CN1793377A

CN1793377A - Process for structuring carrier of expressing seven exogenous geng at same time in chloroplast

Info

Publication number: CN1793377A
Application number: CN 200510111228
Authority: CN
Inventors: 张大兵; 申慧峰; 梁婉琪; 钱炳俊; 袁政
Original assignee: Shanghai Jiaotong University
Current assignee: Shanghai Jiaotong University
Priority date: 2005-12-08
Filing date: 2005-12-08
Publication date: 2006-06-28

Abstract

The invention relates to a chloroplast simultaneity expression seven exogenous genes vector forming method. It belongs to genetic engineering technique field. It includes the following steps: forming a chloroplast expression vector containing faeC, faeD, faeE, faeF, faeG, faeH, and faeI seven gene orders which form K88ac flagellin gene cluster; extracting coding K88ac wild bacterium C83907 plasmid; using primer 1 whose nucleotide sequence is same with SEQ ID NO: 1 and primer 2 whose same with SEQ ID NO: 2 to process PCR amplification; nucleotide sequence 3018bp is same with SEQ ID NO.5; using primer 3 whose same with SEQ ID NO:3 and primer 4 whose same with SEQ ID NO:4 to process PCR amplification; the nucleotide sequence is same with SEQ ID NO.6; connecting with pMD18-T vector; transforming to escherichia coli DH5 alpha; and gaining escherichia coli clone pTEI with faeCD sequence. The invention overcomes the key defect of polygene technique of plant genetic improvement, and offers a good method of producing effective antibody plant bacterin for baby pig.

Description

In chloroplast(id), express the carrier construction method of 7 foreign genes simultaneously

Technical field

What the present invention relates to is the method in a kind of plant gene engineering technology field, particularly a kind of carrier construction method of expressing 7 foreign genes in chloroplast(id) simultaneously.

Technical background

Utilize genetically engineered to carry out the improvement of economical character and utilize plant to produce some pharmaceutical protein and medicinal component molecule, become the research focus of plant genetic engineering as the anti-device of biology.Up to now, most Study on Genetic Transformation all are that single foreign gene is changed in the recipient plant, but some good character is by controlled by multiple genes, and the metabolic pathway of synthesizing of some molecule also has polygene to participate in simultaneously.Conventional polygenic method for transformation is respectively individual gene to be packed in the expression vector, change over to respectively then and carry out the polygenic transformant of advanced generation cross screening acquisition in the recipient plant, perhaps the transformant that obtains is carried out transgeneic procedure again, perhaps carry out a plurality of carrier cotransformations, but these this methods are loaded down with trivial details, time-consuming, simultaneously because genetic manipulation has repeatedly brought the difficulty of antibiotic-screening subsequently, the method efficiency ratio of a plurality of in addition carrier cotransformations is lower, and along with increasing of carrier number, the frequency of the required polygene transformant that obtains descends significantly, can once carry out the carrier construction method that polygene transforms simultaneously so be badly in need of wanting a kind of at present.

Chloroplast(id) is the organoid that luminous energy is converted into chemical energy unique on the earth, along with people progressively study heredity and the gene expression regulation mechanism of having known chloroplast(id), utilize Chloroplast Genetic Engineering improvement plant trait and the valuable albumen of expression and other metabolic substds more and more to be subjected to scientist's attention.Do not have gene contamination, site-directed integration that high expression level amount, the matrocliny that Chloroplast Genetic Engineering causes except the multiple copied with chloroplast gene group brings have been eliminated the advantage of gene silencing, it also has former nuclear properties, be that some gene is expressed with operon of polycistronic form formation, these characteristics have been established theoretical basis for utilizing Chloroplast Genetic Engineering to express a plurality of genes simultaneously.Newborn piglet diarrhoea (claiming yellow scour of piglet again) is that a kind of morbidity is rapid, and the transmissible disease that M ﹠ M is all very high is the pig farm, particularly the common transmittable disease of intensive pig production field.The sickness rate of piglet is often more than 90%, for piglet survive, grow and weightening finish etc. has a strong impact on, also reduce the price of deed etc. simultaneously, estimate that national annual financial loss reaches 1,000,000,000 yuan.Newborn piglet diarrhoea is caused by toxin source property intestinal bacteria, after the courses of infection piglet, on the intestinal epithelial cells of the effect of mat flagellum attached to piglet, breeding in a large number there, and produce a large amount of toxin, infected piglet is acutely suffered from diarrhoea, and discharges yellow or yellow-white watery stools, and dewaters and death rapidly.Prevention newborn piglet diarrhoea mainly is the sow of taking engineered bacterial strain to come the immunization later pregnancy at present, and challenge provides the passive immunization protection for the sucking piglets enteron aisle.

The flagellar antigen on property intestinal bacteria surface, toxin source and thalline excretory enterotoxin are two important virulence factors, difference according to bacterial strain, this type of enterotoxigenic escherichia coli carries different flagellar antigen types, as K88, K99, P, Type 1, S, 987P, CFA/I etc.ETEC popularity with K88 flagellar antigen type in these bacterial strains is the widest, the K88 flagellum is by a large amount of primary structure protein protomer FaeG and a spot of small subunit (FaeC, FaeD, FaeE, FaeF, FaeG, FaeH, FaeI FaeJ) forms, and these flagellum subunits pass through cytoplasmic membrane and be assembled into flagellum by certain mechanism behind pericentral siphon.

Find by prior art documents, Overexpression of the Bt cry2Aa2 operon inchloroplast leads to formation of insecticidal crystals (in chloroplast(id) behind the overexpression Bt cry2Aa2 operon form pest-resistant dose of crystal) .De Cosa et al (2001) reported first in chloroplast(id), express polygene, they have proved that the chloroplast(id) of tobacco can express three genes of bacillus thuringiensis cry2Aa2 operon, cry2Aa2 itself is the 3rd gene in this operon, preceding two genes encoding accessory proteins, one of them promotes toxin protein to be folded into stable structure as molecular chaperones and forms crystal.The reorganization cry2Aa2 expressing quantity that this method obtains has reached 45%/TSP, and these have paved road for utilizing Chloroplast Genetic Engineering to express a plurality of genes simultaneously, but does not also have at present to find and the document of theme close ties of the present invention and the report of patent.

Summary of the invention

The objective of the invention is to make up the tobacco chloroplast expression vector of seven genes from faeC to faeI in the enterotoxigenic escherichia coli K88ac flagellin gene bunch, the method that transforms by particle gun transforms tobacco, realizes seven expression of foreign gene in transgenic plant.A kind of carrier construction method of expressing 7 foreign genes in chloroplast(id) simultaneously is provided, makes it in plant chloroplast, carry out 7 expression of exogenous gene first, proposed a kind of method for producing the plant vaccine of inducing piglet to produce more efficiently antibody simultaneously.

The present invention is achieved by the following technical solutions, the present invention has made up a kind of chloroplast expression carrier and has contained seven gene orders of faeC, faeD, faeE, faeF, faeG, faeH, faeI of forming K88ac flagellin gene bunch, extracts the wild bacterium C of encoded K 88ac ₈₃₉₀₇Plasmid, with wild bacterium C ₈₃₉₀₇Plasmid be template, carry out pcr amplification with the nucleotide sequence primer 1 identical primer 2 identical with SEQ ID NO:2 with nucleotide sequence with SEQ ID NO:1, obtain the amplified production of full-length gene faeCD, be 3011bp, and nucleotide sequence is identical with SEQ IDNO.5; It is connected with the pMD18-T carrier, transformed into escherichia coli DH5 α, acquisition contains the escherichia coli cloning pTCD of faeCD sequence, carry out pcr amplification with the nucleotide sequence primer 3 identical primer 4 identical with SEQ ID NO:4 with nucleotide sequence with SEQ ID NO:3, obtain the amplified production of full-length gene faeEI, be 4186bp, and nucleotide sequence is identical with SEQ ID NO.6, it is connected with the pMD18-T carrier, transformed into escherichia coli DH5 α, acquisition contains the escherichia coli cloning pTEI of faeCD sequence.

Described exogenous origin gene integrator advances in the chloroplast gene group, is meant:

When (1) making up the chloroplast expression carrier, all respectively connect the dna sequence dna of one section chloroplast(id), be called homologous recombination fragment or location fragment (Targeting fragment) in the both sides of external source expression casette.After carrier is imported into chloroplast(id), by the same clip generation homologous recombination on these two fragments and the chloroplast gene group, just with the specific site of exogenous origin gene integrator to the chloroplast gene group.

(2) require homologous recombination to take place simultaneously after, the insertion of foreign gene causes that neither the original sequence of chloroplast gene loses, and is unlikely again and destroys the function that original gene is located in the insertion point.For satisfying this requirement, existing work has all selected for use two adjacent genes as the homologous recombination fragment, rbcL/accD for example, 16StrnV/rps12rps7, psbA/trnK, rps7/ndhB.After homologous recombination took place, the foreign gene fixed point was inserted in the transcribed spacer of two adjacent genes, has guaranteed that the function of original gene is unaffected.

(3) constructed chloroplast expression carrier is selected rbcL/accD, as the homologous recombination fragment.

Advance in the chloroplast gene group at exogenous origin gene integrator, transcribe the generation that comprises the first-generation and s-generation transgenic plant in the goal gene in the chloroplast(id) of plant;

Described K88ac flagellin is the colibacillary flagellin of toxin source property;

Described K88ac flagellin is integrated with seven genes of faeC faeD, faeE, faeF, faeG, faeH, faeI of K88ac flagellin gene bunch in the genome of chloroplast(id);

Described faeC, faeD, faeE, faeF, faeG, faeH, seven gene orders of faeI, protein expression is in the transgenic plant that obtain.

Described foreign gene, its expression cassette starts expression of exogenous gene with 16S rRNA promotor, 1, big subunit gene 3 ' the end non-translational region (ribulose-1,5-biphosphatecarboxylase/oxygenase large subunit gene 3 ' UTR) of 5-bisphosphate carboxylation/oxydase is as the terminator of exogenous gene expression frame.In order to ensure the expression of foreign gene in tobacco chloroplast, before the initiator codon of gene faeC and faeE, add ribosome bind site (RBS) GGAGG respectively.

Escherichia coli cloning pTCD cuts with SalI and BamH I are two, reclaims the band of 3kb, and pBSK cuts with same enzyme, reclaims carrier, connects to transform back acquisition intermediate carrier pBSKCD; PBSKCD cuts back to close carrier with BamH I and Sac I enzyme, and escherichia coli cloning pTEI cuts back to close the band of 4186bp with same enzyme, connects to transform, and obtains intermediate carrier pBSKCDEI.PBSKCDEI cuts with Sac I and Sal I enzyme, reclaims the band of 7kb, and chloroplast expression carrier pCAB cuts with same enzyme, reclaims carrier, connects to transform, and obtains the chloroplast expression carrier pAB88 of last full-length gene.Chloroplast expression carrier pAB88 contains the nucleotide sequence identical with SEQ ID NO:6 with SEQ ID NO:5.By gene gun conversion method, expression vector pAB88 is imported in the chloroplast(id) of tobacco, by the method for homologous recombination exogenous origin gene integrator is advanced in the chloroplast gene group, and detect expression of exogenous gene by the method for ELISA.

The IIDl of selective light system protein gene (photosystem II Dl protein (psbA) gene) promotor (PpsbA) is as the promotor of resistance screening gene aadA.Hold the terminator of non-translational region with 3 ' of this gene simultaneously as aadA.Aminoglycoside 3 '-adenylic acid (AMP) transferring enzyme (Streptothricinacetyltransferases and aminoglycoside adenyltransferase) gene aadA is as the resistance screening gene, grand enzyme element/streptomycin resistance is provided, screens chloroplast(id) and transform plant.

Owing to contain numerous chloroplast(id) and chloroplast gene group in each cell of higher plant, therefore after transforming through resistance screening to transgenic plant generally be heterogeneous (heteroplasmic), the wild-type chloroplast(id) that promptly transforms chloroplast(id) and do not transformed is present in the transgenic plant simultaneously, and the state that is all transformed through all chloroplast gene groups in screening back is called homogeneity (homoplasmic).

The chloroplast(id) of seven genes that the present invention obtains transforms expression vector simultaneously, described nucleotide sequence is identical with SEQ ID NO.6 with SEQID NO.5, utilizing this carrier that tobacco is carried out particle gun transforms, obtained the chloroplast expression plant of seven genes, and in transgenic plant, detected FaeC, FaeD, FaeE, FaeF, FaeG, FaeH, the proteic expression of FaeI, critical defect to the polygene operative technique that overcomes traditional genetic modification of plants, have very big actual application value, proposed a kind of method for producing the plant vaccine of inducing piglet to produce more efficiently antibody simultaneously.

Description of drawings

The carrier structure synoptic diagram that Fig. 1 K88 gene cluster is expressed in tobacco chloroplast.

The ELISA detected result of the expression of gene in transgene tobacco such as Fig. 2 FaeC.

Specific embodiments

1. experiment material

1.1 bacterial strain and plasmid

Coli strain DH5 α, BL21 (DE3) are preserved by this laboratory; K88 wild strain C ₈₃₉₀₇Available from China Veterinary Drugs Supervisory Inst. (China Institute of Veterinary Drug Control); Coli expression carrier pET-30a (+) is available from Novagen company; The pMD18-T carrier is available from TaKaRa company.

1.2 main biochemical reagents

The Taq archaeal dna polymerase, dNTPs, restriction enzyme, nucleic acid molecular weight standards etc. are all available from TaKaRa company; Primer is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd; Pfu archaeal dna polymerase, IPTG (isopropylthio-), BCIP (5-bromo-4-chloro-3-indoles disodic alkaliine), NBT (chlorination nitroblue tetrazolium(NBT)) etc. are all available from Promega company; Protein molecular weight standard is available from Fermantas GmbH and NEB company.

1.3 tobacco

Tobacco (Nicotiana tabacum cv Kexin No.1) is preserved by this laboratory.

2. experimental technique

2.1C ₈₃₉₀₇The extraction of wild bacteria plasmid

Picking contains single bacterium colony of purpose plasmid from the culture medium flat plate, is inoculated in 3ml not in the LB liquid nutrient medium of added with antibiotic, shaking culture 18h above (37 ℃, 85rpm).In the 1.5ml centrifuge tube, pour 1.5ml bacterium liquid into, it is centrifugal that (4 ℃, 3000rpm 2min), removes supernatant, collects thalline, and centrifuge tube is tipped upside down on the paper handkerchief, dries the residual droplets on the tube wall.The solution I that adds 100 μ l precoolings, concuss, suspension thalline; Add the fresh solution II of 200 μ l, lid is closed, put upside down rapidly 5 times, the mixing mixture is noted not rotating centrifugal pipe; Add 150 μ l solution III, lid is closed, put upside down for several times, solution III is dispersed in the heavy-gravity bacterium lysate, place 30min for-20 ℃.Centrifugal (4 ℃, 13000rpm, 10min), supernatant is transferred in the new centrifuge tube, added 2 times of volume dehydrated alcohols, mixing, place more than the 10min for-20 ℃, centrifugal (4 ℃, 13000rpm, 10min), remove supernatant, add 1ml 70% ethanol, lid is closed, put upside down for several times centrifugal (4 ℃, 13000rpm, 2min).Remove supernatant, centrifuge tube is tipped upside down on the paper handkerchief, room temperature was placed several minutes, treat that the residual ethanol drop on the tube wall volatilizees fully, precipitate with 30 μ l TE (pH8.0 contains 20 μ g/ml DNase-free RNase A) dissolving DNA, 37 ℃ the insulation 30min, DNA be stored in-20 ℃ standby.

2.2PCR amplification

In aseptic PCR pipe, add: 5 μ l, 10 * Pfu PCR damping fluid, 5 μ l 2mM dNTPs, each 1 μ l of 20 μ M upstreams and downstream primer, template DNA, 5 U Pfu archaeal dna polymerases add water to 50 μ l cumulative volumes, add an amount of mineral oil at last to avoid evaporating.Reaction conditions is as follows: 94 ℃, and 5min; 94 ℃ of 30sec, 56 ℃ of 30Sec, 72 ℃ of 2min (annealing temperature and extension time are done corresponding change according to primer and amplified production length difference), 35 circulations; Extend 72 ℃ of 10min eventually.

After reaction finishes, in the PCR system, add 1U Taq archaeal dna polymerase, 72 ℃ of 45min.

2.3DNA segmental recovery

The PCR product cuts the blob of viscose that contains the target DNA band and reclaims through 1% Agrose gel electrophoresis, and method reclaims the test kit explanation with reference to the glue of the clean company of Hangzhou Wei Te.

2.4DNA ligation

In aseptic Eppendorf pipe, add: 1 μ l, 10 * T4 DNA ligase Buffer, the PCR product that 8 μ l reclaim, 0.25 μ l pMD18-T carrier, 1 μ l T4 dna ligase, cumulative volume is 10 μ l.With each component mixing, connect 16h in 4 ℃.When the complementary cohesive end of cutting formation by enzyme when PCR product and carrier DNA fragment linked to each other, mass ratio between the two was 5: 1.

2.5 preparation competent escherichia coli cell

Streak inoculation bacillus coli DH 5 alpha on the LB flat board, 37 ℃ of overnight incubation.With transfering loop picking 10-12 single bacterium colony (2-3mm diameter), be inoculated in the SOB nutrient solution of 250mL.Shaking culture (18 ℃, 200-250rpm), to OD600=0.6.Bacterium liquid places 10min on ice.Centrifugal (4 ℃, 3000rpm, 10min), collecting cell.With the TB solution re-suspended cell of 80ml precooling, ice bath 10min.Centrifugal (4 ℃, 3000rpm, 10min), collecting cell.With the TB of 20ml precooling re-suspended cell lightly, add DMSO to final concentration 7%, mixing places on ice gently.Behind the 10min, press every pipe 500 μ l packing cell suspensions in aseptic eppendorf pipe.Use the liquid nitrogen quick freezing, be stored in-70 ℃.

2.6DNA connect the product transformed into escherichia coli

The competent cell that adds 200 μ l in 1.5ml eppendorf pipe is connected product with the DNA of 10 μ l, light finger bomb tube wall, mixing mixture.Ice bath 30min.42 ℃, incubation mixture 90sec.Put back on ice ice bath 10min rapidly.Add 800 μ l SOC nutrient solutions, 37 ℃, thermal agitation mixed solution 1h.Mixed solution is coated on the selective medium 37 ℃ of overnight incubation.

2.7DNA sequential analysis

Adopt ABI377 type sequenator (available from American AB I company) to measure dna sequence dna,, finish by Shanghai Bo Ya biotech firm with PCGENE software analysis sequence.

2.8 prepare plasmid DNA in a small amount

Picking contains single bacterium colony of purpose plasmid from the culture medium flat plate, is inoculated in 3ml and contains in the corresponding antibiotic LB liquid nutrient medium, shaking culture spend the night (37 ℃, 200rpm).In the 1.5ml centrifuge tube, pour 1.5ml bacterium liquid into, it is centrifugal that (4 ℃, 3000rpm 1min), removes supernatant, collects thalline, and centrifuge tube is tipped upside down on the paper handkerchief, dries the residual droplets on the tube wall.The solution I that adds 100 μ l precoolings, concuss, suspension thalline; Add the fresh solution II of 200 μ l, lid is closed, put upside down rapidly 5 times, the mixing mixture is noted not rotating centrifugal pipe; Add 150 μ l solution III, lid is closed, put upside down for several times, solution III is dispersed in the heavy-gravity bacterium lysate, place 30min for-20 ℃.Centrifugal (4 ℃, 13000rpm, 10min), supernatant is transferred in the new centrifuge tube, added 2 times of volume dehydrated alcohols, mixing, place more than the 10min for-20 ℃, centrifugal (4 ℃, 13000rpm, 10min), remove supernatant, add 1ml 70% ethanol, lid is closed, put upside down for several times centrifugal (4 ℃, 13000rpm, 2min).Remove supernatant, centrifuge tube is tipped upside down on the paper handkerchief, room temperature was placed several minutes, treat that the residual ethanol drop on the tube wall volatilizees fully, precipitate with 30 μ l TE (pH8.0 contains 20 μ g/ml DNase-free RNase A) dissolving DNA, 37 ℃ the insulation 30min, DNA be stored in-20 ℃ standby.

2.9 digestion with restriction enzyme DNA

Endonuclease reaction carries out with reference to the concrete operations in restriction enzyme enzyme reagent kit (available from the TAKARA company) specification sheets.Reaction finishes, and separates enzyme by agarose gel electrophoresis and cuts product, and reclaimer operation reclaims identical with the PCR product.

2.10 tobacco chloroplast transforms---particle bombardment

By the conversion of particle bombardment implementation chloroplast(id), method is with reference to (Svab and Maliga (1993) Proc.Natl.Acad.Sci.USA 90:913-917).

With the diameter that is enclosed with the pAB88 plasmid DNA is the bronze of 1.0um, adopt particle gun Bio-Rad PDS1000/He to bombard and be placed on ROMP substratum (MS salt, add the N.F,USP MANNITOL of 0.2M/L sorbyl alcohol and 0.2M/L, the sucrose of 30g/L, 0.7% agar, PH5.8) wild-type tobacco blade, bombardment pressure: 1,100psi; Blade after target distance: the 9cm. bombardment moves to (MS salt on the MS substratum, the sucrose of 30g/L, 0.7% agar, PH5.8) light was cultivated after 4 days, blade is cut into the square fritter of 5mm is placed into and selects substratum (MS salt, 1.5mg/L 6BA, 0.15mg/L IAA, the sucrose of 500mg/L spectinomycin 30g/L, 0.7% agar, PH5.8) carry out differentiation culture on, division culture medium of per 2 Zhou Genhuan; When waiting to grow green seedling, transplant that (0.7% agar carries out root culture on PH5.8) for MS salt, the sucrose of 500mg/L spectinomycin 30g/L to root media.

2.11 the ELISA of foreign protein detects

Get the blade of 100mg transgene tobacco, add liquid nitrogen and grind, add an amount of albumen extracting buffer (15mM Na ₂CO ₃, 35mM NaHCO ₃, pH9.6), behind 4 ℃ of placement 2h, 12,000rpm, centrifugal 10min gets supernatant, is the total soluble protein of tobacco.

The FaeC of the purifying of expressing with e. coli bl21 (DE3), FaeD, FaeE, FaeF, FaeH, FaeI albumen is after the PBS dilution, add 50 μ l in 96 hole enzyme plates, as positive control, simultaneously with the total soluble protein of non-transgenic tobacco as negative control, it is identical that total protein concentration keeps, and 25 ℃ of bags are spent the night.With aseptic water washing three times, add 300 μ l sealing damping fluid (0.05%Tween-20,0.05%NaN ₃, 1mM EDTA, 0.25%BSA, 0.17M H ₃BO ₄, 0.12M NaCl, pH8.5), 25 ℃ of 30min with redistilled water flushing three times, add the mice serum of 50 μ l with sealing damping fluid dilution (1: 300) again, hatch 2h for 4 ℃.After redistilled water flushing three times, add sealing damping fluid sealing 10min, again with redistilled water flushing three times, add 50 μ l with the second antibody of sealing damping fluid dilution (sheep anti mouse, 1: 5000.Promega), room temperature 2h.After the redistilled water flushing three times, the NPP solution that adds 75 μ l [takes by weighing 5mg NPP, is dissolved in 50 μ l ddH ₂Among the O, get 10 μ l NPP damping fluid (0.1MGlycine, 1mM MgCl ₂, 1mM ZnCl ₂, pH10.4) be diluted to 1ml].Behind the color development at room temperature 1h, add 25 μ l 0.5N NaOH termination reactions.Measure the photoabsorption of each hole solution at the 405nm wavelength.

Set forth the present invention according to above-mentioned experiment condition and concrete technology further combined with concrete enforcement.These are implemented only to be used to the present invention is described and are not used in and limit the scope of the invention.

As shown in Figure 1, 2, the ELISA detected result of the expression of gene in transgene tobacco such as carrier structure that the K88 gene cluster is expressed in tobacco chloroplast among the embodiment 1-6 and FaeC.

Embodiment 1---the proteic expression of FaeC in the transgenic plant

1. solution, reagent

(1) textured vegetable protein's extracting buffer

15mM Na ₂CO ₃, 35mM NaHCO ₃, regulate pH to 9.6 at last;

(2) sealing buffer

0.05%Tween-20,0.05%NaN ₃, 1mM EDTA, 0.25%BSA, 0.17M H ₃BO ₄, 0.12MNaCl regulates pH to 8.5 with NaOH;

(3)NPP?buffer

0.1M Glycine, 1mM MgCl ₂, 1mM ZnCl ₂, regulate pH to 10.4 with NaOH.

2. operation steps

(1) get the blade of 100mg transgene tobacco and non-transgenic tobacco, add liquid nitrogen respectively and grind rapidly, add an amount of albumen extracting buffer afterwards, 4 ℃ place 2h after, 12,000rpm, centrifugal 10min gets supernatant, is the total soluble protein of tobacco.

(2) according to the protein concentration in protein concentration standard curve determination transgene tobacco and the non-transgenic tobacco total protein, respectively getting 50ug adds in the 96 hole enzyme plates, the FaeC albumen of escherichia coli expression that adds equivalent simultaneously is as positive control, and PBS solution is as negative control, and 4 ℃ of bags are spent the night.

(3) with aseptic water washing three times, add 300 μ l sealing buffer, 25 ℃ of 30min with redistilled water flushing three times, add 50 μ l again with the mice serum of sealing buffer by dilution in 1: 300, hatch 2h for 4 ℃.

(4) with after the redistilled water flushing three times, add sealing buffer sealing 10min, again with redistilled water flushing three times, add 50 μ l with the second antibody of sealing buffer dilution (sheep anti mouse, 1: 5000.Promega), room temperature 2h.

(5) after redistilled water washed three times, the NPP solution that adds 75 μ l (took by weighing 5mg NPP, is dissolved in 50 μ lddH ₂Among the O, get 10 μ l and be diluted to 1ml) with NPP buffer.Behind the color development at room temperature 1h, add 25 μ l 0.5N NaOH termination reactions.Measure the photoabsorption of each hole solution at the 405nm wavelength.

The result shows that foreign protein FaeC has expressed in transgene tobacco, as Fig. 2 (1).

Embodiment 2---the proteic expression of FaeD in the transgenic plant

1. solution, reagent

(1) textured vegetable protein's extracting buffer

15mM Na ₂CO ₃, 35mM NaHCO ₃, regulate pH to 9.6 at last;

(2) sealing buffer

(3)NPP?buffer

0.1M Glycine, 1mM MgCl ₂, 1mM ZnCl ₂, regulate pH to 10.4 with NaOH.

2. operation steps

(2) according to the protein concentration in protein concentration standard curve determination transgene tobacco and the non-transgenic tobacco total protein, respectively getting 50ug adds in the 96 hole enzyme plates, the FaeD albumen of escherichia coli expression that adds equivalent simultaneously is as positive control, and PBS solution is as negative control, and 4 ℃ of bags are spent the night.

(5) after redistilled water washed three times, the NPP solution that adds 75 μ l (took by weighing 5mg NPP, is dissolved in 50 μ lddH ₂Among the O, get 10 μ l and be diluted to 1ml) with NPP buffer.Behind the color development at room temperature 1h, add 25 μ l0.5N NaOH termination reactions.Measure the photoabsorption of each hole solution at the 405nm wavelength.

The result shows that foreign protein FaeD has expressed in transgene tobacco, as Fig. 2 (2).

Embodiment 3---the proteic expression of FaeE in the transgenic plant

1. solution, reagent

(1) textured vegetable protein's extracting buffer

15mM Na ₂CO ₃, 35mM NaHCO ₃, regulate pH to 9.6 at last;

(2) sealing buffer

0.05%Tween-20,0.05% NaN ₃, 1mM EDTA, 0.25% BSA, 0.17M H ₃BO ₄, 0.12MNaCl regulates pH to 8.5 with NaOH;

(3)NPP?buffer

0.1M Glycine, 1mM MgCl ₂, 1mM ZnCl ₂, regulate pH to 10.4 with NaOH.

2. operation steps

(2) according to the protein concentration in protein concentration standard curve determination transgene tobacco and the non-transgenic tobacco total protein, respectively getting 50ug adds in the 96 hole enzyme plates, the FaeE albumen of escherichia coli expression that adds equivalent simultaneously is as positive control, and PBS solution is as negative control, and 4 ℃ of bags are spent the night.

(3) with aseptic water washing three times, add 300 μ, 1 sealing buffer, 25 ℃ of 30min with redistilled water flushing three times, add 50 μ l again with the mice serum of sealing buffer by dilution in 1: 300, hatch 2h for 4 ℃.

(5) after redistilled water washes three times, add the NPP solution (take by weighing 5mg NPP, be dissolved among the 50 μ lddH2O, get 10 μ l and be diluted to 1ml) of 75 μ l with NPP buffer.Behind the color development at room temperature 1h, add 25 μ l 0.5N NaOH termination reactions.Measure the photoabsorption of each hole solution at the 405nm wavelength.

The result shows that foreign protein FaeE has expressed in transgene tobacco, as Fig. 2 (3).

Embodiment 4---the proteic expression of FaeF in the transgenic plant

1. solution, reagent

(1) textured vegetable protein's extracting buffer

15mM Na ₂CO ₃, 35mM NaHCO ₃, regulate pH to 9.6 at last;

(2) sealing buffer

(3)NPP?buffer

0.1M Glycine, 1mM MgCl ₂, 1mM ZnCl ₂, regulate pH to 10.4 with NaOH.

2. operation steps

(2) according to the protein concentration in protein concentration standard curve determination transgene tobacco and the non-transgenic tobacco total protein, respectively getting 50ug adds in the 96 hole enzyme plates, the FaeF albumen of escherichia coli expression that adds equivalent simultaneously is as positive control, and PBS solution is as negative control, and 4 ℃ of bags are spent the night.

The result shows that foreign protein FaeF has expressed in transgene tobacco, as Fig. 2 (4).

Embodiment 5---the proteic expression of FaeG in the transgenic plant

1. solution, reagent

(1) textured vegetable protein's extracting buffer

15mM Na ₂CO ₃, 35mM NaHCO ₃, regulate pH to 9.6 at last;

(2) sealing buffer

0.05% Tween-20,0.05% NaN ₃, 1mM EDTA, 0.25% BSA, 0.17M H ₃BO ₄, 0.12MNaCl regulates pH to 8.5 with NaOH;

(3)NPP?buffer

0.1M Glycine, 1mM MgCl ₂, 1mM ZnCl ₂, regulate pH to 10.4 with NaOH.

2. operation steps

(2) according to the protein concentration in protein concentration standard curve determination transgene tobacco and the non-transgenic tobacco total protein, respectively getting 50ug adds in the 96 hole enzyme plates, the FaeG albumen of escherichia coli expression that adds equivalent simultaneously is as positive control, and PBS solution is as negative control, and 4 ℃ of bags are spent the night.

The result shows that foreign protein FaeG has expressed (result is unlisted).

Embodiment 6---the proteic expression of FaeH in the transgenic plant

1. solution, reagent

(1) textured vegetable protein's extracting buffer

15mM Na ₂CO ₃, 35mM NaHCO ₃, regulate pH to 9.6 at last;

(2) sealing buffer

(3)NPP?buffer

0.1M Glycine, 1mM MgCl ₂, 1mM ZnCl ₂, regulate pH to 10.4 with NaOH.

2. operation steps

(2) according to the protein concentration in protein concentration standard curve determination transgene tobacco and the non-transgenic tobacco total protein, respectively getting 50ug adds in the 96 hole enzyme plates, the FaeH albumen of escherichia coli expression that adds equivalent simultaneously is as positive control, and PBS solution is as negative control, and 4 ℃ of bags are spent the night.

The result shows that foreign protein FaeH has expressed (result is unlisted).

Embodiment 7---the proteic expression of FaeI in the transgenic plant

1. solution, reagent

(1) textured vegetable protein's extracting buffer

15mM Na ₂CO ₃, 35mM NaHCO ₃, regulate pH to 9.6 at last;

(2) sealing buffer

(3)NPP?buffer

0.1M Glycine, 1mM MgCl ₂, 1mM ZnCl ₂, regulate pH to 10.4 with NaOH.

2. operation steps

(2) according to the protein concentration in protein concentration standard curve determination transgene tobacco and the non-transgenic tobacco total protein, respectively getting 50ug adds in the 96 hole enzyme plates, the FaeI albumen of escherichia coli expression that adds equivalent simultaneously is as positive control, and PBS solution is as negative control, and 4 ℃ of bags are spent the night.

The result shows that foreign protein FaeI has expressed (result is unlisted).

Sequence that the present invention relates to and mark apportion are as follows:

(1) information of SEQ ID NO.1

(i) sequence signature:

(A) length: 33bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: oligonucleotide

(iii) sequence description: SEQ ID NO.1

aaaaaagcttatgaaaaaagcattcttattagc

(2) information of SEQ ID NO.2

(i) sequence signature:

(A) length: 42bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: oligonucleotide

(iii) sequence description: SEQ ID NO.2

aaaaaggatccttattactcacacgtaatctcctgtagtttc

(3) information of SEQ ID NO.3

(i) sequence signature:

(A) length: 27bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: oligonucleotide

(iii) sequence description: SEQ ID NO.3

ggatccagttgtagggagggatttatg

(4) information of SEQ ID NO.4

(i) sequence signature:

(A) length: 32bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: oligonucleotide

(iii) sequence description: SEQ ID NO.4

gagctcttattactggtactcaatacttaccg

(5) information of SEQ ID NO.5-6

＜110〉Shanghai Communications University

＜120〉a kind of carrier construction method of in chloroplast(id), expressing 7 foreign genes simultaneously

<160>6

<170>PatentIn?version?3.3

<210>5

<211>3011

<212>DNA

<213>Escherichia?coli

<400>5

aagcttatga?aaaaagcatt?cttattagca?tgtgtttttt?ttctcactgg?gggcggggtt 60

tctcacgctg?cggttcagaa?aaccatattc?agtgctgacg?tggtggcctc?ggtctgtcat 120

gtggtggtgg?atgcggacag?caccggcaac?agtggccggc?tgacgttcgg?gacttaccgt 180

aagtccacgg?gggcatctgt?accgccgcgt?gacttcacgg?tgcgtctgta?tgagtccggc 240

gccacggttc?agggttgctc?tgcgtttctt?gccgggcagg?tcgccaccct?ggattttggt 300

aacccgggac?aactggacgc?tgccggcgtg?gtcacccgcg?gtgccggtga?tggtattcgc 360

gtggatgtac?gggctgttga?tgcacaggct?gattatcgcg?gacgtctgac?gcaggataac 420

cattccgtga?aatatccggt?ggattttgcc?gctaagggcc?agtttcgttt?tcgtgcgcag 480

ccggtgtttc?cggctgatgt?gaaggcggga?gagtattccg?gggcgctgac?ttttgttgtc 540

acttatcagt?agtagggatg?ccaatgaaaa?aatatgtgac?aacaaaatca?gtgcagccag 600

tggcgtttcg?tctgacaacc?ctgagtctgg?ttatgtcggc?ggtactgggc?agcgcatcgg 660

ttattgccgg?tgaaaaactg?gatatgtcct?ttatccaggg?ggggggcggg?gttaatccgg 720

aagtctgggc?agccctgaac?ggcagctatg?cgccggggcg?ttatctggtt?gacctgtccc 780

tgaacgggaa?ggaggccggg?aaacagatac?tggatgtgac?accacaggac?agtaatgaac 840

tgtgtctgac?agaggcatgg?ctgacgaagg?ctggggttta?cgtcagtgca?gattactttc 900

gtgagggata?tgacgccaca?cgacagtgct?atgtgctgac?aaaagccccg?tcagtgaagg 960

tggattttga?tgtttccacc?cagagtctgg?cgctgtccat?tccccagaag?gggctggtga 1020

agatgccgga?gaatgtggac?tgggattacg?ggaccagtgc?atttcgcgtg?aactataacg 1080

cgaacgccaa?caccggccgt?aataacacct?cggcctttgg?ctcagcggac?ctgaaagcca 1140

atatcgggca?ctgggtggtg?agttcttctg?ccacggccag?cggcggtgac?agcggggata 1200

actccaccac?gataaatatg?tttacggcca?cccgggccat?ccgcgcactg?agtgcggacc 1260

tggcggtcgg?gaaaacatcc?accggggaca?gtctgctggg?cagtacggga?acgtacggcg 1320

tgtcgctgag?ccggaacaac?agcatgaagc?cgggcaatct?ggggtatacc?ccggtgttca 1380

gcggcattgc?gaacgggccg?tcgagggtga?cactgacaca?gaacgggcgg?ttgctgcatt 1440

cggagatggt?gccggcgggt?ccgttctcca?tcacggatgt?gccgctgtac?accagtggtg 1500

atgtgaccat?gaaaatcacc?ggtgaagacg?ggcgcgacga?ggtacagaac?ttcccgttgt 1560

cggtgatggc?cgggcagtta?agtccggggc?agcacgagtt?cagtgtggca?gccggtttgc 1620

ctgacgatga?cagtgacctg?aaaggcggtg?tgtttgcggc?gtcatacggt?tacggtctgg 1680

acggactgac?gctgcgagcc?ggtggggtgt?tcaaccagga?ctggcagggg?gccagtgccg 1740

gtgtggttgc?cgggctgggt?tacctggggg?cggtatctgc?tgacggggct?tatgccacgg 1800

cgaaataccg?tgacggcagc?cacagcggga?ataaggtgca?gctgtcctgg?agtaaacaac 1860

tggagacgac?gaacaccggg?ctgcgggtaa?gctggtcacg?gcagagtgag?gaatatgagg 1920

gcatgtcctc?ctttgacccg?acagagctgt?ggtcgcagtc?aaatcatggg?cgccggacga 1980

aggatgaatg?gaatgccggt?atcagtcagc?cggtgggcgg?gttgttcagt?ctgtcggtgt 2040

ccggctggca?gcggagttat?taccctgcat?ccatgaccgg?aagttaccgg?tacagcgatg 2100

acaacggaaa?agaaaccggt?attaccggca?gtctgagtac?ccagataaag?ggtgtcagtc 2160

tgaacctggg?ctggtccggc?tcccggaact?cccgggggga?gaataactgg?tcggcgtctg 2220

cttcggtgtc?ggtaccgttc?acactgtttg?accgtcgcta?cagcagcagt?gcgtcggtga 2280

gtaccagcaa?aggcggtggc?acaggcttca?gcaccggtgt?atccggctca?ctgaatgacc 2340

gtttcagcta?tggtctgggc?ggtggtcgtg?acggtgatgg?tggtaccagc?agttacctga 2400

acgcctcata?cagtggtgac?cgggcttatc?tgaatggtgt?cctgaaccac?tcgcagtccg 2460

gcggaaccag?tggttctgtc?tcggtcagcg?gttcggtact?ggcagttccg?gcggcgaaag 2520

acatcatgtt?cagccgcacg?accggcgaca?cggtggcggt?ggtgaatgtg?aaggacacgc 2580

cgggagtgaa?ggtgacgtcc?ggtgacggac?agactgacag?cgacggcaac?ctggtggtac 2640

cgctgaacag?ctatgactgg?aacacggtga?cgattgatac?gggcacactc?ccgctgagca 2700

ccgaactgac?gaacaccagt?cagaaggtgg?taccgacgga?caaggcggtg?gtctggatgc 2760

cgtttgatgc?cctgaaagtt?aagcgttacc?tgctgcaggt?gaagcagcgt?gacggtgagt 2820

ttgtgccggg?gggaacctgg?gcacgtgaca?gtaagaacac?accgctgggc?tttgtagcta 2880

acaatggtgt?gctgatgatt?aacacggtgg?atgcgccggg?tgatatcacc?ctgggccagt 2940

gccggatacc?tgcggccaga?ctgcaggata?ctgagaaact?acaggagatt?acgtgtgagt 3000

aataaggatc?c 3011

<210>6

<211>4186

<212>DNA

<213>Escherichia?coli

<400>6

ggatccagtt?gtagggaggg?atttatgagt?aagcgtaacg?cagtaacgac?gtttttcact 60

aaccgggtga?caaaagcact?gggaatgact?ctggcgctga?tgatgacctg?tcagagtgcg 120

atggcttccc?tggcagtaga?ccagacccgc?tatatctttc?gcggggacaa?ggatgcactg 180

accatcacag?tcaccaacaa?tgataaagag?cgtacctttg?gtggtcaggc?ctgggtggac 240

aatatcgtgg?agaaggacac?ccgtccgacc?tttgtggtga?caccatcctt?cttcaaggtg 300

aagccgaatg?gtcagcagac?actgcgtatc?atcatggcct?cggaccatct?gccgaaggat 360

aaagagtcgg?tgtactggct?gaacctgcag?gatattccgc?cggctctgga?gggcagcggt 420

attgcagtgg?cgctgcgcac?gaagctgaaa?ctgttctacc?gcccgaaggc?actgcttgaa 480

ggccgcaagg?gggcagaaga?aggcatcagc?ctgcagagcc?gcccggatgg?caggaccatg 540

ctggtgaaca?ccacgccgta?catttttgcg?attggcagtc?tgctggacgg?aaacggaaag 600

aaaattgcca?cggataacgg?gacgacgcag?aaactgctga?tgttcatgcc?gggggatgaa 660

gtgcaggtga?agggaaatgt?ggtgaaagtg?gactccctga?acgattacgg?tgaactgcag 720

acctggacga?ttaacaagaa?gaaaccggca?gcaccggaag?ccgcaaaagc?tgagaaagca 780

gataccgcag?agcagaaata?accgccctcc?ggaatacgga?acagaggggt?aataaatgaa 840

gaaaacaatg?atggcagccg?ccctggttct?gagtgcgctc?agtattcagt?cagcactggc 900

cgctgaatac?agtgagaaaa?cgcagtacct?gggtgtggtg?aacggtcagg?tggtgggtaa 960

cagtgtggtg?aaggtgaccc?gtacaccgac?agacccggtg?ctgtaccgct?ccggcagtaa 1020

cagcccgtta?cctgcagaac?tgataatccg?gcatgcagaa?agccgcccgg?cttccggcgg 1080

cctggcaaac?atcacggtga?aagaggcgct?gccggataac?ggggaagccc?gcatcactct 1140

gaagacgtcc?ctgatggttg?acggaaagag?agtggcactc?agtgccaggc?agcagggtga 1200

ggatgtggtg?attaccgtgc?ctgaggcaca?gcagcagatt?gagttaagaa?cagatgcacc 1260

ggcagagctg?gaggtgccgg?tcagctaccg?gggaaacctg?cagatagcgc?tgcaggtgga 1320

ggactgagga?ttaatctcct?tagtgatgca?aaacatccgt?gactccggaa?cgggtcatat 1380

tggtaaaggg?acttgccgtt?ttttttaaac?gggaataacg?caaagctgtt?ctgggttaaa 1440

cacagtgttt?aatgaaatgc?ggttatttaa?acggagccgc?agggatagtt?ttacggtaat 1500

tccggaaaaa?taagggttac?cgatttcagt?ttattatttg?tggaatatca?aggggtttat 1560

tttatgaaaa?agactctgat?tgcactggca?attgctgcat?ctgctgcatc?tggtatggca 1620

catgcctgga?tgactggtga?tttcaatggt?tcggtcgata?tcggtggtag?tatcactgca 1680

gatgattatc?gtcagaaatg?ggaatggaaa?gttggtacag?gtcttaatgg?atttggtaat 1740

gtattgaatg?acctgaccaa?tggtggaacc?aaactgacca?ttactgttac?tggtaataag 1800

ccaattttgt?taggccgaac?caaagaagca?tttgctacgc?cagtaactgg?tggtgtagat 1860

ggaattcctc?atattgcatt?tactgactat?gaaggagctt?ctgtagtact?cagaaaccct 1920

gatggtgaaa?ctaataaaaa?aggtttagca?tattttgttc?tgccgatgaa?aaatgcagag 1980

ggcactaaag?ttggttcagt?gaaagtgaat?gcatcttatg?ccggtgtgtt?agggagaggt 2040

ggggttacta?gtgcggacgg?ggagctgctt?tcgctttttg?ccgacgggtt?gagcagtatc 2100

ttttatggtg?gtttgccgag?gggttctgaa?ctctcggctg?ggagtgccgc?agcggagcgc 2160

acaaagttgt?ttggaagtct?atcaagaaat?gatattctcg?gacagattca?aagagtaaac 2220

gcaaatatta?cttctcttgt?tgacgtcgca?ggttcttaca?gggaaaacat?ggagtacact 2280

gatggaactg?ttgtttctgc?tgcctatgca?ctgggtattg?caaacggtca?gactattgag 2340

gcaactttta?atcaggctgt?aactaccagc?actcagtgga?gcgctccgct?gaacgtagca 2400

attacttatt?actaagttgt?cgtgatgagc?tgccaattta?ttattgatac?gttctgataa 2460

cagaccagca?tcttggtgtg?gacgctcttt?ttattgtgag?gtttatactg?atgctggtta 2520

ctttaaattt?aataatagcg?atttgttttt?atttgtattg?tcctgataaa?acagagagaa 2580

taaagatgaa?aataacgcat?cattataaat?cccttctttc?agccattatt?tcggtggccc 2640

ttttttattc?ggcagcgcca?catgcagata?ttcttgatgg?tggcgaaatt?cagtttaatg 2700

gctttgtcac?tgatgatgcc?cccaaatgga?cctggcagat?tagttcaccg?gaccagactt 2760

gggctgtgga?tactgccgat?gcacgtacag?agaacgggca?actggttttt?gatttgagtg 2820

acaaagggcc?tctgcctttt?cttgaggggt?atttgtatga?agtggccgag?cgtggcggtc 2880

ccggattcac?gccctttatt?actttcagca?gtaacggacg?gcctttcgcc?gtaaaggaag 2940

gcagtgacac?ttcagtgcaa?cgttttcgcg?cctctgtccc?ggtgcgtgac?ccggagacgg 3000

ggaacgtgtc?gggacagctt?tctttcaccc?tgaatcaggg?gatggcggtc?agtacaggta 3060

aacaggaaga?gggcgcctcc?acgccttctg?gtatgtcact?ggtcagtgga?caaagtgtga 3120

cagatgttca?gtcaggcagt?cttccgcagg?ggctgaagaa?ccgtctgtct?gccttattgc 3180

tgatgaataa?ggggttcggt?aatggcatga?gtgcggtgga?taacggacag?gttatcactc 3240

agggggtact?ggctgacggt?cgtgtgatga?atctggctgc?ggcatatgcc?tctgcggtgt 3300

cggattttga?actgcggttg?ccggcggaag?gcacaccggc?ccgctggcag?gcagggctga 3360

atgtgacagt?cacggtacag?tgatggtcgc?agggatataa?ggagaaatag?aaatgaagaa 3420

ggtgacgttg?tttctgtttg?ttgtcagcct?cctgccctcc?actgtactgg?cctggaacac 3480

gccgggagaa?gacttcagcg?gagagcttaa?gctggaaggg?gcggtgacca?gcacccgtaa 3540

tccgtgggtg?tggaaagtcg?gacagggaaa?tgaaagtctg?gaggttaagc?agagccgtgg 3600

tgttcgtgac?ggtgagcagg?gaattccggt?tgcactgccg?gcgttgaccg?ttttactggg 3660

aaaaaccacc?ctgaccacac?cggcaggacg?tgaggggctt?tcccccgggg?tcagttacgg 3720

aaagggggct?gagggttttt?cacttgaatg?gacagcgccc?ggcatggcga?aagtgacgct 3780

gcctgtgacc?ggcgataaaa?atgttcgtgc?ggggacattc?accttcagga?tgcaggcggc 3840

cggggtgttg?cgtcatatgc?aggacggaca?accggtgtat?accggcgtat?atgacgacct 3900

gaatgcgaat?gggctgccgg?gtgaaagcac?agccatgaag?acttctgata?ttccggggac 3960

tctgcagacg?atgttcagtg?gtgaaggtcc?gtcctggctg?cagacaatga?cagtcagtgg 4020

ttattcggga?gtgagtcatt?tcagtgatgc?ctccctgcgt?caggttgaag?gtgtgtacgg 4080

cgcacagatt?gtggcaggcg?gtggtgaatt?acatctgaac?ggcgcgatgc?cggaacgctg 4140

gcgggt?gtca?ctgccggtaa?gtattgagta?ccagtaataa?gagctc 4186

Claims

1, a kind of carrier construction method of in chloroplast(id), expressing 7 foreign genes simultaneously, it is characterized in that, make up a kind of chloroplast expression carrier and contained seven gene orders of faeC, faeD, faeE, faeF, faeG, faeH, faeI of forming K88ac flagellin gene bunch, extracted the wild bacterium C of encoded K 88ac ₈₃₉₀₇Plasmid, with wild bacterium C ₈₃₉₀₇Plasmid be template, carry out pcr amplification with the nucleotide sequence primer 1 identical primer 2 identical with SEQ ID NO:2 with nucleotide sequence with SEQ ID NO:1, obtain the amplified production of full-length gene faeCD, be 3011bp, and nucleotides sequence is identical with SEQ ID NO.5; It is connected with the pMD18-T carrier, transformed into escherichia coli DH5 α, acquisition contains the escherichia coli cloning pTCD of faeCD sequence, carry out pcr amplification with the nucleotide sequence primer 3 identical primer 4 identical with SEQ ID NO:4 with nucleotide sequence with SEQ IDNO:3, obtain the amplified production of full-length gene faeEI, be 4186bp, and nucleotide sequence is identical with SEQ ID NO.6, it is connected with the pMD18-T carrier, transformed into escherichia coli DH5 α, acquisition contains the escherichia coli cloning pTEI of faeCD sequence.

2, carrier construction method of expressing 7 foreign genes in chloroplast(id) simultaneously according to claim 1 is characterized in that, described exogenous origin gene integrator advances in the chloroplast gene group, is meant:

When (1) making up the chloroplast expression carrier, the dna sequence dna that respectively connects one section chloroplast(id) in the both sides of external source expression casette, after carrier is imported into chloroplast(id), by the same clip generation homologous recombination on these two fragments and the chloroplast gene group, with the specific site of exogenous origin gene integrator to the chloroplast gene group;

(2) require simultaneously all to have selected for use two adjacent genes as the homologous recombination fragment after the homologous recombination generation, after homologous recombination took place, the foreign gene fixed point was inserted in the transcribed spacer of two adjacent genes;

3, according to claim 1 or 2 described carrier construction methods of in chloroplast(id), expressing 7 foreign genes simultaneously, it is characterized in that, advance in the chloroplast gene group at exogenous origin gene integrator, transcribe the generation that comprises the first-generation and s-generation transgenic plant in the goal gene in the chloroplast(id) of plant.

4, carrier construction method of expressing 7 foreign genes in chloroplast(id) simultaneously according to claim 1 is characterized in that, described K88ac flagellin is the colibacillary flagellin of toxin source property.

5, according to claim 1 or 4 described carrier construction methods of in chloroplast(id), expressing 7 foreign genes simultaneously, it is characterized in that, described K88ac flagellin is integrated with seven genes of faeC, faeD, faeE, faeF, faeG, faeH, faeI of K88ac flagellin gene bunch in the genome of chloroplast(id).

6, carrier construction method of in chloroplast(id), expressing 7 foreign genes simultaneously according to claim 1, it is characterized in that, described foreign gene, its expression cassette starts expression of exogenous gene with 16S rRNA promotor, 1, big subunit gene 3 ' the end non-translational region (ribulose-1,5-biphosphatecarboxylase/oxygenase large subunit gene 3 ' UTR) of 5-bisphosphate carboxylation/oxydase is as the terminator of exogenous gene expression frame.

7, according to claim 1 or 2 or 3 described carrier construction methods of in chloroplast(id), expressing 7 foreign genes simultaneously, it is characterized in that, described foreign gene, in the expression of foreign gene in tobacco chloroplast, before the initiator codon of gene faeC and faeE, add ribosome bind site (RBS) GGAGG respectively.