CN1212400C - Method of obtaining transgenic rape chloroplast plant for producing foot-and-mouth disease vaccine - Google Patents

Abstract

The present invention relates to a method of obtaining transgenic rape chloroplast plants for producing foot-and-mouth disease polypeptide vaccine, which comprises: foot-and-mouth disease polypeptide vaccine genes (sequences which are shown by SEQ ID NO: 3 and SEQ ID NO: 4) and fused vaccine genes which are obtained by serially connecting green fluorescin or other report genes are inserted between two segments on a carrier by using a sequence which is shown by SEQ ID NO: 1 of a genome homologous recombination segment of a cloning rape chloroplast genome, a sequence which is shown by SEQ ID NO: 2, and a site-directed transformation carrier of a rape chloroplast which is built by two DNA segments. The fused genes are inserted into a cloning vector, and the homologous recombination sequence of the genes and the rape chloroplast generate site-directed integration by transgenic technology; finally, the transgenic rape chloroplast plants for expressing foot-and-mouth disease polypeptide vaccine are obtained by the sieving of rape cells and the induction and the cultivation of the plants.

Description

Be used to produce the preparation method of the transgenic rape chloroplast plant of aftosa vaccine

Invention field

The present invention relates to a kind of preparation method that is used for the transgenic rape chloroplast plant of production foot and mouth disease polypeptide vaccine.Specifically, this method comprises: make up and to be used to the rape chloroplast associated dna sequence of fixing a point to transform; Synthetic foot and mouth disease polypeptide vaccine gene order; This sequence and reporter gene or gene with strong immunogenic protein are connected, make it to become the fusion bacterin gene; The rape chloroplast fixed point conversion carrier that contains foot and mouth disease polypeptide vaccine gene with this sequence construct; Transform rape with this conversion carrier, obtain to express the transgenic rape chloroplast plant of foot and mouth disease polypeptide vaccine.

Background technology

Existing the most frequently used plant nuclear expression system expression level is low, the highest vaccine protein amount only is 0.37% of a total protein in the plant that obtains the commentaries on classics vaccine gene as transforming with nuclear gene, recently the higher plant chloroplast(id) that grows up transforms then for this work provides new approach, utilizes the chloroplast(id) conversion of plant to overcome a lot of deficiencies that transform and have unique advantages in the nuclear gene group.As: (1) efficiently expresses: because the copy number of chloroplast gene group very big (for example about 1900～50000 copies of each leaf cell), the foreign gene that is incorporated into wherein also might exist with high copy number, and this just must provide condition for efficiently expressing of foreign gene; (2) prokaryotic gene need not to modify and transforms; (3) security is good: chloroplast(id) mostly is matrilinear inheritance, thereby has guaranteed engineered security, has particularly avoided the propagation of foreign gene to weeds or other non-purpose plants.(4) be convenient to genetic manipulation, can realize site-directed integration, eliminated " position effect " that exist in the consideration conveyization, and minimizing influences growth and development of plant.

But because chloroplast(id) overexpression foreign protein, therefore, the chloroplast(id) of plant might become industrial enzymes or pharmaceutical protein " bio-reactor ", work on hand is expressed by the chloroplast expression foreign gene, its expression amount is more than 100 of nuclear expression normally, high expression level amount has reached 46% of total soluble protein in the work on hand, and this fully shows the feasibility of utilizing chloroplast(id) conversion technology to produce pharmaceutical grade protein or vaccine.

Foot and mouth disease is to cause a kind of acute, deadly infectious disease artiodactylous by foot and mouth disease virus, infect with the direct way of contact, its harm is to liking domestic animal and tens kinds of other cloven-hoofed animals such as pig, ox, sheep, its infection velocity is exceedingly fast and easily causes and is very popular, very harmful to livestock industry classified as first of 18 kinds of category-A eqpidemic diseases by the International Animal Health code.Because foot and mouth disease in case take place will directly influence the export trade and the international fame of the livestock product of a country, some countries even take compulsory measuress such as ill domestic animal destruction are stoped and prevent the expansion of epidemic situation for this reason.The prevention foot and mouth disease is to be still the most effectual way of preventing and treating foot and mouth disease, and common method is the injection aftosa vaccine.Because foot and mouth disease has more seroimmunity type, various vaccine can not provide cross protection, so when the prevention foot and mouth disease takes place, use and the identical aftosa vaccine of local popular virus type more.How providing sufficient amount effective vaccine, and can carry out immunity effectively, is the key of prevention foot and mouth disease.

Aftosa vaccine commonly used is to utilize BHK (hamster kidney cell system) passage cell system, method to produce inactivated vaccine, this class immune effect of vaccine is good, but produce the animal cell culture technology that relates to, not only produce have high input, the cost height, and animal cell culture is easily polluted, so can only just have the ability to produce in a few devices complete laboratory or biological product factory, in this production of vaccine, want a large amount of propagative viruseses in addition, and should virus can pass through airborne transmission, so in case out of controlly will cause serious consequence.Need to develop energetically other good type vaccine of security for this reason.What research was more now is synthetic peptide vaccine, recombinant vaccine etc.

Synthetic peptide is the little peptide that is similar to the natural antigen decision with provide protection of synthetic, and the vaccine safety of being made by this little peptide is good, yet the synthetic expense is still higher; Recombinant vaccine then with the dna sequence dna in the virion with immunogenicity subunit protein or polypeptide as goal gene, express vaccine component by prokaryotic expression system.Because producing vaccine, this method do not relate to virus itself, so security good, but it equally still has the high shortcoming of cost with synthetic peptide vaccine, and its reason is that the immunogenicity of subunit protein or polypeptide is lower than common deactivation vaccine, so thereby need a large amount of injections to increase application cost.

For reducing the use cost of recombinant vaccine, utilizing plant is a selection preferably as bio-reactor expression and production vaccine, and the working condition of this method requires low more than animal cell culture, as long as just energy scale operation of soil is arranged; Because the endogenous pyrogen material of plant is few,, it should be noted that first utilizes the virus vaccines of transgenic plant expression and make immune animal all obtain to protect, the work of foot and mouth disease aspect just so it is also very low to extract the purifying cost of vaccine from plant.In addition, exploring the application of edible vaccine at present,, also be beneficial to transportation and application on aftosa vaccine if this imagination can be achieved not only and may further reduce the vaccine cost, very favourable to backwoodsman foot and mouth disease preventing and controlling.

Invention is described

。Work involved in the present invention promptly is to utilize rape chloroplast fixed point transformation technology to obtain to express the rape plant of aftosa vaccine.This method may further comprise the steps:

(1) makes up the rape chloroplast associated dna sequence that is used for transforming foreign gene to the rape chloroplast fixed point;

(2) gene order of composite coding foot and mouth disease polypeptide vaccine, the gene that makes this sequence and reporter gene or have a strong immunogenic protein is connected the foot and mouth disease polypeptide vaccine gene that obtains merging;

(3) dna sequence dna that step (1) is built and step (2) the synthetic foot and mouth disease polypeptide vaccine gene recombination of merging makes the vaccine gene sequence of fusion be positioned at the centre of rape chloroplast associated dna sequence;

(4) dna fragmentation that reorganization in the step (3) is obtained is inserted on the multiple clone site of cloning vector, as foot and mouth disease polypeptide vaccine vector for transgenic rape chloroplast site-specific conversion carrier; With

(5) conversion carrier that obtains with step (4) transforms rape, obtains the transgenic plant of chloroplast expression foot and mouth disease polypeptide vaccine.

The invention still further relates to a kind of method, may further comprise the steps to rape chloroplast fixed point conversion foreign DNA:

(1) makes up the relevant dna fragmentation of rape chloroplast that is used for transforming foreign gene to the rape chloroplast fixed point;

(2) dna fragmentation that step (1) is constructed and foreign gene reorganization makes exogenous gene sequence be positioned at the centre of rape chloroplast associated dna sequence;

(3) dna fragmentation that step (2) reorganization is obtained is inserted on the multiple clone site of cloning vector, as foreign gene rape chloroplast fixed point conversion carrier; With

(4) conversion carrier that obtains with step (3) transforms rape, and foreign gene is expressed in rape chloroplast.

Specifically, of the present inventionly relate to a kind of sequence that is used for transforming foreign DNA to rape chloroplast fixed point, it has the sequence shown in the SEQ ID NO:1 or its fragment that is not less than 1kb, and the sequence shown in the SEQ ID NO:2 or its fragment that is not less than 1kb.Should contain above-mentioned two location fragments sequence on the chloroplast site-specific conversion carrier, thereby realize that the rape chloroplast fixed point transforms.The location fragment is to clone two sections adjacent dna fragmentations (SEQ ID NO:1 and SEQ ID NO:2) of coming out with gene clone technology from the rape chloroplast genome, it is structured in makes exogenous gene sequence in the carrier, be that foot and mouth disease polypeptide vaccine gene order is positioned at two segmental centres, when carrier imported chloroplast(id), this two dna fragmentation can be incorporated on the sequence of chloroplast gene group with the homologous recombination form sequence that sheet is intersegmental.The suitable integration site that provides in the present invention is rps7 gene in the rape chloroplast genome and the transcribed spacer between the ndhB gene, i.e. 3 ' of the SEQ ID NO:1 5 ' end regions of holding SEQ ID NO:2.First fragment has 1037 nucleic acids, comprises 3 ' rps12 gene, rps7 gene and border sequence thereof; Second fragment has 2467 nucleic acids, comprises part ndhB gene and intergenic region.Rape chloroplast fixed point conversion carrier as location fragment structure, the fusion gene point of foot and mouth disease polypeptide vaccine and green fluorescence protein gene is inserted into transcribed spacer between genomic rps7 gene of rape chloroplast and the ndhB gene, promptly in the rape chloroplast genome the first segmental 3 ' end between the second segmental 5 ' end.These two segmental acquisitions can utilize known tobacco chloroplast dna sequence dna design primer, separate corresponding D NA fragment with the method for PCR from the rape chloroplast genome.Also can be from increasing according to SEQID NO:1 provided by the invention and SEQ ID NO:2 sequences Design primer.Transcribed spacer between rps7 gene and the ndhB gene can guarantee that this conversion process does not cause losing of original important sequence of chloroplast gene group, or disturbing the normal function that closes on gene, integration site is in the nonfunctional area of chloroplast gene group or the inessential district of function.So-called genomic nonfunctional area is meant does not have a nucleotide sequence of all biochemical reaction functions such as coded protein, regulatory gene duplicate, transcribe, translation in the Plant Genome, as the transcribed spacer between the gene, pseudogene sequence area, transcribed spacer etc.And the inessential district of function is meant the nucleotide sequence in the Plant Genome, its expressed product the normal growth of plant grow and physiological metabolism in do not play an important role, do not influence normal development and the Metabolic activity of plant after the disappearance.

In addition, the coding foot and mouth disease polypeptide vaccine gene that also relates to of the present invention contains sequence shown in SEQ IDNO:3 and the SEQ ID NO:4, its acquisition is immunogenicity sequence partly to be arranged from new design in the hoof-and-mouth disease toxalbumin, makes it be suitable for prokaryotic expression, carries out synthetic then.The aminoacid sequence of the foot and mouth disease immunogenicity that is provided in the invention, from domestic O type 58 and 86 strains is 140-160 and 200-213 aminoacid sequence on the viral foot and mouth disease VP1 albumen, these two sections sequences are to generally acknowledge to come out the virus ingredient with immunogenicity through comparative optimization.Simultaneously, its dna sequence dna is codon redesign and the synthetic with reference to the intestinal bacteria preference.E. coli codon uses the data of preference situation to obtain from the Internet related web site.

A kind of connecting method of foot and mouth disease peptide sequence also is provided among the present invention, promptly in the invention on the dna fragmentation splicing of coded polypeptide sequence dual mode is arranged, it is 200-213 amino acid that the one 140-160 amino acid for O58 strain system connects the O58 strain, and the 140-160 amino acid and the amino acid whose peptide chain of 200-213 of O86 strain system gone up in series connection again; Another 140-160 amino acid for O86 strain system connects 200-213 amino acid, and the 140-160 amino acid of going up O58 strain system of connecting again connects the amino acid whose peptide chain with 200-213.

Because above-mentioned described polypeptid DNA sequence encoding molecular weight of albumen is little, be unfavorable for accumulation, so also the dna sequence dna of aforementioned polypeptides is connected with the bigger albumen of other molecular weight again among the present invention, adopt among the present invention and connect, thereby be configured to the vaccine gene of fusion rotein form of polypeptide one green fluorescent protein of tool immunogenicity with the dna sequence dna of green fluorescence protein gene.Even so, also be not limited to green fluorescence protein gene with the placed in-line gene of aftosa vaccine gene among the present invention, can also use the placed in-line gene of other form, as foot and mouth disease virus VP1 protein gene sequence or other polypeptide fragment of said function is arranged, the protein gene that strong immunogenicity is more particularly arranged is as hepatitis B core protein gene etc.

Rape chloroplast conversion carrier of the present invention makes up on common cloning vector basis, and wherein said common cloning vector can be any cloning vector well known in the prior art, SK plasmid for example, pUC18, pUC19, pUC118, pUC119 etc.

Owing to be among the present invention, aftosa vaccine gene on the rape chloroplast conversion carrier will be expressed in chloroplast(id), so be connected with the chloroplast expression promotor in the upstream of gene, it has the startup function in the chloroplast gene group, makes the chloroplast expression frame that constitutes the aftosa vaccine gene.In promotor used in the present invention is promotor from the ribosomal RNA gene rrn of tobacco, and terminator is the terminator of tobacco psbA gene.Even so, other chloroplast(id) promotor and terminator with same function also is applicable among the present invention, particularly from corresponding chloroplast(id) gene promoter and the terminator of cress.The chloroplast expression frame of above-mentioned vaccine gene starts the selection markers gene chloroplast expression frame of expression as the foreign gene on the fixed point conversion carrier of rape chloroplast among the present invention by the chloroplast(id) promotor equally with one.Aspect vector construction, consider the selection markers gene is arranged so that transform individual screening.Used in the present invention is the antibiotic marker gene, i.e. the spectinomycin gene.Can be used for the marker gene, particularly betaine aldehyde dehydrogenase gene that plant chloroplast transforms selection but also can use other, promptly at this moment BADH adds betaine aldehyde chloride with the screening transformant on substratum.

The acquisition of the transgenic plant of rape chloroplast express polypeptide vaccine is the finished product of the present invention.Use the rape chloroplast conversion carrier polypeptide vaccine gene is imported rape or other cress chloroplast(id), foundation efficiently expresses the system of polypeptide vaccine, need carry out a series of work, comprise that method for transformation sets up, obtains the homogeneity transformant, under long wave ultraviolet light, excite green fluorescence to detect and analyze the expression etc. of vaccine gene with the GFP gene product.Aspect the importing of carrier, particle bombardment commonly used, microbeam laseropuncture method, protoplastis fusion method all are suitable for rape chloroplast of the present invention and transform.Aspect the screening of chloroplast(id) conversion individuality, the present invention has used spectinomycin selection markers gene, just can obtain transforming individuality as long as add the spectinomycin of proper concn in substratum.The so-called suitable antibiotic concentration of the present invention is 8-15mg/L, if when adopting the BADH gene as the selection markers on the conversion carrier, the betaine aldehyde chloride concentration in the substratum is at 5-10mg/L.

Method provided by the invention can import the aftosa vaccine gene in the rape chloroplast genome, and transformed plant is used for the production of aftosa vaccine, compare with the aftosa vaccine production method of present use, it has following advantage: whole process of production transforms rape by plantation and gets final product, do not relate to the cultivation and the breeding of virus, have high security; The expression efficiency height, the expression efficiency that the nuclear gene of comparable plant transforms improves at least 10 times, even exceeds 100 times; Production cost is reduced greatly.Therefore, the present invention provides new method for aftosa vaccine production, and is significant to its prevention, also has general reference significance with the improvement of advancing the production method of other vaccine.

Description of drawings

Fig. 1. the rape chloroplast fixed point of aftosa vaccine gene transforms and expression vector establishment figure

Fig. 2. the splicing synoptic diagram of synthetic oligonucleotide fragment

The preparation of embodiment 1. foot and mouth disease polypeptide vaccine fusion genes

1. sequences Design

Foot and mouth disease polypeptide vaccine gene order mainly is to adopt the sequence of domestic virus strain, and situation about codon being had a preference for according to the acceptor of genetic expression in future redesigns.

The foot and mouth disease polypeptide vaccine gene order that is adopted obtains from international gene database (GeneBank), mainly choose O58 and O86 strain system from the O C-type virus C of China, utilize and generally acknowledge to have amino acid whose 20 amino acid polypeptides of coding VP1 albumen 140-160 (to call 20 peptides in the following text) and amino acid whose 14 amino acid polypeptides of 200-213 (the to call 14 peptides in the following text) sequence of vaccine effect at present, as the peptide sequence that plays the immunogenic effect in the polypeptide vaccine gene.

Because synthetic polypeptide vaccine gene will be mainly used in the chloroplast(id) of protokaryon and prokaryotic and express, so when design, adopt the prokaryotic preference codon to replace original codon as far as possible.Replace mainly and codon preference situation is determined with reference to intestinal bacteria

For using the prokaryotic codon as far as possible, originally be operated in when determining final polypeptide vaccine gene order mainly according to as the aminoacid sequence on the virus VP 1 albumen of vaccine composition, directly adopt the intestinal bacteria preference codon.Such as leucine, just directly with the highest corresponding nucleotide sequence of CTG conduct of utilization ratio in the intestinal bacteria.

Though the nucleotide sequence of the polypeptide fragment that designs is not very long, but still be difficult to directly synthetic full length sequence, so with its salvage, upper and lower chain is divided into several sections and synthesizes, cochain is 4 sections, coding be respectively virus O 58 strains be have on the VP1 egg immunogenicity 20 peptides, 14 peptides and 20 peptides of O86 strain system and 14 peptides (explanation see before literary composition), its length of nucleotides is two kinds of 60bp and 42bp, cochain 5 ' is held whole phosphorylations; Following chain is convenient for synthetic, has designed a plurality of chains, wherein not only have and the complete homologous segment of cochain, and also have with homophyletic system or not homophyletic be the fragment that different cochains have complementary relationship.In addition also according to the sequences Design of polypeptide vaccine gene primer, in order to the synthetic good fragment that increases, and on primer, added the recognition sequence of restriction enzyme.It is synthetic that polypeptide gene that designs and primer are transferred to DNA Synesis Company.

Its concrete sequence is as shown in table 1:

The oligonucleotide fragment of table 1. design

Numbering	Sequence
		A	5’GTG ACC AAA GTG AGA GGC GAT CTG CAG GTG CTG GCG CAG AAA GCG GCA CGC TCT CTG CCG(SEQ ID NO：11)
B	5’AGA CAT AAA CAG AAG ATT GTG GCA CCA GGC AAA CGC CTG CTG(SEQ ID NO：12)
		C	5’GTG AGC AAC GTG AGA GGC GAT CTG CGA GTG CTG GCG CAG AAA GCG GAA AGA GCG CTG CCG(SEQ ID NO：13)
D	5’AGA CAT AAA CAG AAG ATT GTG GCA CCA GCA AAA CAA CTG CTG(SEQ ID NO：14)
		1	5’GAA TTC TAA TAG CTC GAG GTC GAC AAG CTT ACC ATG(SEQ ID NO：15)
2	5’TTT GGT CAC CAT GGT AAG CTT GTC GAC(SEQ ID NO：16)
		3	5’CGC TTT CTG CGC CAG CAC CTG CAG ATC GCC TCT CAC(SEQ ID NO：17)
4	5’TGG TGC CAC AAT CTT CTG TTT ATG TCT CGG CAG AGA GCG TGC(SEQ ID NO：18)
		5	5’GTT GCT CAC CAG CAG GCG TTT GCC(SEQ ID NO：19)
6	5’CTC GAG CTA TTA GAA TTC CAG CAG GCG TTT GCC(SEQ ID NO：20)
		7	5’GTT GCT CAC CAT GGT AAG CTT GTC GAC(SEQ ID NO：21)
8	5’TGG TGC CAC AAT CTT CTG TTT ATG TCT CGG CAG CGC TCT TTC(SEQ ID NO：22)
		9	5’TTT GGT CAC CAG CAG TTG TTT TGC(SEQ ID NO：23)
10	5’CTC GAG CTA TTA GAA TTC CAG CAG TTG TTT TGC(SEQ ID NO： 24)

2. fragment assembly

The synthetic oligonucleotide fragment dissolves with distilled water, wherein is used for the about 800ng/ μ l of all being diluted to of synthetic gene, is used as the synthetic fragment dissolving of primer and is diluted to 80ng/nl.Splice by mode shown in Figure 2 then.

In Fig. 2, Segment A and B represent 20 peptides of O58 strain system and the cochain of 14 peptides respectively, C and D represent 20 peptides of O86 and the cochain oligonucleotide fragment of 14 peptides respectively, 1 representative be the cochain oligonucleotide fragment of an artificial design, mainly providing enzyme cuts sequence and makes primer usefulness, its 5 ' hold phosphorylation equally, 2,3,4,5,6,7,8,9,10 the representative be respectively chain oligonucleotide fragment under the synthetic, wherein some chain can be complementary mutually with different cochains simultaneously, for use in splicing the not cochain of homophyletic system, wherein fragment 1,6,10 also will be as the primer synthetic chain that increases.

Press the gene splicing operation of O58 (20 peptides-14 peptide)-O86 (20 peptides-14 peptide) polypeptide sequence:

It is one group with Segment A, 2,3 respectively; Fragment B, 4,5 is one group; Fragment C, D, 3,8,10,1 are one group, by waiting mole to mix.The fragment solution 10 μ l that mix are put in the water-bath that is warmed up to 95 ℃, outage back naturally cooling 10 hours.

Press the gene splicing operation of O86 (20 peptides-14 peptide)-O58 (20 peptides-14 peptide) polypeptide sequence:

Be one group with fragment C, 7,3 respectively, fragment D, 8,9 is one group, Segment A, B, 3,4,6,1 be one group by etc. mole mix.The fragment solution 10 μ l that mix in being warmed up to 95 ℃ water-bath, outage back naturally cooling 10 hours.

3. fragment connects

Respectively get an amount of mixing by three spellings of the gene splicing of O58 (20 peptides-14 peptide)-O86 (20 peptides-14 peptide) polypeptide sequence operation thing of practicing midwifery, get the connection damping fluid I (Dalian Bao Sheng biotech firm product) that 5 μ l add equivalent, connect more than 16 hours in 16 ℃.70 ℃ of deactivations are after 10 minutes, with 100 times of TE damping fluid dilutions ,-20 ℃ of preservations.

Pressing the gene splicing product of O86 (20 peptides-14 peptide)-O58 (20 peptides-14 peptide) polypeptide sequence handles the same.

Fragment after the connection is actually an annular DNA chain.Promptly press the gene fragment of O58 (20 peptides-14 peptide)-O86 (20 peptides-14 peptide) polypeptide sequence.

The synthetic chain of first kind of situation, the gene fragment of promptly pressing O58 (20 peptides-14 peptide)-O86 (20 peptides-14 peptide) polypeptide sequence, because fragment cochain oligonucleotide chain 5 ' end phosphorylation, so connect into a complete annular DNA strand.Following chain does not utilize fragment 1,10 as primer at the intersegmental breach that is still of oligonucleoside sheet but do not influence, can be to its amplification of carrying out by PCR.The synthesis mode of second kind of situation is similar.

4. synthetic segmental pcr amplification

Utilize primer sequence that above-mentioned connection product is carried out pcr amplification, PCR carries out on PE480 PCR instrument.

PCR reaction system: 10XPCR damping fluid 5 μ l, 10mM dNTP 4 μ l, Pfu archaeal dna polymerase 2U, primer 1 (80ng/ μ l) 2 μ l, primer 2 (80ng/ μ l) 2 μ l connect product 1 μ l, add water to cumulative volume 50 μ l, above-mentioned composition all joins 0.5mL PCR pipe, and the back that is mixed covers the aseptic paraffin oil of one deck (20-30 μ l).

The gene fragment of pressing O58 (20 peptides-14 peptide)-O86 (20 peptides-14 peptide) polypeptide sequence that wherein increases uses fragment 1,10 as primer, and amplification is pressed the gene fragment of O58 (20 peptides-14 peptide)-O86 (20 peptides-14 peptide) polypeptide sequence and used fragment 1,6 as primer.

The PCR program is: 95 ℃ of pre-sex change 5 minutes; 94 ℃ of sex change are 1 minute then, 65 ℃ of renaturation 1 minute, and 72 ℃ were extended 2 minutes, and circulated 30 times.Get 10 μ l PCR products after reaction finishes and carry out the agarose gel electrophoresis detection.All the other use phenol/chloroform extraction method purifying.-20 ℃ of preservations.

The clone that the rape chloroplast fixed point expression of embodiment 2. foot and mouth disease polypeptide vaccine fusion genes and conversion carrier make up 1. chloroplast site-specific recombinant fragments

The amplification of rps7 gene and clone

With reference to the sequence at tobacco chloroplast rps7 gene two ends, design is also given birth to synthetic following two primers of worker company by Shanghai, each primer 5 ' end has added specific restriction enzyme site and protection base respectively:

5’GCG GGTACCGCCCTTATAAAAAGAA 3’(SEQ ID NO：5)

KpnI

5’CGC GGGCCCCTTCTCTCCATCGG 3’(SEQ ID NO：6)

ApaI

With rape chloroplast DNA is template, with the rps7 gene of above-mentioned primer amplification rape.Reaction solution consists of: 10 * Taq buffer, 5 μ l, dNTPs (each 2.5mmol/L) 2 μ l, each 2 μ l of primer (10pmol/ μ l), rape chloroplast DNA (20-50ng/ μ l) 2 μ l, high-fidelity DNA polymerase (3-5U/ μ l) 1 μ l adds sterilization distilled water to 50 μ l.The pcr amplification program is: 95 ℃ of pre-sex change 5min → 95 ℃ of sex change 30s, and 48 ℃ of annealing 1min, 72 ℃ are extended 2min, and totally 30 circulations are extended 10min for → 72 ℃.

Obtain the dna fragmentation of a 1.0kb after the amplification, its size is with consistent from the corresponding DNA fragments of tobacco and paddy rice, and therefore, we infer that this fragment may comprise the rps7 gene of rape chloroplast.This fragment is connected into pGEM-T vector, and transformed into escherichia coli obtains 72 white colonies altogether.The plasmid of 10 bacterium colonies is wherein carried out enzyme cut, finding has 8 bacterium colonies to contain the insertion fragment of 1.0kb, and we name these recombinant plasmids into pTR (1-8).

The amplification of ndhB gene and clone

With reference to the gene order of tobacco chloroplast ndhB, designed and synthesized following two primers, 5 ' end of each primer has added specific restriction enzyme site and protection base respectively:

5’GCG GCGGCCGCCCATGGAATAAGGTTTGAT 3’(SEQ ID NO：7)

NotI

5’CGC CCGCGGGAATGTATATAACCCTATTC 3’(SEQ ID NO：8)

SacII

With rape chloroplast DNA is the ndhB gene of template amplification rape, and other is the same except that the primer difference in the reaction solution system.Obtain the dna fragmentation of an about 2.4kb after the amplification, after the purified recovery of amplified production,, be connected in then on the pBluescriptSK plasmid that same enzyme is cut, again the transformed competence colibacillus bacillus coli DH 5 alpha with NotI and SacII double digestion.The bacterium colony that grows on LB (Amp100mg/L) flat board is carried out enzyme cut evaluation.The result shows that these 10 bacterium colonies all contain the insertion fragment of 2.4 kb.These recombinant plasmids are named into pSN (1-10).

2. the rape chloroplast fixed point transforms the intermediate carrier structure

As the homologous recombination fragment, make up the fixed point conversion carrier of rape chloroplast with above clone's rps7 gene and ndhB gene.The 1.0kb dna fragmentation (being called for short rps7 in building process) that at first will comprise the rps7 gene downcuts from pTR4 with KpnI and ApaI, is inserted on the pBluescript SK (+) that same enzyme is cut, and obtains plasmid pSR21.With KpnI and XhoI rps7 is downcut from pSR21 again, be inserted on the pSN that same enzyme is cut, obtain plasmid pSNR4.With XhoI and NotI cutting plasmid pSZB8, obtain the expression cassette (Prrn-aadA-psbA3 ') of selection markers gene aadA, this expression cassette is inserted on the pSNR4 that same enzyme is cut, and obtains intermediate carrier pNRA8.

3. the structure of the fusion gene of foot and mouth disease polypeptide vaccine and chloroplast expression frame thereof

Plasmid p16SP and pT393 (structure and the pesticidal thereof of rape chloroplast fixed point conversion carrier, Hou Bingkai etc., hi-tech communication, 2000,7,5-11 page or leaf; The structure of tobacco chloroplast conversion carrier and the acquisition of transfer-gen plant, Zou Zhurong, Acta Agronomica Sinica, 1998, July, the 24th the 4th phase of volume; The clone's transformation of tobacco chloroplast 16S promotor and the acquisition of transfer-gen plant, illawarra mountain pine, 1999, September, the 25th the 5th phase of volume; High-frequency plastid transformation intobacco by selection for a chimeric aadA gene, Proc.Natl.Acad.Sci.USA, Vol.90, pp913-917,1993) contain chloroplast gene promotor Prrn and terminator psbA3 ' respectively, cut, connect through suitable enzyme and can not only be comprised promotor, but also comprise the plasmid pTP4 of terminator.To synthesize fragment cuts, mends flat through the NocI enzyme, cut through the EcoRI enzyme again, and together be inserted between the promotor and terminator of plasmid pTP4 with the GFP gene fragment that EcoRI and SalI enzyme are cut, obtain comprising the intermediate carrier pTPFG1 of anti-source polypeptide-GFP fusion bacterin expression of gene box.Because vaccine gene is positioned under the prokaryotic chloroplast(id) promotor on this intermediate, so vaccine gene can be at expression in escherichia coli, the thalline of promptly cloning this plasmid can inspire green fluorescence with blue streak under long wave ultraviolet or fluorescent microscope.

4. the structure of final carrier

PTPFG1 cuts, mends flat, NotI enzyme through the XhoI enzyme and cuts, and recyclable vaccine gene expression cassette is inserted into then through the SpeI enzyme and cuts, mends on the pNRA8 flat, that the NotI enzyme is cut, and obtains final chloroplast(id) and transforms carrier pNRAFG1.This carrier comprises the aftosa vaccine expression casette and the aadA selection markers expression of gene box of fusion gene form, is respectively homologous dna fragment rps7 and ndhB from rape chloroplast in their both sides.PNRAFG1 cuts checking through enzyme and shows the correct (see figure 1) of structure.

The acquisition of the rape chloroplast transformed plant of embodiment 3. foot and mouth disease polypeptide vaccine fusion genes

1. material

The plant acceptor is two low (low erucic acid, low-sulfur glycosides) rape (Brassica napusL.) the kind H165 of cabbage type.

The substratum that adopts is:

MS:MS basal component+sucrose 30g/L+ agar 7.0g/L, pH5.8

MB ₆：MS+6-BA6mg/L，pH5.8

MB ₁：MS+6-BA1mg/L，pH5.8

MN：MS+NAA0.1mg/L，pHS.8

BS：B5+6-BA6mg/L+NBA 0.45mg/+AgNO3 10μM，pH5.8

The method that a large amount of preparations of plasmid pNRAFG1 are introduced with reference to " Molecular cloning " (Sambrook etc., 1989) is carried out.The plasmid DNA of extracting is through agarose gel electrophoresis and UV spectrophotometer measuring purity and concentration, and concentration is transferred to 1 μ g/ μ l.

The preparation of particle gun bullet

Preparation bronze suspension: the 60mg bronze adds the 1ml dehydrated alcohol; Vibration mixes 1-2min, the centrifugal ethanol of abandoning; Repeat A, B step 3 time; 10, the centrifugal 1min of 000rpm removes supernatant, adds the 1ml sterilized water, and is resuspended; 10, the centrifugal 1min of 000rpm removes supernatant, adds the 1ml sterilized water, and is resuspended.

Preparation bullet: get 50 μ l bronze suspensions, add 5 μ l plasmid pNRAB (1 μ g/ μ l) successively, 50 μ l 2.5mol/L CaCl2,20 μ l 0.1mol/L spermidines; Vibration mixes 3min, and 10, the centrifugal 1min of 000rpm removes supernatant; Add 250 μ l dehydrated alcohols, vibration mixes, and centrifugal 10s removes supernatant; Add 60 μ l dehydrated alcohols, resuspended.Every rifle is got 5-10 μ l during bombardment.

2. particle gun transforms

With the acceptor material of 4-5 days coleseed petiole of cultivation as conversion.

The material pre-treatment: the height that the coleseed petiole is placed on the additional 0.5mg/L N.F,USP MANNITOL (or sorbyl alcohol) of MS oozes on the substratum, carries out the preceding height of 4h and oozes.Then cotyledon petiole is arranged in new substratum be subjected to (drawn a circle to approve the bombardment scope in the culture dish bottom in advance) in the bombardment zone, cotyledon petiole is arranged closely, and cotyledon petiole slightly upwards erects, so that increase the probability that the cotyledon petiole incision is hit.

Particle gun bombardment process: particle gun places on the Bechtop, cleans vacuum chamber with 70% ethanol, can split disk, little missile-borne body, stop that net is immersed in the 15min and drying up of sterilizing in 70% ethanol.Get 5-10 μ l bag by the bronze suspension of DNA, be evenly coated in the microcarrier middle part and dry up.Opening power, vacuum pump and helium cylinder valve screw the split disk of the selected pressure fixed cap of packing into, will be loaded with the microcarrier of little bullet and stop the net launching device of packing into.The culture dish that cotyledon petiole is housed is put on the selected position of vacuum chamber, taken away the culture dish loam cake and expose target tissue.Vacuumize, select suitable pressure (1100psi) to bombard.Twice of every ware bombardment.Afterwards cotyledon petiole is set level, be attached to height and ooze and carry out the back height on the substratum and ooze 16h.Several of front and back are bombarded about 1000 of cotyledon petioles altogether.

3. the screening of transformed plant

The high later cotyledon petiole that oozes processing of warp changes MB over to ₆Culture medium culturing 2-3 days, change MB then over to ₆In the screening division culture medium of additional spectinomycin (Spe) 8mg/L.The green bud clump that will obtain after three weeks changes MB over to ₆The screening division culture medium of additional Spe 10mg/L, continuous subculture twice on this substratum, each three weeks.The green bud that will obtain then changes MB over to ₁The division culture medium of additional Spe 10mg/L.The regrowth of growing up on this substratum is the T0 generation of transformed plant.

4. the homogeneity of transformed plant

Because the chloroplast(id) in T0 generation transforms plant and is difficult to reach homogeneity, promptly all chloroplast DNA molecules are all transformed, so also will will carry out the homogeneity screening and culturing in the present invention to the regenerated sprout, its concrete operations are to cut the square T0 of the 1cm true leaf blade in generation, be put on the BS substratum of additional spectinomycin (Spe) 10mg/L inducing culture to producing regeneration bud, it is T1 generation, if find not reach homogeneity by detecting, then continue the true leaf blade in T1 generation is cut into the square fritter of 1cm, be put on the BS substratum of additional spectinomycin (Spe) 10mg/L inducing culture to producing regeneration bud, this is T2 generation, in like manner detect and do not reach the similar screening and culturing of proceeding of homogeneity requirement, the true requirement that reaches homogeneity to the regeneration bud that obtains.

The transforming gene sprout that reaches homogeneity changes the additional Spe 8mg/L root media of MN over to, and the root system development good stand is planted in the engagement soil,

The detection of embodiment 4. transgene rapes

1.GFP fluorescence is identified

Shine the green seedling that institute's (long wave on the home-made three-wavelength Ultraviolet Detector gets final product) obtains with long-wave ultra violet lamp, what can send green fluorescence is the transgenosis individuality.Or utilize the blue streak shooting conditions of fluorescent microscope to observe down the blade that changes plant, the transformed plant that is of green fluorescence is arranged, and show at the foot and mouth disease immunogenicity polypeptide of green fluorescence protein gene upstream and also necessarily expressed.

2. the homogeneity PCR method of chloroplast(id) conversion detects

PCR primer design: can illustrate in order to make the pcr amplification result whether foreign gene fixes a point to be inserted between two homologous fragments and the degree of isozygotying, when the design primer,, another primer is selected in 267bp place, ndhB gene initiation codon downstream specially with 65bp place, a primer rps7 homologous fragment upstream.Use this two primers, reach homogeneity, then can only amplify 4kb dna fragmentation one band if chloroplast(id) transforms body; If be heterozygote, then can amplify about 4kb and 1.1kb two bands; If be non-transformant, then can only amplify the band of 1.1kb.

Because the chloroplast gene group complete sequence of rape is not clear at present, a primer has used the dna sequence dna of tobacco corresponding site, and another primer then adopts the sequence of rape ndhB gene itself.The sequence of two primers is as follows:

5’GAGATCCACCCTACAATATG 3’(SEQ ID NO：9)

5’TCCTGAAAAGCTAATCATAG G 3’(SEQ ID NO：10)

PCR reaction: get total DNA with transformed plant as template, carry out pcr amplification by the standard reaction program.Owing to may have the big dna fragmentation of 4kb in the amplified production, select the big segmental LA Taq enzyme that increases that is suitable for of TaKaRa company production in the present embodiment for use.Reaction solution consists of: the total DNA of rape (20-50ng/ μ l) 2 μ l; 10 * LA buffer, 5 μ l; DNTPs (each 2.5mmol/L) 5 μ l; Primer 1 (10pmol/ μ l) 1 μ l; Primer 2 (10pmol/ μ l) 1 μ l; TaKaRa LA Taq enzyme 1 μ l; Add sterilization distilled water to 50 μ l.

Concrete amplification condition is: 95 ℃ of pre-sex change 5min; 95 ℃ of 1min → 47 ℃ 1min → 72 ℃ of 8min circulate 30 times: last 72 ℃ of extension 10min altogether then.Get 10 μ l PCR products after reaction finishes and carry out agarose gel electrophoresis.

The plant detected result of transformation tissue culture generally is non-homogeneity plant for the first time, promptly detects by PCR and amplifies about 4kb and 1.1kb two bands, and wherein the 1.1kb band is heavier, and the 4kb band is very weak.But being cut into small pieces of regeneration plant carried out taking turns screening and culturing again, the result that PCR detects still has the 1.1kb band, but it is more weak, and two 4kb bands are strong, through screening and culturing several times, when final plant detects, have only the 4kb band, could judge that at this moment the chloroplast(id) conversion of transformed plant reaches pure materialization.

3. the detection of aftosa vaccine gene expression product

Positive anti-source preparation: utilize NcoI and SalI enzyme to cut prokaryotic expression carrier plasmid pET28a, reclaim the plasmid fragment of cutting, it together is connected with the GFP gene fragment that polypeptide vaccine gene fragment, EcoRI and SalI enzyme that the EcoRI enzyme is cut are cut with NcoI, the competence that connects product transformation receptor bacterium BL21, the transformant of the vector plasmid that contains the polypeptide vaccine fusion gene that obtains, with reference to relevant pET product description the transformant thalline is carried out inducing culture, collect thalline, separated product is positive anti-source after the SDS protein electrophoresis detects purity.Albumen also can downcut from SDS-PAGE glue in addition, injects animal (as rabbit) after the drying and crushing and obtains corresponding antiserum(antisera).

The extraction of vegetable-protein: get the 100mg vegetable material, add grinding buffer solution (10mM Tris.Cl, 0.02 NaN3,0.001%PMSF, pH8.0) 200 μ l are ground into homogenate in the ice bath, under the 5000rpm room temperature centrifugal 10 minutes, get supernatant.

Enzyme-linked immunoassay: the enzyme-linked immunoassay method by standard is measured, and wherein test sample is from the isolating positive protein sample of prokaryotic expression mouth, and from the isolating albumen of plant transformed, and the isolated albumen of unconverted plant is as negative protein sample.

Get a certain amount of sample and join and wrap quilt in the Sptting plate, its positive anti-source protein is added in the hole of Sptting plate by gradient.

Wash unnecessary antigen off.

Add the anti-foot and mouth disease antiserum(antisera) of test antibody-rabbit (utilize positive protein to annotate that rabbit produces, or directly use Chinese Lanzhou animal doctor institute biology the anti-foot and mouth disease serum of rabbit).

Wash unnecessary antibody off.

The goat-anti rabbit 1gG that adds alkali phosphatase enzyme mark.

Flush away is combination two anti-not.

Add NBT/BCIP colour developing liquid.

Colour developing

Microplate reader is measured light absorption value (OD value), can measure band according to the coloured product gradient of coloured end product content and positive anti-source of separating anti-source from plant and survey antigenic content.

Generally speaking, the polypeptide vaccine fusion rotein can account for more than 1% of total soluble protein in the conversion plant of homogeneity.

Sequence table

＜110〉Gansu Yasheng Group

Institute of Genetics, Academia Sinica

＜120〉be used to produce the preparation method of the transgenic rape chloroplast plant of aftosa vaccine

<130>I2001666

<160>24

<170>PatentIn version 3.1

<210>1

<211>1037

<212>DNA

＜213〉rape

<400>1

aactgattct tgaccccctt tcacgctcat gtcacgtcga ggtactgcag aagaaaaaac 60

tgcaaaatcc gatccaattt atcgtaatcg attagttaac atgttggtta accgtattct 120

gaaacacgga aaaaaatcat tggcttatca aattatctat cgagccttga aaaagattca 180

acaaaagaca gaaacaaatc cactatctgt tttacgtcaa gcgatacgtg gagtaactcc 240

cgatatagca gtaaaagcaa gacgtgtagg cggatcaact catcaagttc ccattgaaat 300

aggatccacg caaggaaaag cacttgccat tcgttggtta ttaggggcat cccgaaaacg 360

tccgggtcga aatatggctt tcaaattaag ttccgaatta gtggatgctg ccaaagggag 420

tggcgatgcc atacgcaaaa aggaagagac tcatagaatg gcagaggcaa atagagcgtt 480

tgcacatttt cgttaatcca tgaacaggat ctatatagac acatagatcc gtggatccat 540

acatctcgat ccgaaaagaa tcaatagaaa aagaaaaaat cggaattgat cgatctcttt 600

ctcgaaacaa acgaaaagga aagaaaagac gaaacataaa tcatggatca actaagccct 660

ctcggggact tgcttaagaa taagaaagag caatctcatg taaataccat ggaataaggt 720

tttaacctat tcatggggat tccgtaaata ttccattcaa aaaaaaaaaa attggttttt 780

ttttggagat tggatgcagt tactaattca tgatctggca tgtacagaat gaaaatttca 840

ttctcgattc tacgagaatt tttatgaaag cctttcattt gcttctcttc gatggaagtt 900

ttattttccc agaatgtatc ctaatttttg gcctaatcct tcttctgatg atcgattcaa 960

cctctgatca aaaagatata ccttggttat atttcatctc gtcaacaagt ttcgtaatga 1020

gcataacggc cctattg 1037

<210>2

<211>2467

<212>DNA

＜213〉rape

<400>2

cctattcatg gggattccgt aaatattcca ttcaaaaaaa aaaaaattgg tttttttttg 60

gagattggat gcagttacta attcatgatc tggcatgtac agaatgaaaa tttcattctc 120

gattctacga gaatttttat gaaagccttt catttgcttc tcttcgatgg aagttttatt 180

ttcccagaat gtatcctaat ttttggccta atccttcttc tgatgatcga ttcaacctct 240

gatcaaaaag atataccttg gttatatttc atctcgtcaa caagtttcgt aatgagcata 300

acggccctat tgttccgatg gagagaagaa cctatgatta gcttttcagg aaatttccaa 360

acgaacaatt tcaacgaaat ctttcaattt cttattttac tatgttcaac tctctgtatt 420

cctctatccg tagagtacat tgaatgtaca gaaatggcta taacagagtt tctgttattc 480

gtattaacag ctactctagg aggaatgttt ttatgtggtg ctaacgattt aataactatc 540

tttgtagctc cagaatgttt cagtttatgc tcctacctat tatctggata taccaagaaa 600

gatgtacgat ctaatgaagc tactatgaaa tatttactca tgggtggggc aagctcttct 660

actctggttc atggtttctc ttggctatat ggttcatccg ggggagagat tgagcttcaa 720

gaaatagtga atggtcttat caatacacaa atgtataact ccccaggaat ttcaattgcg 780

cttatattca tcactgtagg aattgggttc aagctttccc tagccccttc tcatcaatgg 840

actcctgacg tataccaagg agtgcggttc gtttgagaaa ttcctacctc tctatctatc 900

tctgagatgt ttggattttt caaaactcca tggacatgca gaagagaaat gctatcccca 960

cgcagaccaa gacagaactt tgacttgttc aaataacaat taatgtgaag cagggtcagg 1020

aacaacgaat ctctttatga taaacggatc cattttgcaa gtttgttatt acgggtagtt 1080

cctacaaagg atcggactaa tgacgtatac aagaaagact tgaattctcg atgtagatgc 1140

tacatagttg gttctcatcc ttcagagact acgagtgtaa taggagcatc cgtcgacaaa 1200

aggatcaccc taagatgatc atctcatggc tattgagaac gaatcaaatc agatggttcc 1260

atttctcaat ctttcggacg tgctcctacg gaaccaaggt cgaaacgatt gagaaaaatc 1320

agtcattcac aaccactgat gaaggattcc tcgaaaagtt aaggattagt catccgtttt 1380

agaaaggatt cgatcttaac atacgcgagg aaagtaatca aaaaagaaag aagatgagtt 1440

cttctttact tttatcactt aggagccgtg cgagatgaaa gtctcatgca cggttttgaa 1500

tgagagaaag aagtgaggaa tcctcttttc gactctgact ctcccactcc agtcgttgct 1560

tttctttctg ttacttcgaa agtagctgct tcagctttag ccactcgaat tttcgatatt 1620

cctttttatt tctcatcaaa tgaatggcat cttcttctgg aaatcctagc tattcttagc 1680

atgatattgg ggaatctcat tgctattact caaacaagca tgaaacgtat gcttgcatat 1740

tcgtccatag gtcaaatcgg atatgtaatt attggaataa ttgttggaga ctcaaatggt 1800

ggatatgcga gcatgataac ttatatgctg ttctatatct ccatgaatct aggaactttt 1860

gcttgcatta tattatttgg tctacgtacc ggaactgata acattcgaga ttatgcagga 1920

ttatacacaa aagatccttt tttggctctc tctttagctc tatgtctctt atccctagga 1980

ggtcttcctc cactagcagg tttttttgga aaacttcatt tattctggtg tggatggcgg 2040

gcaggcctat atttcttggt ttcaatagga ctccttacga gcgttctttc tatctactat 2100

tatctaaaaa taatcaagtt attaatgact ggacgaaacc aagaaataac ccctcacgtg 2160

cgaaattata gaatatcccc tttaagatca accaattcca tcgaattgag tatgattgta 2220

tgtgtgatag catctactat accaggaata tcaatgaacc cgattattgc gattgctcag 2280

gatagccctt tttagcttct agaatctatt tcttagttca agatccctct tactaactgg 2340

aatcaaagaa ttagtagatc ggttccgccc aaaatgggaa tggactaagg ttatgaactt 2400

ataatctata atctgatgat cgagtcgatt ccatgattat aagttcattc cataccggac 2460

caggccg 2467

<210>3

<211>204

<212>DNA

＜213〉aftosa vaccine

<400>3

gtgaccaaag tgagaggcga tctgcaggtg ctggcgcaga aagcggcacg ctctctgccg 60

agacataaac agaagattgt ggcaccaggc aaacgcctgc tggtgagcaa cgtgagaggc 120

gatctgcgag tgctggcgca gaaagcggaa agagcgctgc cgagacataa acagaagatt 180

gtggcaccag caaaacaact gctg 204

<210>4

<211>204

<212>DNA

＜213〉aftosa vaccine

<400>4

gtgagcaacg tgagaggcga tctgcgagtg ctggcgcaga aagcggaaag agcgctgccg 60

agacataaac agaagattgt ggcaccagca aaacaactgc tggtgaccaa agtgagaggc 120

gatctgcagg tgctggcgca gaaagcggca cgctctctgc cgagacataa acagaagatt 180

gtggcaccag gcaaacgcct gctg 204

<210>5

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>5

gcgggtaccg ccct tataaa aagaa 25

<210>6

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>6

cgcgggcccc ttctctccat cgg 23

<210>7

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>7

gcggcggccg cccatggaat aaggtttgat 30

<210>8

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>8

cgcccgcggg aatgtatata accctattc 29

<210>9

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>9

gagatccacc ctacaatatg 20

<210>10

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>10

tcctgaaaag ctaatcatag g 21

<210>11

<211>60

<212>DNA

＜213〉artificial sequence

<220>

＜223〉oligonucleotide

<400>11

gtgaccaaag tgagaggcga tctgcaggtg ctggcgcaga aagcggcacg ctctctgccg 60

<210>12

<211>42

<212>DNA

＜213〉artificial sequence

<220>

＜223〉oligonucleotide

<400>12

agacataaac agaagattgt ggcaccaggc aaacgcctgc tg 42

<210>13

<211>60

<212>DNA

＜213〉artificial sequence

<220>

＜223〉oligonucleotide

<400>13

gtgagcaacg tgagaggcga tctgcgagtg ctggcgcaga aagcggaaag agcgctgccg 60

<210>14

<211>42

<212>DNA

＜213〉artificial sequence

<220>

＜223〉oligonucleotide

<400>14

agacataaac agaagattgt ggcaccagca aaacaactgc tg 42

<210>15

<211>36

<212>DNA

＜213〉artificial sequence

<220>

＜223〉oligonucleotide

<400>15

gaattctaat agctcgaggt cgacaagctt accatg 36

<210>16

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉oligonucleotide

<400>16

tttggtcacc atggtaagct tgtcgac 27

<210>17

<211>36

<212>DNA

＜213〉artificial sequence

<220>

＜223〉oligonucleotide

<400>17

cgctttctgc gccagcacct gcagatcgcc tctcac 36

<210>18

<211>42

<212>DNA

＜213〉artificial sequence

<220>

＜223〉oligonucleotide

<400>18

tggtgccaca atcttctgtt tatgtctcgg cagagagcgt gc 42

<210>19

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉oligonucleotide

<400>19

gttgctcacc agcaggcgtt tgcc 24

<210>20

<211>33

<212>DNA

＜213〉artificial sequence

<220>

＜223〉oligonucleotide

<400>20

ctcgagctat tagaattcca gcaggcgttt gcc 33

<210>21

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉oligonucleotide

<400>21

gttgctcacc atggtaagctt gtcgac 27

<210>22

<211>42

<212>DNA

＜213〉artificial sequence

<220>

＜223〉oligonucleotide

<400>22

tggtgccaca atcttctgtt tatgtctcgg cagcgctctt tc 42

<210>23

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉oligonucleotide

<400>23

tttggtcacc agcagttgtt ttgc 24

<210>24

<211>33

<212>DNA

＜213〉artificial sequence

<220>

＜223〉oligonucleotide

<400>24

ctcgagctat tagaattcca gcagttgttt tgc 33

Claims (4)

1. preparation method that is used to produce the transgenic rape chloroplast plant of O type foot and mouth disease polypeptide vaccine may further comprise the steps:

(1) makes up the rape chloroplast associated dna sequence that is used for transforming foreign gene to the rape chloroplast fixed point;

(2) gene order of composite coding O type foot and mouth disease polypeptide vaccine, make this sequence and reporter gene or have the O type foot and mouth disease polypeptide vaccine gene that the gene of strong immunogenic protein is connected and obtained merging, the gene order of described coding O type foot and mouth disease polypeptide vaccine is by shown in SEQ ID NO:3 or the SEQ IDNO:4;

(3) dna sequence dna that step (1) is built and step (2) the synthetic O type foot and mouth disease polypeptide vaccine gene recombination of merging makes the vaccine gene sequence of fusion be positioned at the centre of rape chloroplast associated dna sequence;

(4) dna fragmentation that reorganization in the step (3) is obtained is inserted on the multiple clone site of cloning vector, as O type foot and mouth disease polypeptide vaccine vector for transgenic rape chloroplast site-specific conversion carrier; With

(5) conversion carrier that obtains with step (4) transforms rape, obtains the transgenic plant of chloroplast expression O type foot and mouth disease polypeptide vaccine.

2. according to the process of claim 1 wherein that being used for described in the step (1) has sequence shown in fragment that sequence shown in the SEQ ID NO:1 or its be not less than 1kb and the SEQ ID NO:2 or it is not less than the fragment of 1kb to the dna sequence dna that rape chloroplast fixed point transforms foreign gene.

3. according to the process of claim 1 wherein that the vaccine gene that merges described in the step (3) is positioned at the centre of SEQ ID NO:1 and SEQ IN NO:2.

4. according to the process of claim 1 wherein that the described reporter gene of step (2) is a green fluorescence protein gene, described gene with strong immunogenic protein is selected from O type foot and mouth disease virus VP1 protein gene or hepatitis B core protein gene.

Images