw material with the sorbyl alcohol, industrially make sorbyl alcohol with the glucose high-pressure hydrogenation more.Preparation is not only dangerous but also waste like this, makes whole technology more complicated.The middle and later periods seventies has invented from glucose fermentation and has generated intermediate 2,5-DKG, and then fermentation generates 2-KLG " two step cascade fermentation methods ".But second step coryneform bacteria fermentation of cascade fermentation method utilizes substrate 2, and the concentration of 5-DKG is restricted, and total conversion rate is not high, and final 2-KLG concentration can only reach about 15mg/ml in the fermented liquid.And still to divide two steps to finish.

Second step fermentation principle of glucose cascade fermentation is the small molecular weight single chain protein 2 in the coryneform bacteria, 5-DKG reductase enzyme catalysis 2, and 5-DKG generates the process of 2-KLG.It can be three-dimensional single-mindedly with 2 in the C-5 position, and 5-DKG is reduced to 2-KLG.Utilize recombinant DNA technology, 2 in the coryneform bacteria, 5-DKG reductase gene clonal expression makes up a genetic engineering bacterium in Erwinia, will realize that the glucose one-step fermentation produces 2-KLG.People such as Anderson at first adopt the method in screening-gene library to be cloned into one 2 from coryneform bacteria, the 5-DKG reductase gene, and made up the genetically engineered Erwinia that utilizes glucose direct fermentation to produce 2-KLG.After this another 2, the 5-DKG reductase gene is also obtained from coryneform bacteria clone by the similar method of humans such as Hardy.It is lower that but expression amount and enzyme are lived, and is difficult in industrial application.

The objective of the invention is to set up the biosynthesizing 2 of a practicality, the technology of 5DKG reductase enzyme lays the foundation for successfully constructing the genetic engineering bacterium that utilizes glucose direct fermentation to produce 2-KLG and improving glucose cascade fermentation technology.

The present invention mainly obtains 2 of sudden change by polymerase chain reaction (PCR) method from coryneform bacteria SCB3058 (this laboratory screening) clone, the 5-DKG reductase I, and efficiently express intestinal bacteria and finally be expressed in Erwinia SCB125 (this laboratory screening) and realize goal of the invention.Utilizing round pcr, is template with the genomic dna, optimizes the PCR reaction conditions, obtain containing 2 through amplification, the fragment of 5-DKG reductase I gene, orientation are connected to cloning vector PGEM3Zf (+), and transformed into escherichia coli DH5 α, screening obtains positive colony PGEM813.The sequencing results shows, fragment total length 1107bp contains the open reading frame of a 834bp, and it is the albumen of 34kD that coding produces the molecular weight of being made up of 278 amino acid, turns out to be 2, the 5-DKG reductase I gene.With and the regulating and controlling sequence of gene carry out deletion mutantion after, be cloned into prokaryotic expression carrier pBL and go up acquisition expression plasmid pBL4, by temperature-induced, through denaturing polyacrylamide gel electrophoresis (SDS-PAGE) analysis the obvious expression band is arranged, account for 20% of thalline overall protein, and expressed proteins has higher enzyme activity.Can in intestinal bacteria, efficiently express coryneform bacteria 2, the plasmid pBL4 of 5-DKG reductase I gene is transformed into the plasmid pBLS with streptomycin resistance, adopt improved competence conversion method that pBLS is imported and to utilize glucose high yield 2, among the Erwinia SCB125 of 5-DKG, temperature-induced by improving, analyze 2 through SDS-PAGE, the 5-DKG reductase enzyme has obtained to efficiently express, and does not form inclusion body.Vitro enzyme measurement result alive shows that the enzyme of expression has very high vigor simultaneously.Therefore very big application prospect is arranged.

Below in conjunction with accompanying drawing the present invention is further described.

Fig. 1 is 2,5 DKG reductase I gene sequences and coding protein sequence figure, and the zone that underscore is arranged among the figure is a saltation zone.

Fig. 2 is the SDS-PAGE collection of illustrative plates that is expressed in the bacillus coli DH 5 alpha, and M is molecular weight Marker, and lane1 is the intestinal bacteria that contain expression plasmid, and lane2 is for containing the contrast intestinal bacteria of expressing acid p'tase (pho4) plasmid.

Fig. 3 is a recombinant expression vector PBLS structural representation, EcoR I among the figure, Xho I, the BamH I, the Hind III is a restriction enzyme site, and str is a streptomycin resistance gene, and amp is the plain resistant gene of penbritin, ori is an ori, Pl is a promotor, and CIts856m is the arrestin gene of Pl promotor, 2,5DKGRI is 2, the 5-DKG reductase I gene.

Fig. 4 is the SDS-PAGE collection of illustrative plates that is expressed among the Erwinia SCB125.The same Fig. 2 of Marker, lane1 are the Erwinia that contains expression plasmid, and lane2 is not for containing the contrast Erwinia of expression plasmid.

1. chromosome DNA extracting method: be by mammalian cell chromosome DNA extracting method improve and Come. To the corynebacteria DNA electrophoresis detection of extracting, the dna molecular size that institute's extracting is arrived is 23kb About. 2. primer synthesizes and pcr amplification: according to 2 of document report, and 5-DKG reductase gene total order row, With PCR design of primers program in the PC/GENE software, designed the primer of PCR reaction, when synthetic 5 ' end adds restriction enzyme site and protects base to clone easily: 5 ' end primer: 5 ' TCTGAATTCGCGCCTACCCTGGAAGACATGACAG 3 '

EcoR I 3 ' end primer: 5 ' TCTAAGCTTATCCTCGAAGCTCTCCCGTGCCATC 3 '

Hind III 5 ' distal process becomes primer: 5 ' CGCCTACCCTGGAATTCATGACAG 3 '

EcoRⅠ

With coryneform bacteria SCB3058 complete genome DNA is template, carries out pcr amplification by designed optimization reaction conditions.Amplified production is single band through the agarose gel electrophoresis inspection, is about 1.1Kb, and size is in full accord with desired value; Whether correct for the product of identifying PCR reaction, to cut as a result the aspect from the enzyme of product and carried out principium identification, restriction endonucleases such as BamH I, Xho I digestion site and theoretical value meet.Amplified production reclaims the test kit purifying with Wizard PCR.3.PCR the clone of amplified production and evaluation: after pcr amplification product is purified, cut with EcoR I and Hind III enzyme, directed cloning is in pGEM3Zf (+).Take out the positive bacterium colony of plasmid evaluation and screening by blue hickie variation and small-scale.The recombinant clone that increases carries out enzyme with the inner restriction enzyme site of EcoR I, Hind III and gene and cuts preliminary evaluation.After gained plasmid PGEM813 identifies by restriction enzyme mapping, adopt the terminal cessation method of the two deoxidations of Sanger to carry out nucleic acid sequence analysis, be template directly with recombinant plasmid PGEM813 double-stranded DNA, adopt M13 forward universal primer and middle synthetic primer to measure the sequence at two ends, order-checking (referring to Fig. 1) behind middle portion employing Sal I-Pst I subclone, with complete sequence with deliver 2, it is G rather than A that the 5-DKG reductase gene compares 434 of gene coding regions in proper order, 734 is C rather than T, thereby two amino acid differences have been caused, 145 His become Arg, and 245 Val become Ala.4. expression vector establishment: with 2, the 5-DKG reductase I gene directly is cloned into the prokaryotic expression carrier pBL from EcoR I and Hind III site, utilize coryneform translation signals to translate, be built into coli expression carrier pBL1028, analyze through SDS-PAGE and fail to realize efficiently expressing.Be speculated as distance oversize (26bp) between SD sequence on the pBL and the initiator codon ATG, influenced translation efficiency greatly.Thereby synthesized new 5 ' distal process and become primer, in two bases of ATG front sudden change, construct a new EcoR I restriction enzyme site, sequential analysis has confirmed that the new segment that produces has lacked coryneform bacteria 2,5 ' the ending regulating sequence that the 5-DKG reductase I gene is original, all with regulate gene expressions such as the Pl promotor on the expression vector pBL, SD sequences, spacing becomes 8bp between SD sequence and the ATG initiator codon, near the optimum distance of bibliographical information.Construct escherichia coli high-level expression carrier pBL4.

The bacillus coli DH 5 alpha that contains recombinant expression vector pBL4 is through 42 ℃ of thermal inductions, produced the unexistent obvious expression product of contrast, visible obvious expression product band (referring to Fig. 2) on the SDS-PAGE gel, record molecular weight and be about 34kD, in full accord with theoretical value, gray scale scanning is the result show, the recombinant protein of expression accounts for 20% of bacterial protein.

Be expressed in 2 in the intestinal bacteria by enzyme activity determination method mensuration, 5-DKG reductase I vigor, the result shows 2 of expression, the 5-DKG reductase I has very high biologic activity, has reached 1660U/mg, is greatly improved than the enzyme activity of reporting.4. the transformation of expression vector: streptomycin resistance gene fragment that will about 2Kb is inserted into 2 on the pBL4, and 5-DKG reductase I gene fragment back obtains plasmid pBLS (referring to Fig. 3).Plasmid transforms Erwinia SCB125 to carry out with improved CaCl2 method.Genetic engineering bacterium carries out 2, and 5-DKG reductase I expression analysis is mainly by SDS-PAGE analysis and 2, and the 5-DKG reductase I is measured than living, and the transgenosis Erwinia has obvious band of expression (seeing accompanying drawing 4) as a result, than vigor 3572U/mg, is 10 times of contrast bacterium.

Below be the embodiment of the invention:

Embodiment 1: with genes of corynebacteria group DNA is template, contains 10 * Buffer (Mg at 50ul PCR reaction mixture ²⁺Free) 5ul, 5mol/l dNTP 2ul, each 2ul of 20pmol/ul primer, template 1ul, Taq DNA Polymerase 0.5ul adds 25mmol/lMgCl as required ₂, glycerine etc. are some, are adjusted to 50ul with sterilized water.Loop parameter: 95 ℃ of sex change 1min; 50 ℃ of renaturation 1min; 72 ℃ are extended 3min; 35 circulations, amplified production is single band through electrophoretic examinations, is about 1.1Kb.

Embodiment 2: picking contains the DH5 α bacterial classification inoculation of pBL4 in the AmpLB liquid nutrient medium, and 30 ℃ of overnight incubation are inoculated in the fresh AmpLB substratum next day, cultivates 3-4h (A600 about 0.4) for 30 ℃, is warming up to 42 ℃ and induces continuation to cultivate.Centrifugal collection thalline is suspended in sterilized water, adds the equal-volume sample-loading buffer, boils, and gets supernatant after centrifugal and carries out SDS-PAGE and analyze.Use coomassie brilliant blue staining, gray scale scanning is measured expression product content.Visible obvious expression product band records molecular weight and is about 34kD on the SDS-PAGE gel, and gray scale scanning is the result show, the recombinant protein of expression accounts for 20% of bacterial protein.

The thalline that centrifugal collection is expressed with Buf A 0.1M Tris-Cl (pH7.0) washing, is resuspended among the Buf A of certain volume, uses the ultrasonic disruption thalline, and the centrifuging and taking supernatant is as the enzyme liquid of measuring usefulness.At 30 ℃, 100ul enzyme liquid is added among the 2.7ml Buf A, and adding 100ul concentration again is NADPH solution and the excessive substrate 2 of 100ul of 3-5mM, and 5-DKG measures A ₃₄₀Variation, be converted into the NADPH change in concentration according to typical curve, calculate enzyme activity.Enzyme activity unit (U) is defined as: the enzyme amount that per minute oxidation 1umol NADPH is required.It is standard test with the bovine serum albumin that protein concentration adopts the coomassie brilliant blue staining method, calculates the ratio vigor of enzyme.By different temperature-induced, though inducing for 42 ℃, the result can access much higher expression amount, and the zymoprotein of expressing mainly is present in the precipitation, and the ratio vigor of enzyme still keeps essentially identical level in the supernatant.

Embodiment 3: 28 ℃ of cultivations of transgenosis Erwinia with the fresh 50ug/ml of the containing Streptomycin sulphate LB of 2% inoculation, behind 28 ℃ of cultivation 2-6h, are transferred to 42 ℃ of inducing culture some hrs, the equal 200rpm of rotating speed the bacterium that spends the night that contains 50ug/ml Streptomycin sulphate LB.The results thalline is resuspended to 1mlBufA with 150D600 ,-70 ℃ of broken bacterium walls of freeze thawing ultrasonic wave.Centrifuging and taking supernatant electrophoresis and survey enzyme are lived, and the expression analysis method is with example 2.Transgenosis Erwinia SCB125 has obvious band of expression as a result, than vigor 3572U/mg, is 10 times of contrast Erwinia (365U/mg), and is the highest from the ratio vigor of 28 ℃ of cultivations inducible enzyme after 2 hours.Be inducing of 4 hours and 6 hours beginning successively.The ratio vigor of inducible enzyme can be kept and not reduce in 12 hours after 2 hours.

Biosynthesizing 2 involved in the present invention, the technology of 5DKG reductase enzyme, the coryneform bacteria 2 of being cloned into, 5DKG reductase I gene and the difference of in the past reporting that has, import bacillus coli DH 5 alpha and Erwinia SCB125 at the expression vector that makes up, expression level is all very high, meet or exceed the level of present bibliographical information, recombinant expressed 2, the 5DKG reductase enzyme has very high catalytic activity, be applicable to and improve the technology that the glucose cascade fermentation produces the ancient dragon acid of vitamin C precursor 2-ketone group-L-, have very big using value.

Claims

1. 2,5 diketos of a sudden change-maltonic acid reductase enzyme (2, the 5DKG reductase I) and gene engineering expression system thereof is characterized in that:

A. 2, in the 5DKG reductase I gene coding region, 434 sport G by A, and 734 sport C by T, thereby make 145 of corresponding 2,5 DKG reductase Is to sport Arg by His, and 245 sport Ala by Val.

B.2,5 DKG reductase I genes are to adopt polymerase chain reaction technique (PCR) to obtain from coryneform bacteria SCB3058 genome amplification, and then make up the recombinant expression vector transformed host cell, are built into the gene engineering expression system.

2. as claimed in claim 12,5 DKG reductase I gene engineering expression systems, it is characterized in that 2, after the regulating and controlling sequence of 5DKG reductase I gene carries out deletion mutantion, put in PL promotor back, be built into recombinant expression vector PBL4, wherein spacing is 8bp between SD sequence and the ATG initiator codon.

3. as claim 1 and 2 described expression systems, it is characterized in that the host bacterium is intestinal bacteria, recombinant expression vector is PBL4.

4. as claim 1 and 2 described expression systems, it is characterized in that the host bacterium is an Erwinia, recombinant expression vector be transform on the PBL4 basis and PBLS.

5. recombinant expression vector as claimed in claim 4, its feature will about 2Kb the streptomycin resistance gene fragment be inserted into 2 of pBL4,5-DKG reductase I gene fragment back obtains plasmid pBLS.

6. expression system as claimed in claim 1 is characterized in that designing the 5 ' distal process that has synthesized the PCR reaction and becomes primer, and sequence is: 5 ' CGCCTACCCTGGAATTCATGACAG 3 '.