CN103173485A - Method for cultivating starch-content-increased transgenic plant through multi-gene transformation - Google Patents
Method for cultivating starch-content-increased transgenic plant through multi-gene transformation Download PDFInfo
- Publication number
- CN103173485A CN103173485A CN2013100693458A CN201310069345A CN103173485A CN 103173485 A CN103173485 A CN 103173485A CN 2013100693458 A CN2013100693458 A CN 2013100693458A CN 201310069345 A CN201310069345 A CN 201310069345A CN 103173485 A CN103173485 A CN 103173485A
- Authority
- CN
- China
- Prior art keywords
- gene
- final concentration
- plant
- sequence
- substratum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a method for cultivating a starch-content-increased transgenic plant through multi-gene transformation. According to the transgenic plant cultivation method provided by the invention, a selection marker gene, an adenosine diphosphate glucose pyrophosphorylase small subunit gene, an adenosine diphosphate glucose pyrophosphorylase large subunit gene, a sucrose synthase gene, and a granule-bound starch synthase gene are introduced into a target plant, such that a transgenic plant is obtained. The total starch content of the transgenic plant is higher than that of the target plant. As a result of experiment of the invention, a plurality of genes can be simultaneously transferred in one-time through one time of gene gun bombardment, such that transgenic material cultivation period and work load can be greatly shortened. Specifically, the 4 genes related to starch metabolism are simultaneously transferred in, such that the total starch content of a transgenic regenerated plant is higher than that of wild-type plant.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of method of utilizing polygene to transform cultivation starch content raising transgenic plant.
Background technology
At first Ackermann in 1977 etc. obtain regeneration plant with Ri Plasmid Transformation tobacco cell, have started the history of plant transgene.After this, there are multiple technologies to be invented and be applied to plant transgene, mainly contain agrobacterium-mediated transformation, particle bombardment, protoplasm body and pollen tube passage method, also have in addition virus-mediated method, electric shocking method, microinjection, ultrasonic wave importing method, imbibition method, pollen to carry method, liposome method, Laser microbeam puncture, ionic fluid method etc., use these methods, existing a large amount of plant species is converted successfully and has produced transfer-gen plant.These method for transformation are generally once a goal gene is imported vegetable cell and makes its stable integration in Plant Genome.
For output or other economical character that improves farm crop, often several genes need to be imported in recipient plant, adopt common transgenic method can only adopt several times, change at every turn the strategy of a gene, transformation efficiency is lower, therefore, has produced some polygene method for transformation, the one, when building conversion carrier, a plurality of gene expression frames are connected in series in the T-DNA district, and this technique construction carrier is more loaded down with trivial details, is subjected to the restriction of Ti-plasmids capacity can't build the carrier that comprises greater than the 50Kb insertion sequence; The 2nd, the T-DNA that different foreign genes are building up to respectively on different expression vectors is regional, then will contain heterogeneic expression vector changes in same agrobatcerium cell, carry out polygene and transform, but need to consider that Agrobacterium holds the ability of a plurality of plasmids when adopting this method.Can a plurality of transgenosiss be imported in the same plant material by other strategy in addition, for example will contain different genetically modified plants and hybridize, but these methods inevitably need a plurality of plant-growth cycles to realize.
very polygenic expression has tissue specificity, some starch is synthetic, the gluten synthesis related gene is specifically expressing in the seed of cereal crop only, synthesizing of the various starch of the main catalysis of its product and gluten, they have consisted of the main component of endosperm, the tissue specific expression of these genes is to be determined by the specificity of its promotor, as: wheat high-molecular-weight glutelin (HMW) promotor, barley D group prolamine (D-hordin) promotor, barley B group prolamine (B-hordin) promotor, Rice Glutelin (Gt1) promotor, barley isoamylase (Isa) promotor etc.
In the seed of cereal crop, often accumulate in a large number starch, the gene synthetic relevant to starch, also in the stage specific great expression of endosperm development, wherein important key enzyme or rate-limiting enzyme gene have: sucrose synthase gene (Sh1); The large and small subunit of ADP-glucose pyrophosphorylase (AGPase) is respectively by Sh2 and Bt2 genes encoding; Granule-Bound Starch Synthase (GBSSIIa) gene determines the synthetic of amylose starch.
Summary of the invention
An object of the present invention is to provide a kind of method of cultivating transgenic plant.
Method provided by the invention is following 1) or 2):
1) for ADP-glucose pyrophosphorylase small ylidene gene, the large subunit gene of ADP-glucose pyrophosphorylase, sucrose synthase gene and Granule-Bound Starch Synthase gene are imported in the purpose plant altogether, obtain transgenic plant; The total starch content of described transgenic plant tissue is higher than described purpose plant;
2) for selection markers protein gene, ADP-glucose pyrophosphorylase small ylidene gene, the large subunit gene of ADP-glucose pyrophosphorylase, sucrose synthase gene and Granule-Bound Starch Synthase gene are imported in the purpose plant altogether, obtain transgenic plant; The total starch content of described transgenic plant tissue is higher than described purpose plant.
In aforesaid method, described selection markers albumen be PPT(it be the protein expressioning product of Bar gene, English name Phosphinothricin N-acetyltransferase, in translate careless fourth phosphine N-acetyl-transferase), its aminoacid sequence is sequence 6 in sequence table;
Described ADP-glucose pyrophosphorylase small subunit is Bt2, and its aminoacid sequence is sequence 7 in sequence table;
The large subunit of described ADP-glucose pyrophosphorylase is Sh2, and its aminoacid sequence is sequence 8 in sequence table;
Described sucrose synthase is Sh1, and its aminoacid sequence is sequence 9 in sequence table;
Described Granule-Bound Starch Synthase is GBSSIIa, and its aminoacid sequence is sequence 10 in sequence table.
Described selection markers protein gene is specially Bar, and its nucleotides sequence is classified in sequence table sequence 1 as from 5 ' end 2036-2584 position Nucleotide;
Described ADP-glucose pyrophosphorylase small ylidene gene is specially Bt2, and its nucleotides sequence is classified in sequence table sequence 2 as from 5 ' end 1935-3362 position Nucleotide;
The large subunit gene of described ADP-glucose pyrophosphorylase is specially Sh2, and its nucleotides sequence is classified in sequence table sequence 3 as from 5 ' end 1085-2635 position Nucleotide;
Described sucrose synthase gene is specially Sh1, and its nucleotide sequence is specially in sequence table sequence 4 from 5 ' end 592-3000 position Nucleotide;
Described Granule-Bound Starch Synthase gene is specially GbssIIa, and its nucleotide sequence is specially in sequence table sequence 5 from 5 ' end 478-2307 position Nucleotide.
In aforesaid method, described selection markers protein gene imports the purpose plant with the form of Bar expression casette; Described Bar expression casette specifically comprises Ubi promotor, Bar gene and no terminator;
Described ADP-glucose pyrophosphorylase small ylidene gene imports the purpose plant with the form of Bt2 expression casette; Described Bt2 expression casette specifically comprises Gt1 promotor, Bt2 gene and 35S terminator;
The large subunit gene of described ADP-glucose pyrophosphorylase imports the purpose plant with the form of Sh2 expression casette; Described Sh2 expression casette specifically comprises ISA promotor, Sh2 gene and 35S terminator;
Described sucrose synthase gene imports the purpose plant with the form of Sh1 expression casette; Described Sh1 expression casette specifically comprises B1hordein promotor, Sh1 gene and 35S terminator;
Described Granule-Bound Starch Synthase gene imports the purpose plant with the form of GbssIIa expression casette; Described GbssIIa expression casette specifically comprises HMW-Glutenin promotor, GbssIIa gene and 35S terminator.
The sequence of the gene in above-mentioned expression cassette is coding sequence.
In aforesaid method, described Bar expression casette imports in the purpose plant by recombinant expression vector pTRAuxBar;
Described Bt2 expression casette imports in the purpose plant by recombinant expression vector pGt1-Bt2;
Described Sh2 expression casette imports in the purpose plant by recombinant expression vector pISA-Sh2;
Described Sh1 expression casette imports in the purpose plant by recombinant expression vector pB1hor-Sh1;
Described GbssIIa expression casette imports in the purpose plant by recombinant expression vector pHMW-GbssIIa.
In aforesaid method, the described endosperm that is organized as seed; Described purpose plant is dicotyledons or monocotyledons.The monocotyledons of adopting in an embodiment of the present invention is corn, is specially corn H99.
Another object of the present invention be to provide a kind of in the purpose plant corotation enter the method for a plurality of goal gene.
Method provided by the invention comprises the steps:
1) prepare respectively mixed carrier and transgene receptor:
Described mixed carrier is comprised of a plurality of recombinant expression vectors of equimolar ratio;
Each described recombinant expression vector contains the carrier of a corresponding described goal gene;
Described transgene receptor is prepared as follows:
A, the explant of purpose plant is carried out preculture, obtain explant after preculture;
B, explant after described preculture is carried out height ooze preculture, obtain height and ooze explant after preculture, be transgene receptor;
2) with the coated bronze of described mixed carrier, then import in described transgene receptor by particle gun, obtain bombarding rear explant;
3) explant after described bombardment is gone down to posterity successively cultivation, screening and culturing, differentiation culture and root culture namely obtain transgenic plant, realize that corotation enters a plurality of goal gene in the purpose plant.
In aforesaid method, in step 1), the substratum that described preculture adopts is callus inducing medium N6E, described callus inducing medium N6E is prepared as follows: adding final concentration in the N6 minimum medium is that 2.76g/L proline(Pro), final concentration are that 100mg/L inositol, final concentration are 2mg/L2,4-D, final concentration are that 100mg/L caseinhydrolysate, final concentration are that 25uM Silver Nitrate, final concentration are that 30g/L sucrose and final concentration are the 2.5g/L plant gel, and water is supplied volume;
The substratum that the preculture of oozing described height adopts is the N6OSM substratum, described N6OSM substratum is prepared as follows: adding final concentration in the N6 minimum medium is that 0.69g/L proline(Pro), final concentration are that 100mg/L inositol, final concentration are 2mg/L2,4-D, final concentration are that 100mg/L caseinhydrolysate, final concentration are that 36.4g/L sorbyl alcohol, final concentration are that 36.4g/L N.F,USP MANNITOL, final concentration are that 29mg/L Silver Nitrate, final concentration are that 30g/L sucrose and final concentration are the 2.5g/L plant gel, and water is supplied volume;
Step 2) in, the mass ratio of described bronze and described mixed carrier is 20:1-500:1; Be 100:1 in an embodiment of the present invention;
Particle gun vacuum tightness 27～28psi can split each bombardment of film once with 650psi and 1100psi, can split film to target spot distance: 6cm/9cm;
In step 3), the described cultivation of going down to posterity is cultivation that explant after described bombardment is gone down to posterity, and the cultivation explant obtains going down to posterity;
The described substratum of cultivating employing that goes down to posterity is described callus inducing medium N6E;
Described screening and culturing obtains callus (antiweed biolaphos) for the described cultivation explant that goes down to posterity is carried out screening and culturing (herbicide screening);
The substratum that described screening and culturing adopts is the N6S substratum; Described N6S substratum is prepared as follows: adding final concentration in the N6 minimum medium is that 100mg/L inositol, final concentration are 2mg/L2,4-D, final concentration are the two propylamine phosphines of 2mg/L Bialaphos(), final concentration is that 6mg/L Silver Nitrate, final concentration are that 30g/L sucrose and final concentration are the 2.5g/L plant gel, water is supplied volume;
Described differentiation culture obtains the callus (callus that comprises over-ground part spire and underground part) with spire for described callus is carried out differentiation culture;
The substratum that described differentiation culture adopts is the RMI substratum; Described RMI substratum is prepared as follows: adding final concentration in the MS minimum medium is that 100mg/L inositol, final concentration are the two propylamine phosphines of 3mg/L Bialaphos(), final concentration is that 60g/L sucrose and final concentration are the 3g/L plant gel, water is supplied volume;
Described root culture namely obtains transgenic plant for described callus with spire is carried out root culture;
The substratum that described root culture adopts is the RMII substratum; Described RMII substratum is prepared as follows: adding final concentration in the MS minimum medium is that 100mg/L inositol, final concentration are that 60g/L sucrose and final concentration are the 3g/L plant gel, and water is supplied volume.
In aforesaid method, in step 1), described pre-incubated condition is 25-28 ℃, secretly cultivated 1-3 days; Described pre-incubated condition is specially 28 ℃, secretly cultivated 3 days;
Described height oozes pre-incubated condition and is 25-28 ℃, secretly cultivates 4-10h; Described height oozes pre-incubated condition and is specially 28 ℃, secretly cultivates 8h;
In step 3), the described condition of cultivating that goes down to posterity is 25-28 ℃ of dark the cultivation 14-21 days; The described condition of cultivating that goes down to posterity is specially 28 ℃ of dark cultivations 14 days;
The condition of described screening and culturing is the 25-28 ℃ of dark 2-3 of cultivation week each time, and described screening number of times is 3-6 time;
The condition of described differentiation culture is 23-25 ℃, secretly cultivates 1-3 week; The condition of described differentiation culture is specially 25 ℃, secretly cultivated for 3 weeks;
The condition of described root culture is that secretly to cultivate 15 days, intensity of illumination be 4000-8000lux for 22-25 ℃, 16h light/8h; It is 4000lux that the condition of described root culture is specially 25 ℃, intensity of illumination;
In step 2) and step 3) between also comprise the steps: explant after described bombardment through the high preculture of oozing again; Described again high to ooze the substratum that preculture adopts be the N6SOM substratum, and described again high to ooze pre-incubated condition be the 25-28 ℃ of dark 12-24h of cultivation; Describedly again highly ooze pre-incubated condition and be specially 28 ℃ of high preculture 20h that ooze again;
Described purpose plant is rear 12 days plants of pollination.
In aforesaid method, described purpose plant is dicotyledonous or monocotyledons; Described monocotyledons is specially corn, is specially corn H99; Described explant is the embryo (rataria of the rear 12 days plant seeds of pollinating) of seed;
Described a plurality of goal gene is selection markers protein gene Bar, ADP-glucose pyrophosphorylase small ylidene gene Bt2, the large subunit gene Sh2 of ADP-glucose pyrophosphorylase, sucrose synthase gene Sh1 and Granule-Bound Starch Synthase gene GbssIIa totally 5 genes;
Described a plurality of recombinant expression vector is pTRAuxBar, pGt1-Bt2, pISA-Sh2, pB1hor-Sh1 and pHMW-GbssIIa totally 5 recombinant expression vectors;
Described recombinant expression vector pTRAuxBar is the recombinant vectors that contains the Bar expression casette;
Described recombinant expression vector pGt1-Bt2 is the recombinant vectors that contains the Bt2 expression casette, for the Gt1 promotor in the Bt2 expression casette shown in 5 ' end 34-3362 position Nucleotide and Bt2 gene insert the carrier that pB7RWG2 carrier (attB1 and attB2 between site) obtains with sequence in sequence table 2; Concrete construction process see embodiment 1 one 2) obtain;
Described recombinant expression vector pISA-Sh2 is the recombinant vectors that contains the Sh2 expression casette; For the ISA promotor in the Sh2 expression casette shown in 5 ' end 28-2635 position Nucleotide and Sh2 gene coding region insert pB7RWG2 carrier (attB1 and attB2 between site) with sequence in sequence table 3; Concrete construction process see embodiment 1 one 3) obtain;
Described recombinant expression vector pB1hor-Sh1 is the recombinant vectors that contains the Sh1 expression casette; For the B1hordein promotor in the Sh1 expression casette shown in 5 ' end 28-3000 position Nucleotide and Sh1 gene coding region are connected into the carrier that pB7RWG2 carrier (attB1 and attB2 between site) obtains with sequence in sequence table 4; Concrete construction process see embodiment 1 one 4) obtain;
Described recombinant expression vector pHMW-GbssIIa is the recombinant vectors that contains the GbssIIa expression casette; For the HMW-Glutenin promotor in GbssIIa expression casette shown in 5 ' end 28-2307 position Nucleotide and GbssIIa gene coding region insert the carrier that pB7RWG2 carrier (attB1 and attB2 between site) obtains with sequence in sequence table 5; Concrete construction process see embodiment 1 one 5) obtain.
Described Bar expression casette specifically comprises Ubi promotor, Bar gene and no terminator;
Described Bt2 expression casette specifically comprises Gt1 promotor, Bt2 gene and 35S terminator;
Described Sh2 expression casette specifically comprises ISA promotor, Sh2 gene and 35S terminator;
Described Sh1 expression casette specifically comprises B1hordein promotor, Sh1 gene and 35S terminator;
Described GbssIIa expression casette specifically comprises HMW-Glutenin promotor, GbssIIa gene and 35S terminator.
The nucleotides sequence of described Bar expression casette is classified the sequence 1 in sequence table as;
The nucleotides sequence of described Bt2 expression casette is classified the sequence 2 in sequence table as;
The nucleotides sequence of described Sh2 expression casette is classified the sequence 3 in sequence table as;
The nucleotides sequence of described Sh1 expression casette is classified the sequence 4 in sequence table as;
The nucleotides sequence of described GbssIIa expression casette is classified the sequence 5 in sequence table as.
The recombinant expression vector group that is used for the expression cassette group of polygene conversion or transforms for polygene is also the scope of protection of the invention;
Or the application in improving the plant tissue total starch content of described expression cassette group or described recombinant expression vector group is also the scope of protection of the invention;
Or the substratum group that is used for the polygene conversion is also the scope of protection of the invention;
Described expression cassette group is following 1) or 2):
1) formed by the described Bt2 expression casette in aforesaid method, described Sh2 expression casette, described Sh1 expression casette and described GbssIIa expression casette;
2) formed by the described Bar expression casette in aforesaid method, described Bt2 expression casette, described Sh2 expression casette, described Sh1 expression casette and described GbssIIa expression casette;
Described recombinant expression vector group be following a) or b):
A) formed by the pGt1-Bt2 in aforesaid method, pISA-Sh2, pB1hor-Sh1 and pHMW-GbssIIa;
B) formed by the pTRAuxBar in aforesaid method, pGt1-Bt2, pISA-Sh2, pB1hor-Sh1 and pHMW-GbssIIa;
Described purpose plant is dicotyledons or monocotyledons specifically; Described tissue is specially the endosperm of seed; Described monocotyledons is specially corn, is specially corn H99.The described substratum group that transforms for polygene is comprised of the N6E of callus inducing medium described in aforesaid method, described N6OSM substratum, described N6S substratum, described RMI substratum and described RMII substratum.
low in order to overcome above traditional single-gene or polygene method for transformation efficient, but the defective that the cotransformation gene is few, the present invention is take the Bombardment-Mediated Transformation technology as the basis, adopt multiple plasmid, wherein every kind of plasmid contains a different destination gene expression box, these plasmid equimolar ratio examples are mixed, be coated on the bronze surface, and bombard with particle gun, the transformation receptor vegetable material, adopt the tissue culturing system that optimizes, through the antiweed screening, plant tissue culture and plant regeneration, exogenous origin gene integrator detects, the steps such as exogenous gene expression detection and kernel starchness detection, set up efficient polygene cotransformation system, but and obtain genetic stability, the high starch plant of polygene corotation gene of expressing.
Of the present invention experiment showed, on the one hand adopted method of the present invention, can be by a particle gun bombardment, disposablely change simultaneously a plurality of genes over to, and obtain the more much higher gene cotransformation of transformation efficiency regeneration plant; On the one hand, owing to changing simultaneously 4 kinds of genes relevant to starch metabolism and a kind of selection markers gene over to, make the total starch content content of transgenic regenerated plant higher than wild-type plant in addition; In a word, method of the present invention not only can be controlled a plurality of genes of certain biological character, even can be with all genes in a pathways metabolism, all disposable, efficiently, stably be transferred in acceptor material, greatly improved transgene efficiency; And can obtain the transgenic plant of high-content of starch.
Description of drawings
Fig. 1 is the GUS coloration result
Fig. 2 is the ELISA test strip result
Fig. 3 is that T4 is for the Southern blot detection of material
Fig. 4 is the gene expression abundance of 5 genes in different transgenic lines
Fig. 5 be the T4 of cotransformation for seed total starch content and amylose content determination,
Wherein, a, b, c represent significant difference significantly (P＜0.05, Duncan ' s test).
Embodiment
The experimental technique that uses in following embodiment is ordinary method if no special instructions.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
One, the acquisition of 5 expression vectors
5 needed expression vectors of transgenosis are respectively pTRAuxBar, pGt1-Bt2, pISA-Sh2, pB1hor-Sh1, pHMW-GbssIIa; The concrete integral part of above-mentioned 5 expression vectors is shown in Table 1, and builds the required primer of above-mentioned 5 expression vectors as shown in table 2.
The expression vector that table 1 uses for the polygene cotransformation
The primer that table 2 cloning promoter and gene use
* primer flank position (underscore part) adds corresponding att recombination site;
The construction process of above-mentioned 5 expression vectors is specific as follows:
1）pTRAuxBar
Carrier pTRAuxBar is provided by Zhu, be documented in as in Publication about Document: Cost-effective production of a vaginal protein microbicide to prevent HIV transmission, Proc Natl Acad Sci USA, March11,2008(105) 10:3727 – 3732; The public can obtain from Northeast Normal University.
Contain the Bar expression casette shown in sequence 1 in ordered list in this carrier; The Bar expression casette comprises that sequence 1 in sequence table is from the no terminator shown in the Nucleotide of the Bar gene (aminoacid sequence of the albumen PPT of coding is sequence 6 in sequence table) shown in the Nucleotide of the Ubi promotor shown in 5 ' end 1-949 position Nucleotide, 2036-2584 position, 2585-2808 position.
2）pGt1-Bt2
With paddy rice fine (the Oryza sativa L.var.nipponbare of Japan; Be documented in as in Publication about Document: Zhu, J., Fine mapping of a major QTL controlling panicle number in rice, Molecular Breeding, Volume 27, Issue2, February2011, Pages171-180; The public can obtain from Northeast Normal University) genomic dna be template, take Gt1promoter primers F and R as primer (sequence sees Table 2), carry out pcr amplification, the PCR product that obtains 1883bp is the Gt1 promotor;
(be documented in as in Publication about Document: adopt maize Ubi-1 promoter to obtain low copy transgenic corn plant, biotechnology journal, 2004(20) 1:120-126 with corn H99; The public can obtain from Northeast Normal University) endosperm cDNA is template, and F and R primer (sequence sees Table 2) with Bt2 carry out pcr amplification, and the PCR product that obtains 1428bp is Bt2 full length gene coding region.
The Gt1 promotor that above-mentioned amplification obtains is with attB1 and attB5r recombination site, and the Bt2 gene that above-mentioned amplification obtains is with attB5 and attB2 recombination site; Gateway recombination kit (the Multisite that 2 are provided in Invitrogen company with the sequence of recombination site
Pro Plus Kit for2-, 3-or4-fragment recombination (12537-100), Invitrogen) under the reaction, directly connect 2 purpose fragments by once recombinating and arrive carrier pB7RWG2(available from Plant system biology company, pB7RWG2, http://www.psb.ugent.be/) obtain pGt1-Bt2 in.
With pGt1-Bt2 through order-checking, the carrier that result obtains for the Gt1 promotor in the Bt2 expression casette shown in 5 ' end 34-3362 position Nucleotide and Bt2 gene insertion pB7RWG2 carrier (attB1 and attB2 between site) with sequence in sequence table 2 for this carrier.The Bt2 expression casette comprises the 35S terminator on pB7RWG2 carrier framework shown in the Nucleotide of the Bt2 gene (aminoacid sequence of the albumen ADP-glucose pyrophosphorylase small subunit of coding is sequence 7 in sequence table) shown in the Nucleotide of the Gt1 promotor shown in 5 ' end 34-1904 position Nucleotide, 1935-3362 position, 4089-4314 position of sequence 2 in sequence table.
3）pISA-Sh2
With barley (Hordeum vulgare var Bomi, be documented in as in Publication about Document: The nutritive value of botanically defined mill fractions of barley.2.The influence of hind-gut microflora in rats on digestibility of protein and energy of endosperm and husk of Bomi and M-1508.Bach Knudsen KE, Wolstrup J, Eggum BO.Z Tierphysiol Tierernahr Futtermittelkd.1982Nov; 48 (5): 276-87.; The public can obtain from Northeast Normal University) genomic dna be template, take ISA promoter primers F and R as primer (sequence sees Table 2), carry out pcr amplification, the PCR product that obtains 1033bp is the ISA promotor;
Take corn H99 endosperm cDNA as template, F and R primer (sequence sees Table 2) with Sh2 carry out pcr amplification, and the PCR product that obtains 1551bp is the Sh2 gene coding region.
The ISA promotor that above-mentioned amplification obtains is with attB1 and attB5r recombination site, and the Sh2 gene that above-mentioned amplification obtains is through attB5 and attB2 recombination site; Gateway recombination kit (the Multisite that 2 are provided in Invitrogen company with the sequence of recombination site
Pro Plus Kit for2-, 3-or4-fragment recombination (12537-100) Invitrogen) under the reaction, directly connects 2 purpose fragments by once recombinating and obtain pISA-Sh2 in carrier pB7RWG2.
Through order-checking, this carrier is the ISA promotor in the Sh2 expression casette shown in 5 ' end 28-2635 position Nucleotide and Sh2 gene coding region insertion pB7RWG2 carrier (attB1 and attB2 between site) with sequence in sequence table 3 for this carrier with pISA-Sh2.The Sh2 expression casette comprises the 35S terminator on pB7RWG2 carrier framework shown in the Nucleotide of the Sh2 gene coding region (aminoacid sequence of the Protein S h2 of coding is sequence 8 in sequence table) shown in the Nucleotide of the ISA promotor shown in 5 ' end 28-1060 position Nucleotide, 1085-2635 position, 3362-3587 position of sequence 3 in sequence table.
4）pB1hor-Sh1
Take the genomic dna of barley (Hordeum vulgare var.Bomi) as template, take B1hordein promoter primers F and R as primer (sequence sees Table 2), carry out pcr amplification, the PCR product that obtains 540bp is the B1hordein promotor;
Take corn H99 endosperm cDNA as template, F and R primer (sequence sees Table 2) with Sh1 carry out pcr amplification, and the PCR product that obtains 2409bp is the Sh1 gene coding region.
The B1hordein promotor that above-mentioned amplification obtains is with attB1 and attB5r recombination site, and the Sh1 gene coding region that above-mentioned amplification obtains is through attB5 and attB2 recombination site; GateWay recombination kit (the Multisite that 2 are provided in Invitrogen company with the sequence of recombination site
Pro Plus Kit for2-, 3-or4-fragment recombination (12537-100) Invitrogen) under the reaction, directly connects 2 purpose fragments in carrier pB7RWG2 by once recombinating, and obtains pB1hor-Sh1.
Through order-checking, result is connected into for this carrier is with sequence in sequence table 4 the B1hordein promotor in the Sh1 expression casette shown in 5 ' end 28-3000 position Nucleotide and Sh1 gene coding region the carrier that pB7RWG2 carrier (attB1 and attB2 between site) obtains with pB1hor-Sh1.Wherein, the Sh1 expression casette comprises the 35S terminator on pB7RWG2 carrier framework shown in the Nucleotide of the Sh1 gene coding region (aminoacid sequence of the albumen sucrose synthase of coding is sequence 9 in sequence table) shown in the Nucleotide of the B1hordein promotor shown in 5 ' end 28-567 position Nucleotide, 592-3000 position, 3727-3952 position of sequence 4 in sequence table.
5）pHMW-GbssIIa
With wheat (Triticum astivum var.Chinese spring, be documented in as in Publication about Document: Johnson, J.W., Adult-plant resistance to powdery mildew in Knox62wheat, Cereal Research Communications, Volume31, Issue3-4,2003, Pages281-288; The public can obtain from Northeast Normal University) genomic dna be template, take HMW-Glutenin promoter primers F and R as primer (sequence sees Table 2), carry out pcr amplification, the PCR product that obtains 426bp is the HMW-Glutenin promotor;
Take corn spire cDNA as template, F and R primer (sequence sees Table 2) with GbssIIa carry out pcr amplification, and the PCR product that obtains 1830bp is the GbssIIa gene coding region.
The HMW-Glutenin promotor that above-mentioned amplification obtains is with attB1 and attB5r recombination site, and the GbssIIa gene coding region that above-mentioned amplification obtains is through attB5 and attB2 recombination site; GateWay recombination kit (the Multisite that 2 are provided in Invitrogen company with the sequence of recombination site
Pro Plus Kit for2-, 3-or4-fragment recombination (12537-100) Invitrogen) under the reaction, directly connects 2 purpose fragments in carrier pB7RWG2 by a recombining reaction, obtains pHMW-GbssIIa.
With pHMW-GbssIIa through order-checking, the carrier that result obtains for the HMW-Glutenin promotor in GbssIIa expression casette shown in 5 ' end 28-2307 position Nucleotide and GbssIIa gene coding region insertion pB7RWG2 carrier (attB1 and attB2 between site) with sequence in sequence table 5 for this carrier.The GbssIIa expression casette comprises the 35S terminator on pB7RWG2 carrier framework shown in the Nucleotide of the GbssIIa gene coding region (protein grain of coding is sequence 10 in sequence table in conjunction with the aminoacid sequence of amylosynthease GbssIIa) shown in the Nucleotide of the HMW-Glutenin promotor shown in 5 ' end 28-453 position Nucleotide, 478-2307 position, 3034-3259 position of sequence 5 in sequence table.
Two, the acquisition of transgenic plant
1, particle bombardment obtains transgenic plant
Utilize the desk-top particle gun of PDS-1000 to carry out corn (H99, below also referred to as the wild-type corn) rataria transgeneic procedure, concrete steps are as follows:
1) material selection: according to pollination time, get the rataria of rear 12 days corn H99 seeds of pollination, this moment, maize immature embryos was about 1.8mm;
2) rinse mealie: add 1 Tween20, soak, rinse 30min under clear water, then steep 30min with 75% ethanol, then use aseptic water washing three times;
3) preculture: will be through the 2) rataria after processing, plumular axis is downward, and shield is placed in the culture dish that contains callus inducing medium N6E that is covered with filter paper (2x2cm) 30 rataria/culture dish facing up; Twined sealed membrane, be placed in incubator, 28 ℃, secretly cultivated 3 days; Obtain rataria after preculture;
Callus inducing medium N6E is prepared as follows: adding final concentration in the N6 minimum medium is that 2.76g/L proline(Pro), final concentration are that 100mg/L inositol, final concentration are 2mg/L2,4-D, final concentration are that 100mg/L caseinhydrolysate, final concentration are that 25uM Silver Nitrate, final concentration are that 30g/L sucrose and final concentration are the 2.5g/L plant gel, water is supplied volume, and regulating Medium's PH Value is 5.8.
The final concentration of the concrete component of N6 minimum medium and each component is as follows: ammonium sulfate 463mg/L, boric acid 1.6mg/L, Calcium Chloride Powder Anhydrous 125.33mg/L, two water disodium ethylene diamine tetraacetate 37.25mg/L, green vitriol 27.85mg/L, anhydrous magnesium sulfate 90.37mg/L, manganese sulfate monohydrate 3.3mg/L, potassiumiodide 0.8mg/L, saltpetre 2830mg/L, potassiumphosphate 400mg/L, Zinc Sulphate Heptahydrate 1.5mg/L, glycine 2mg/L, nicotinic acid 0.5mg/L, pyridoxine hydrochloride 0.5mg/L.
4) height oozes preculture:
Rataria after preculture (rataria that namely is shaped and expands is thought to begin to form the TypeII callus) is changed in the culture dish (diameter 3.5cm) that contains the N6OSM substratum, and 28 ℃, the dark cultivation carried out height and oozed processing 8h; Obtain height and ooze rataria after preculture;
N6OSM culture medium prescription and final concentration are specific as follows: N6 minimum medium, 0.69g/L proline(Pro), 100mg/L inositol, 2mg/L2, and 4-D, 100mg/L caseinhydrolysate, 36.4g/L sorbyl alcohol, 36.4g/L N.F,USP MANNITOL, 29mg/L Silver Nitrate, 30g/L sucrose, final concentration are the 2.5g/L plant gel; Water is supplied volume, and regulating Medium's PH Value is 5.8.
5) vehicle treated
During height oozed processing, sterilization Holder and stop net added the 5 μ l pre-mixed mixed carrier DNA of equimolar ratio in the bronze bullet, and mixing is placed on ice after being ready to, and has obtained wrapping up the bronze suspension of plasmid.
The concentration of mixed carrier DNA is 1 μ g/ μ l, and the add-on of carrier is 5 μ g; 0.5mg the mass ratio of bronze parcel 5 μ g mixed carrier DNA(bronzes and mixed carrier is 100:1).Mixed carrier DNA is 5 kinds of carrier pTRAuxBar, pGt1-Bt2, pISA-Sh2, pB1hor-Sh1 and pHMW-GbssIIa that mix according to mol ratio 1:1:1:1:1.
6) with 4) height that obtains ooze preculture after rataria put into particle gun, drip 5 on carrier film) parcel that obtains the bronze suspension of plasmid, particle gun vacuum tightness 27～28psi can split each bombardment of film once with 650psi and 1100psi, can split film to target spot distance: 6cm/9cm; Obtain bombarding rear rataria;
7) will bombard after rataria (on filter paper) 28 ℃ of high preculture 20h that ooze again on the N6SOM substratum, adopt secretly and cultivate, obtain bombarding rear height and ooze the processing rataria;
8) will bombard after height ooze and process rataria and be transferred to cultivations of going down to posterity on N6E substratum without filter paper, the culture condition that goes down to posterity is 28 ℃ of dark cultivations 14 days, the cultivation rataria obtains going down to posterity;
9) will go down to posterity and cultivate rataria and be transferred to screening and culturing on the N6S substratum, the screening and culturing condition be 28 ℃ dark cultivate 3 the week/time, screen altogether 3 times, obtain callus (antiweed biolaphos).
The N6S culture medium prescription is specific as follows: N6 minimum medium, 100mg/L inositol, 2mg/L2,4-D, 2mg/L Bialaphos, 6mg/L Silver Nitrate, 30g/L sucrose, 2.5g/L plant gel; Water is supplied volume, and regulating Medium's PH Value is 5.8.
10) callus (is selected frangible TypeII callus, in diameter 4mm) transfer on induction substratum RMI and carry out differentiation culture, the condition of differentiation culture is 25 ℃, the dark cultivation for 3 weeks obtains the callus (callus that comprises over-ground part spire and underground part) with spire;
The concrete formula of induction substratum RMI is as follows: MS minimum medium, 6-BA1mg/L, 100mg/L inositol, the two propylamine phosphines (Bialaphos) of 3mg/L, 60g/L sucrose, final concentration are the 3g/L plant gel; Water is supplied volume, and regulating Medium's PH Value is 5.8.
The concrete formula of MS minimum medium is: saltpetre 1900mg/L, ammonium nitrate 1650mg/L, potassium primary phosphate 170mg/L, magnesium sulfate heptahydrate 370mg/L, Calcium dichloride dihydrate 440, potassiumiodide 0.83mg/L, boric acid 6.2mg/L, four water manganous sulfates
22.3mg/L, Zinc Sulphate Heptahydrate 8.6mg/L, Sodium Molybdate Dihydrate 0.25mg/L, cupric sulfate pentahydrate 0.025mg/L, CoCL2 6H2O 0.025mg/L, disodium ethylene diamine tetraacetate 37.25mg/L, iron vitriol 27.85mg/L, glycine
2mg/L, vitamin 0.1mg/L, pyridoxine hydrochloride 0.5mg/L, nicotinic acid 0.5mg/L; Water is supplied volume.
11) will be transferred to the callus of spire root culture in the RMII substratum, the root culture condition is that 25 ℃ of 16h light/8h secretly cultivated 15 days, and intensity of illumination is 4000lux, can grow seedling (namely obtaining transgenic plant);
The RMII culture medium prescription is: MS minimum medium, 100mg/L inositol, 60g/L sucrose, final concentration are the 3g/L plant gel; Water is supplied volume, and regulating Medium's PH Value is 5.8.
12) treat that seedling grows to 3cm more than, when root system is complete, seedling is transplanted to the dixie cup that fills soil from the RMII substratum, 25 ℃, light is cultivated, and observes the soil surface every day, waters after finish-drying; Can be transplanted in large basin when high when seedling in dixie cup grows to 25cm, tear dixie cup, with soil and transplantation of seedlings falling flowerpot or experiment field, obtain 250 strain T0 for transgenic corns.
Empty carrier pB7RWG2 is adopted to use the same method change in the wild-type corn, obtain turning the empty carrier corn.
2, the evaluation of transgenic corns
1), Gus staining examine reporter gene transient expression
In order to detect the parameter setting in the particle bombardment transgenosis, whether the micropellet bombardment rataria is even, changed an expression vector with the transient expression gus gene over to.After rataria transforms, cultivated 1～2 day at incubator, carry out GUS dyeing.Concrete operation step is as follows:
(1) after the bombardment that above-mentioned 1 step 6) is obtained, rataria immerses in 0.4% formaldehyde solution, 45min under room temperature;
(2) phosphate buffered saline buffer with 0.1M pH7.0 rinses plant tissue 3 times;
(3) plant tissue is put into the substrate working fluid, 3h under 37 ℃ of states (can spend the night);
(4) slough background color with 75% ethanol;
(5) blue spot of making plant tissue.
Prep solution is as follows:
A.0.2M phosphate buffered saline buffer, pH7.0:
Potassium primary phosphate KH
2PO
4(MW136.09) 22.22g/L
Dipotassium hydrogen phosphate K
2HPO
4(MW174.20) 34.84g/L
With 10N KOH, pH is transferred to 7.0
B.0.1M phosphate buffered saline buffer (P-buffer), pH7.0:
Solution A and distilled water equal-volume are mixed
C．10%Triton X-100：
10mL Triton X-100 is joined in distilled water to final volume 100mL.
D.38.8mM X-Gluc stock solution:
1g X-Gluc is dissolved in the 49.4mL dimethyl sulfoxide (DMSO), uses the centrifuge tube packing, 20 ℃ of storages.
E.50mM Tripotassium iron hexacyanide K
3Fe (CN)
6(MW329.26):
With 16.464g K
3Fe (CN)
6Be dissolved in 1L distilled water.
F.50mM yellow prussiate of potash K
4Fe (CN)
6(MW422.39):
With 21.12g K
4Fe (CN)
6Be dissolved in 1L distilled water
G．100mM EDTA(MW380)：
38g EDTA is dissolved in 1L distilled water
H. staining fluid, see the following form 3:
Table 3 is GUS prescription of its dyeing liquor (volume: microlitre)
Result after dyeing is completed, is examined under a microscope as shown in Figure 1, and result shows that the little bullet of particle bombardment transgenosis is evenly distributed, and changing effect is good.The particle gun significant parameter of Select to use is: can split film: 600psi/1100psi; Can split film to target spot distance: 6cm/9cm.
2) detection of bar in transfer-gen plant
(1) herbicide test kit
For whether the Preliminary detection transgenosis is successful, adopt the test kit QuickStix of U.S. envirologix company
TMKit for
(bar) Cotton leaf﹠amp; Seed detects for transgenic corns 250 strain T0 of Basta screening:
A. clamp T0 for the blade of transgenic corns with pipe lid and the pipe cap of Disposable Tissue Extractor tube in test kit, take off one or two circular leaf tissue, with the pestle that carries in test kit, leaf tissue is pushed tapered tube bottom, the effective waterproof marking pen mark that sample is housed is good;
B. pestle is inserted and contain in organized pipe, grind leaf tissue by the rotation pestle, continue 20 to 30 seconds, until the leaf tissue mill is enough broken;
C. add 0.5mL Extraction Buffer in pipe;
D. continue to smash blade to pieces with the pestle rod, make leaf tissue and the abundant mixing of Extraction Buffer smashed to pieces;
E. take out the pestle rod, test strip is inserted in the Extraction Buffer of mixing and leaf tissue detected, wait for about one minute, the observing response result.
Use test kit 250 strain T0 through the Basta screening are detected for transfer-gen plant, result two bands occur positive as shown in Figure 2 on test strip, and it is negative only having an explanation; Obtain 193 strain bar gene masculine T0 for transgenic corns.
(2) the bar gene PCR of transfer-gen plant is analyzed
In order further to detect whether success of transgenosis, according to herbicide screening mark bar gene design special primer.Primer
Sequence is: upstream primer P1:5'-GCACCATCGTCAACCACTACATC-3'
Downstream primer P2:5'-AGCTGCCAGAAACCCACGT-3'
Take 193 strain bar gene masculine T0 for the transgenic corns genomic dna as template, be that primer carries out pcr amplification with P1 and P2, obtain the 433bp amplified production positive, further proof obtains 193 strain bar gene masculine T0 for transgenic corns.
3) Southern hybridization analysis
Above-mentioned 193 strain bar gene masculine T0 for transgenic corns sowing, sowing, until obtain T4 for transgenic corns, are extracted genomic dna.To turn empty carrier corn and wild-type corn (H99) as contrast.
(1) enzyme of corn gene group DNA is cut
Cut genomic dna (this experiment used restriction enzyme all available from New England Biolabs company) with the EcoRI restriction enzyme according to the specification sheets enzyme: T4 is for transgenic corns genomic dna 30 μ g, EcoRI Buffer5 μ l, EcoRI enzyme 1 μ l, 100 * BSA0.5 μ l, with deionized water mend to cumulative volume be 50 μ l.37 ℃, enzyme was cut 8 hours.
(2) genomic dna transferring film
Enzyme is cut product and is separated through 1% agarose gel electrophoresis (voltage is 1v/cm, 24h).Cut the unnecessary glue of sample surrounding on ultraviolet gel analysis instrument, but leave the position of bromjophenol blue, cut " triangle " in the upper right corner of glue and do positive mark, write down the length and width of glue.Gel pre-treatment in the HCl of 0.125M exactly 10min that vibrates by blue flavescence, makes the DNA depurination to the color of bromophenol blue indicator, outwells HCl, with distilled water rinsing 5 times, in order to avoid HCl neutralizes with the NaOH in lower step.Shift liquid (10X SSC: sodium-chlor 1.5M with neutrality, Trisodium Citrate 1.5M) with siphonage, DNA is transferred on Hybond N+ nylon membrane (Amersham), carry out UV-crosslinkedly after transfer is spent the night, then film is soaked seasoning again after 2-5min with 2x SSC, normal temperature saves backup.
(3) probe preparation and mark
Probe is respectively the PCR product of GbssIIa, Sh1, Sh2, Bt2 and bar gene C DS, and the primer sequence that the required primer of the PCR product of above-mentioned each gene C DS is used during with these genes of clone is identical, sees table 2 for details.
The mark of probe uses the DIG DNA Labeling Kit test kit that Roche company produces to carry out: at first, to add needs the DNA of mark sample (10ng-3 μ g, can divide three uses after general 1 μ g mark), be diluted to 15 μ l with bi-distilled water, be placed in boiling water and approximately made it complete sex change in 10 minutes, then taking-up is put on ice rapidly.In being housed, the pipe of denatured DNA adds following reagent:
Hexa nucleotide Mix,10× 2μl
dNTP Labeling Mix 2μl
Klenow enzyme labeling grade 1μl
Centrifugal after mixing, 37 ℃ of reaction 1-20h, different with the reaction times, reaction product output does not wait, and concrete reference parameter is as follows:
Table 4 probe mark output and efficient
After reaction is completed, add 0.2M EDTA(pH8.0) 2 μ l termination reactions, or 65 ℃ of heating 10min termination reactions.The content of terminal crossing liquid middle probe is less than 25ng in every ml.
(4) Southern hybridization
At first carry out prehybridization, prehybridization solution (10g/L BSA) is melted, pour in hybrid pipe 42 ℃ of prehybridizations into.New film was more preferably greater than 4 hours.To be mixed with hybridization solution [the Liquid block(test kit of 5 * SSC, 0.1% (w/v) SDS, 5% T 500,1/20 volume provides)] sex change 10min in boiling water of probe (probe is respectively the PCR product of GbssIIa, Sh1, Sh2, Bt2 and bar gene C DS), be placed on rapidly on ice, prehybridization solution is poured out, probe is joined in the pipe that prehybridization crosses, and 42 ℃ of hybridization are spent the night.Next day wash-out: probe is poured out, is added elutriant I[1 * SSC, 0.1%(W/V) SDS], 65 ℃ the reaction 15min, repeat this step once.Then add elutriant II(0.5 * SSC, 0.1%(W/V) SDS), 65 ℃ of reactions twice, each 20min.
The detection of hybridization signal and the removal of hybridization signal:
Under normal temperature, the nylon membrane of hybridizing is put into appropriate Washing buffer, room temperature vibration 1-5 minute.Film is put into appropriate Blocking solution, react twice in hybrid pipe, 30min/ time.Blocking solution in pipe is discarded, pour in appropriate Antibody solution, reaction 0.5-1h.Discard Antibody solution, film is put into appropriate Washing buffer rinsing 2 times, each 15min.Washing buffer on film is discarded, film was put into appropriate Detection buffer 2-5 minute.Hybond membrane is placed on a clean preservative film, and make with one of DNA and face up, appropriate detection liquid (being generally 1ml CSPD solution) is dropped on preservative film equably along film one side, make by pulling preservative film four limits that to detect the even distribution membrane of liquid positive, then standing 2-5min.Reclaim unnecessary CSPD solution.The Hybond membrane that is painted with is placed in 37 ℃ of reactions 15 minutes, to strengthen luminous reaction, be with the exposed placement that faces up of film.Attention: during this reaction process exposes, film is in moistening air, and film anything but can be dry.Film is faced up, be put in magazine.In the darkroom, exograph is pressed on film, compressing tablet is carried out in the room temperature exposure more than 30 minutes, then X-ray is developed, stops shadow and photographic fixing.
Wash away the probe on Hybond membrane: first rinse the Hybond membrane of hybridizing in distilled water, then use 0.1%SDS, 0.2M NaOH is rinsing twice in 37 ℃, and each 15 minutes, then used 2 * SSC rinsing 5 minutes, and preservative film is wrapped, and-20 ℃ of preservations are in order to hybridization next time.
Southern blot result as shown in Figure 3, A is that careless fourth phosphine resistant gene (Bar) coding region is that probe, B are that ADP-glucose pyrophosphorylase small ylidene gene (Bt2) coding region is that probe, C are that the large subunit gene of ADP-glucose pyrophosphorylase (Sh2) coding region is that probe, D be particle are that probe, E are that sucrose synthase gene (Sh1) coding region is probe in conjunction with amylosynthease IIa gene (GbssIIa) coding region; The P31-4-2 of each figure swimming lane 1-4 is T4 for transgenic corns; Can find out, wild-type corn (H99) is to bar gene probe amixia signal, and T4 has obvious bar gene probe hybridization signal for transgenic corns; Wild-type H99 all has obvious hybridization signal to the detection probes of other 4 genes, but the number of signal is less than T4 for transgenic corns, illustrate that the probe signals on wild-type H99 should be from native gene, and T4 for probe signals newly-increased in transgenic corns namely from the foreign gene that changes over to; Antiweed and bar gene PCR be accredited as 193 positive strain T0 for transgenic corns in, identify by the southern blot to its T4 generation, it is that 5 genes all change over to for the transgenic corns strain that confirmation has 87 T4, copy number is less, transformation efficiency is 45.08%, and after these 87 T4 are identified for transgenic corns strain called after Southern blot, positive T4 is for transgenic corns.Can find out, adopt method of the present invention to carry out 5 gene cotransformations, obtain the coexpression transgenic plant of high conversion efficiency.
4) real-time fluorescence quantitative RT-PCR
After above-mentioned 87 Southern blot are identified, positive T4 extracts respectively RNA for the endosperm of transgenic corns, reverse transcription obtains cDNA as template, carry out respectively Real-Time PCR with following primer pair, detect 5 genes and identify that at Southern blot rear positive T4 is for the expression in transgenic corns.To turn empty carrier corn and wild-type corn (H99) as contrast.
The primer of the RT-PCR of GbssIIa is 5'-AGATAAGGGTGTTGAGTTGGATGG and 5'-TCGAGACGCCCGACGAA;
The primer of the RT-PCR of Sh1 is 5'-ATGCCTCCTTTCCTCGTCCT and 5'-ATCATCGTCGTGCCCTTGTAG;
The primer of the RT-PCR of Sh2 is 5'-TTGGCCCTCACTGAGCAGC and 5'-CACGGAGTCCTTGAGTTCACATC;
The primer of the RT-PCR of Bt2 is 5'-CTGTGCAGCTAAGACTTCAACAAAC and 5'-CTGTGCAGCTAAGACTTCAACAAAC;
The primer of the RT-PCR of bar is 5'-GGCACGCAACGCCTACGACT and 5'-AGCCCGATGACAGCGACCAC;
Internal reference is corn actin1 gene, and primer is 5'-CCTGAAGATCACCCTGTGCT and 5'-GCAGTCTCCAGCTCCTGTTC.
Result as shown in Figure 4, A is ADP-glucose pyrophosphorylase small subunit (Bt2) gene expression dose, B is the large subunit gene of ADP-glucose pyrophosphorylase (Sh2) expression level, C is that particle is in conjunction with amylosynthease IIa gene (GbssIIa) expression level, D is sucrose synthase gene (Sh1) expression level, and E is the Bar gene expression dose; 1-1-1,1-1-2,1-1-3,1-1-4,1-1-5,1-1-6,1-4-1,1-4-2,1-4-3,1-4-4,1-4-5,1-4-6,2-5-1,2-5-2,2-5-3,2-5-4,2-5-5,2-5-6,2-8-1,2-8-2,2-8-3,2-8-4,2-8-5,2-8-6 are that Southern identifies that rear positive T4 is for transgenic corns; H99 compares with the wild-type corn, and after 87 strain Southern identify, positive T4 are for totally 28 strains that the expression amount of 5 genes of transgenic corns all improves, after accounting for Southern and identifying positive 32.18%.Illustrate and have 5 gene co-expressing T4 of 28 strain for transgenic corns.
The possible cause that above-mentioned transformation efficiency is high: (1) uses various carriers all to mix with the equimolar ratio example, make the frequency that changes simultaneously 4 kinds of other foreign genes in the Herbicid resistant plant over to significantly improve, and other polygene cotransformation such as Zhu uses the carrier ratio of 3:1, Bar genophore ratio height of the present invention; (2) use less plasmid vector to be used for transforming, when preparing bullet, use every batch of bronze 5 μ g mixing plasmid DNA(to be less than the 10-20 μ g of general experimental program), easily obtain the transfer-gen plant of low copy, make exogenous gene expression efficient higher, avoid transgene silencing; (3) use the high substratum pre-treatment rataria time lengthening to 8 hour of oozing, make the transformation efficiency after particle gun bombardment rataria significantly improve; (4) use the culture system of optimizing, comprise that the culture medium prescription of each step all through optimizing, makes plant regeneration frequency, transgenic positive plant frequency all significantly improve than prior art.
Turn empty carrier corn and wild-type corn (H99) result without significant difference.
5) the genetically modified insertion point of reverse pcr analysis
Use Reverse PCR method to analyze genetically modified insertion point.With the genomic dna of different 5 gene co-expressing T4 of restriction enzyme cutting 28 strain for the different strains of transgenic corns, purpose is to produce the short-movie section on genomic dna, but for there is no cleavage site on the promotor that function is arranged, gene order and the terminator that change over to.
Detecting the required restriction endonuclease of pTRAuxBar carrier is EcoRV, and required amplimer is as follows;
pG-G1-F1：TTCCTAAAACCAAAATCCAGTG，
pG-G1-R1：AGACATGCAATGCTCATTATCT；
Detecting the required restriction endonuclease of carrier pGt1-Bt2 is restriction endonuclease BamHI, and required amplimer is as follows;
pG-G1-F1：TCTGCTTCCCTCAACCGTCAC，
pG-G1-R1：CGCCACCACATTCACATCCA；
Detecting the required restriction endonuclease of carrier pISA-Sh2 is XhoI, and required amplimer is as follows;
25-G2-F2：GGCGTTCCGGGTTTCTGG，
22-G2-R2：TGGAGCATAGACGACA；
Detecting the required restriction endonuclease of carrier pB1hor-Sh1 is AseI, and required amplimer is as follows;
28-G9-F1：CCGAGAATGAACGCCAAGAG，
28-G9-R1：CGAACCCAGTGGACATAAGC；
Detecting the required restriction endonuclease of carrier pHMW-GbssIIa is restriction endonuclease AseI, and required amplimer is as follows;
29-G10-F1：TTACACTTTTCTTATTTCAGCCA，
29-G10-R1：CGTCAATTTGTTTACACCACA；
Detailed process is as follows:
(1) extract respectively genomic dna from the different individual plants of 5 gene co-expressing T4 for transgenic corns, respectively with the restriction endonuclease cutting 1 μ g that detects different carriers, it is as follows that enzyme is cut system:
Enzyme is cut 4hr～spend the night, and obtains enzyme and cuts rear DNA.
Annotate: if need the more genomic dna of cutting, system is wanted proportional expansion.
(2) connect cyclisation:
Room temperature is placed 2hr or 16 ℃ and is spent the night, and obtains connecting product.
(3) purifying connects product: precipitate or cross column purification with ethanol, heavy molten DNA obtains purifying and connects product in 50 μ l water.
(4) take above-mentioned connection product as template, increase with amplimer;
The PCR system:
1X: 95℃ 5min.
35X: 95℃ 30 sec.，55℃ 1min.，72℃ 2.5min.
1X: 72℃ 10min.
(5) different PCR products are sent to order-checking, determine insertion point.
Partial results is as shown in table 5:
Table 5 is foreign gene insertion point in the transgenic corns genome
Can find out, can identify the insertion point of expression cassette.
Three, the Function Identification of transgenic plant
Get 5 gene co-expressing T4 for two strain P31-4-2, P31-11-5 in transgenic corns; Through backcrossing, male parent is respectively these two 5 gene co-expressing T4 for transgenic corns with these two strains, and female parent is wild-type corn (H99); The seed that produces backcrossing carries out starch content and detects.Take wild-type corn (H99) as contrast.
Total starch content is measured and is selected perchloric acid method, amylose content determination to select National Standard Method (GB5006-1985).
The perchloric acid method is specific as follows:
1) thick starch obtains
Random choose is 5 from each strain corn seed, and boiling water boiling was sloughed kind of a skin in 3 minutes, goes after embryo, endosperm to be dried to constant weight in 50 ℃; With mortar, the endosperm of oven dry is pulverized, cross 80 mesh sieves, namely obtain thick starch.
2) slough soluble sugar
(1) take 5O mg1) the thick starch that obtains, pour in the 7.5ml test tube, add 4ml50% ethanol, 8O ℃ of water-bath 40min, continuous stirring and evenly mixing therebetween;
(2) the centrifugal l0min of 5000rpm, cleer and peaceful precipitation in collection;
(3) add 2ml80% ethanol in precipitation, repeat extracting 2 times, merge supernatant liquor, collect residue.
3), the mensuration of thick starch content
(1) with above-mentioned 2) (3) residue of obtaining 50 ℃ of oven dry, then add 3ml ddH
2O, mixing stirs, and boiling water bath 15min adds 2ml perchloric acid (72%) after cooling, and 15min is extracted in concussion, and the centrifugal 5min of l000Orpm gets supernatant liquor and adds in the 1Oml pipe, collecting precipitation;
(2) add 2ml perchloric acid (72%) in the precipitation that obtains toward above-mentioned (1), repeat extracting once, merge supernatant (this time the centrifugal rear insolubles of extracting is suspended substance, floats on liquid level, and is easily broken, wants extreme care when drawing supernatant);
(3) get the 0.5ml supernatant liquor and be diluted to 10ml, therefrom draw 0.5ml liquid, add 5ml anthrone reagent (the 0.2g anthrone is dissolved in 5ml ethanol, with 75% sulfuric acid constant volume in the 100ml volumetric flask), boiling water bath 2min measures OD
620The absorbance value of nm;
Starch content calculation formula: starch content %=G*O.9/DW*100%
The G representative sample is in the absorbance at 620nm place; DW represents the seed dry weight.
Result as shown in Figure 5, the total starch content of wild-type corn H99 is 65.05%, 5 gene co-expressing T4 are 75.41%, 5 gene co-expressing T4 for the total starch content of transgenic corns P31-4-2 is 75.96% for the total starch content of transgenic corns P31-11-5; The amylose content of wild-type corn H99 is that 29.27%, 5 gene co-expressing T4 is that 30.17%, 5 gene co-expressing T4 is 28.35% for transgenic corns P31-11-5 amylose content for transgenic corns P31-4-2 amylose content.
Can find out, the total starch content of polygene cotransformation transgenic corns all increases to some extent than the wild-type corn, and amylose content does not obviously change.
Turn empty carrier corn and wild-type corn (H99) result without significant difference.
In this research in 4 of cotransformation Starch-synthesizing genes, Sh1 and GbssIIa have no report in corn gene, in transfer-gen plant endosperm starch content detection, their starch content significantly improves, and illustrates that these gene actings in conjunction make total starch content higher than the content of report.
compare with existing method: (the Li such as Li Ning, N., S.Zhang, et al. (2011). " Over-expression of AGPase genes enhances seed weight and starch content in transgenic maize. " Planta 233 (2): the large small ylidene gene Sh2 and the Bt2 that 241-250.) clone corn AGPase by the method for RT-PCR from corn embryosperm cDNA, select the corn embryosperm specificity promoter to start Sh2 and Bt2 genetic expression, take herbicide resistance gene as selective marker, construct Sh2, the Bt2 single-gene is crossed the expression plant vector excessively of expressing plant vector and both connecting, adopt agriculture bacillus mediated maize bud point genetic transforming method that target gene on three kinds of carriers is changed respectively over to the prosperous 7-2 of Elite Maize Inbred Lines and tucks in 478, total starch content reaches 74%, the amylose starch ratio is 23%, the parent material that uses in the parent who uses in the researchs such as Li Ning and this patent belongs to different blood lineages, they are different from the hybrid vigour that other self-mating system assembly produces, and material itself is the kind of high-content of starch, the H99 parent that the present invention uses belongs to low starch content kind, transgenic line of the present invention is compared starch content and is improved approximately 10% with the parent.
Claims (10)
1. a method of cultivating transgenic plant, be following 1) or 2):
1) for ADP-glucose pyrophosphorylase small ylidene gene, the large subunit gene of ADP-glucose pyrophosphorylase, sucrose synthase gene and Granule-Bound Starch Synthase gene are imported in the purpose plant altogether, obtain transgenic plant; The total starch content of described transgenic plant tissue is higher than described purpose plant;
2) for selection markers protein gene, ADP-glucose pyrophosphorylase small ylidene gene, the large subunit gene of ADP-glucose pyrophosphorylase, sucrose synthase gene and Granule-Bound Starch Synthase gene are imported in the purpose plant altogether, obtain transgenic plant; The total starch content of described transgenic plant tissue is higher than described purpose plant.
2. method according to claim 1 is characterized in that:
Described selection markers albumen is PPT, and its aminoacid sequence is sequence 6 in sequence table;
Described ADP-glucose pyrophosphorylase small subunit is Bt2, and its aminoacid sequence is sequence 7 in sequence table;
The large subunit of described ADP-glucose pyrophosphorylase is Sh2, and its aminoacid sequence is sequence 8 in sequence table;
Described sucrose synthase is Sh1, and its aminoacid sequence is sequence 9 in sequence table;
Described Granule-Bound Starch Synthase is GBSSIIa, and its aminoacid sequence is sequence 10 in sequence table;
Described selection markers protein gene is specially Bar, and its nucleotides sequence is classified in sequence table sequence 1 as from 5 ' end 2036-2584 position Nucleotide;
Described ADP-glucose pyrophosphorylase small ylidene gene is specially Bt2, and its nucleotides sequence is classified in sequence table sequence 2 as from 5 ' end 1935-3362 position Nucleotide;
The large subunit gene of described ADP-glucose pyrophosphorylase is specially Sh2, and its nucleotides sequence is classified in sequence table sequence 3 as from 5 ' end 1085-2635 position Nucleotide;
Described sucrose synthase gene is specially Sh1, and its nucleotides sequence is classified in sequence table sequence 4 as from 5 ' end 592-3000 position Nucleotide;
Described Granule-Bound Starch Synthase gene is specially GbssIIa, and its nucleotides sequence is classified in sequence table sequence 5 as from 5 ' end 478-2307 position Nucleotide.
3. method according to claim 1 and 2 is characterized in that:
Described selection markers protein gene imports the purpose plant with the form of Bar expression casette; Described Bar expression casette specifically comprises Ubi promotor, Bar gene and no terminator;
Described ADP-glucose pyrophosphorylase small ylidene gene imports the purpose plant with the form of Bt2 expression casette; Described Bt2 expression casette specifically comprises Gt1 promotor, Bt2 gene and 35S terminator;
The large subunit gene of described ADP-glucose pyrophosphorylase imports the purpose plant with the form of Sh2 expression casette; Described Sh2 expression casette specifically comprises ISA promotor, Sh2 gene and 35S terminator;
Described sucrose synthase gene imports the purpose plant with the form of Sh1 expression casette; Described Sh1 expression casette specifically comprises B1hordein promotor, Sh1 gene and 35S terminator;
Described Granule-Bound Starch Synthase gene imports the purpose plant with the form of GbssIIa expression casette; Described GbssIIa expression casette specifically comprises HMW-Glutenin promotor, GbssIIa gene and 35S terminator.
4. method according to claim 3 is characterized in that:
Described Bar expression casette imports in the purpose plant by recombinant expression vector pTRAuxBar;
Described Bt2 expression casette imports in the purpose plant by recombinant expression vector pGt1-Bt2;
Described Sh2 expression casette imports in the purpose plant by recombinant expression vector pISA-Sh2;
Described Sh1 expression casette imports in the purpose plant by recombinant expression vector pB1hor-Sh1;
Described GbssIIa expression casette imports in the purpose plant by recombinant expression vector pHMW-GbssIIa.
5. arbitrary described method according to claim 1-4, is characterized in that: the described endosperm that is organized as seed;
Described purpose plant is dicotyledons or monocotyledons.
One kind in the purpose plant corotation enter the method for a plurality of goal gene, comprise the steps:
1) prepare respectively mixed carrier and transgene receptor:
Described mixed carrier is comprised of a plurality of recombinant expression vectors of equimolar ratio; Each described recombinant expression vector contains the carrier of a corresponding described goal gene;
Described transgene receptor is prepared as follows:
A, the explant of purpose plant is carried out preculture, obtain explant after preculture;
B, explant after described preculture is carried out height ooze preculture, obtain height and ooze explant after preculture, be transgene receptor;
2) with the coated bronze of described mixed carrier, then import in described transgene receptor by particle gun, obtain bombarding rear explant;
3) explant after described bombardment is gone down to posterity successively cultivation, screening and culturing, differentiation culture and root culture namely obtain transgenic plant, realize that corotation enters a plurality of goal gene in the purpose plant.
7. method according to claim 6 is characterized in that:
In step 1), the substratum that described preculture adopts is callus inducing medium N6E, described callus inducing medium N6E is prepared as follows: adding final concentration in the N6 minimum medium is that 2.76g/L proline(Pro), final concentration are that 100mg/L inositol, final concentration are 2mg/L2,4-D, final concentration are that 100mg/L caseinhydrolysate, final concentration are that 25uM Silver Nitrate, final concentration are that 30g/L sucrose and final concentration are the 2.5g/L plant gel, and water is supplied volume;
The substratum that the preculture of oozing described height adopts is the N6OSM substratum, described N6OSM substratum is prepared as follows: adding final concentration in the N6 minimum medium is that 0.69g/L proline(Pro), final concentration are that 100mg/L inositol, final concentration are 2mg/L2,4-D, final concentration are that 100mg/L caseinhydrolysate, final concentration are that 36.4g/L sorbyl alcohol, final concentration are that 36.4g/L N.F,USP MANNITOL, final concentration are that 29mg/L Silver Nitrate, final concentration are that 30g/L sucrose and final concentration are the 2.5g/L plant gel, and water is supplied volume;
Step 2) in, the mass ratio of described bronze and described mixed carrier is 20:1-500:1;
In step 3), the described cultivation of going down to posterity is cultivation that explant after described bombardment is gone down to posterity, and the cultivation explant obtains going down to posterity;
The described substratum of cultivating employing that goes down to posterity is described callus inducing medium N6E;
Described screening and culturing obtains callus for the described cultivation explant that goes down to posterity is carried out screening and culturing;
The substratum that described screening and culturing adopts is the N6S substratum; Described N6S substratum is prepared as follows: adding final concentration in the N6 minimum medium is that 100mg/L inositol, final concentration are 2mg/L2,4-D, final concentration are that the two propylamine phosphines of 2mg/L, final concentration are that 6mg/L Silver Nitrate, final concentration are that 30g/L sucrose and final concentration are the 2.5g/L plant gel, and water is supplied volume;
Described differentiation culture obtains the callus with spire for described callus is carried out differentiation culture;
The substratum that described differentiation culture adopts is the RMI substratum; Described RMI substratum is prepared as follows: adding final concentration in the MS minimum medium is that 100mg/L inositol, final concentration are that 3mg/L Bialaphos, final concentration are that 60g/L sucrose and final concentration are the 3g/L plant gel, and water is supplied volume;
Described root culture namely obtains transgenic plant for described callus with spire is carried out root culture;
The substratum that described root culture adopts is the RMII substratum; Described RMII substratum is prepared as follows: adding final concentration in the MS minimum medium is that 100mg/L inositol, final concentration are that 60g/L sucrose and final concentration are the 3g/L plant gel, and water is supplied volume.
8. according to claim 6 or 7 described methods is characterized in that:
In step 1), described pre-incubated condition is 25-28 ℃, secretly cultivated 1-3 days; Described pre-incubated condition is specially 28 ℃, secretly cultivated 3 days;
Described height oozes pre-incubated condition and is 25-28 ℃, secretly cultivates 4-10h; Described height oozes pre-incubated condition and is specially 28 ℃, secretly cultivates 8h;
In step 3), the described condition of cultivating that goes down to posterity is 25-28 ℃ of dark the cultivation 14-21 days; The described condition of cultivating that goes down to posterity is specially 28 ℃ of dark cultivations 14 days;
The condition of described screening and culturing is the 25-28 ℃ of dark 2-3 of cultivation week each time, and described screening number of times is 3-6 time; The condition of described screening and culturing is specially 28 ℃ of dark cultivations for 3 weeks each time, and described screening number of times is 3 times;
The condition of described differentiation culture is 23-25 ℃, secretly cultivates 1-3 week; The condition of described differentiation culture is specially 25 ℃, secretly cultivated for 3 weeks;
The condition of described root culture is that secretly to cultivate 15 days, intensity of illumination be 4000-8000lux for 22-25 ℃, 16h light/8h; It is 4000lux that the condition of described root culture is specially 25 ℃, intensity of illumination;
In step 2) and step 3) between also comprise the steps: explant after described bombardment through the high preculture of oozing again; Described again high to ooze the substratum that preculture adopts be the N6SOM substratum, and described again high to ooze pre-incubated condition be the 25-28 ℃ of dark 12-24h of cultivation; Describedly again highly ooze pre-incubated condition and be specially 28 ℃ of high preculture 20h that ooze again;
Described purpose plant is rear 12 days plants of pollination.
9. arbitrary described method according to claim 6-8 is characterized in that:
Described purpose plant is dicotyledonous or monocotyledons; Described monocotyledons is specially corn; Described explant is the embryo of seed;
Described a plurality of goal gene is selection markers protein gene Bar, ADP-glucose pyrophosphorylase small ylidene gene Bt2, the large subunit gene Sh2 of ADP-glucose pyrophosphorylase, sucrose synthase gene Sh1 and Granule-Bound Starch Synthase gene GbssIIa totally 5 genes;
Described a plurality of recombinant expression vector is pTRAuxBar, pGt1-Bt2, pISA-Sh2, pB1hor-Sh1 and pHMW-GbssIIa totally 5 recombinant expression vectors;
Described recombinant expression vector pTRAuxBar is the recombinant vectors that contains the Bar expression casette;
Described recombinant expression vector pGt1-Bt2 is the recombinant vectors that contains the Bt2 expression casette;
Described recombinant expression vector pISA-Sh2 is the recombinant vectors that contains the Sh2 expression casette;
Described recombinant expression vector pB1hor-Sh1 is the recombinant vectors that contains the Sh1 expression casette;
Described recombinant expression vector pHMW-GbssIIa is the recombinant vectors that contains the GbssIIa expression casette;
Described Bar expression casette specifically comprises Ubi promotor, Bar gene and no terminator;
Described Bt2 expression casette specifically comprises Gt1 promotor, Bt2 gene and 35S terminator;
Described Sh2 expression casette specifically comprises ISA promotor, Sh2 gene and 35S terminator;
Described Sh1 expression casette specifically comprises B1hordein promotor, Sh1 gene and 35S terminator;
Described GbssIIa expression casette specifically comprises HMW-Glutenin promotor, GbssIIa gene and 35S terminator.
10. be used for the expression cassette group of polygene conversion or be used for the recombinant expression vector group that polygene transforms;
Or described expression cassette group or the application of described recombinant expression vector group in improving the plant tissue total starch content;
Or be used for the substratum group that polygene transforms;
Described expression cassette group is following 1) or 2):
1) formed by the described Bt2 expression casette in the described method of claim 3 or 9, described Sh2 expression casette, described Sh1 expression casette and described GbssIIa expression casette;
2) formed by the described Bar expression casette in the described method of claim 3 or 9, described Bt2 expression casette, described Sh2 expression casette, described Sh1 expression casette and described GbssIIa expression casette;
Described recombinant expression vector group be following a) or b):
A) formed by pGt1-Bt2, pISA-Sh2, pB1hor-Sh1 and pHMW-GbssIIa in the described method of claim 4 or 9;
B) formed by pTRAuxBar, pGt1-Bt2, pISA-Sh2, pB1hor-Sh1 and pHMW-GbssIIa in the described method of claim 4 or 9;
Described purpose plant is dicotyledons or monocotyledons specifically; Described tissue is specially the endosperm of seed;
The described substratum group that transforms for polygene is comprised of callus inducing medium N6E described in the arbitrary described method of claim 7-9, described N6OSM substratum, described N6S substratum, described RMI substratum and described RMII substratum.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310069345.8A CN103173485B (en) | 2013-03-05 | 2013-03-05 | Method for cultivating starch-content-increased transgenic plant through multi-gene transformation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310069345.8A CN103173485B (en) | 2013-03-05 | 2013-03-05 | Method for cultivating starch-content-increased transgenic plant through multi-gene transformation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103173485A true CN103173485A (en) | 2013-06-26 |
| CN103173485B CN103173485B (en) | 2015-05-13 |
Family
ID=48633673
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310069345.8A Expired - Fee Related CN103173485B (en) | 2013-03-05 | 2013-03-05 | Method for cultivating starch-content-increased transgenic plant through multi-gene transformation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103173485B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105985951A (en) * | 2015-02-12 | 2016-10-05 | 武汉大学 | Lotus root starch related gene AGP functional molecule marker primers and application |
| WO2017221112A1 (en) * | 2016-06-22 | 2017-12-28 | Benson Hill Biosystems, Inc. | Increasing plant growth and yield by using an adp-glucose pyrophosphorylase sequence |
| CN113025556A (en) * | 2021-04-26 | 2021-06-25 | 东北师范大学 | Separation method of wheat protoplast, cytoplasm and chloroplast |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1513559A (en) * | 2003-08-06 | 2004-07-21 | 复旦大学 | Method capable of renforving gene gun inoculation DNA Vaccine inducel cell immune response |
| CN1628858A (en) * | 2004-08-27 | 2005-06-22 | 复旦大学 | Method for inducing immune response using HBs DNA vaccine inoculated by HBV core protein reinforcing gene gun |
| CN1793377A (en) * | 2005-12-08 | 2006-06-28 | 上海交通大学 | Process for structuring carrier of expressing seven exogenous geng at same time in chloroplast |
-
2013
- 2013-03-05 CN CN201310069345.8A patent/CN103173485B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1513559A (en) * | 2003-08-06 | 2004-07-21 | 复旦大学 | Method capable of renforving gene gun inoculation DNA Vaccine inducel cell immune response |
| CN1628858A (en) * | 2004-08-27 | 2005-06-22 | 复旦大学 | Method for inducing immune response using HBs DNA vaccine inoculated by HBV core protein reinforcing gene gun |
| CN1793377A (en) * | 2005-12-08 | 2006-06-28 | 上海交通大学 | Process for structuring carrier of expressing seven exogenous geng at same time in chloroplast |
Non-Patent Citations (3)
| Title |
|---|
| 别晓敏，等: "植物多基因转化研究进展", 《中国农业科技导报》 * |
| 燕丽，等: "共转化法及其在植物基因工程中的应用, imag", 《生物技术通报》 * |
| 郭嘉，等: "基因枪共转化法获得玉米转基因植株的研究", 《玉米科学》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105985951A (en) * | 2015-02-12 | 2016-10-05 | 武汉大学 | Lotus root starch related gene AGP functional molecule marker primers and application |
| CN105985951B (en) * | 2015-02-12 | 2019-03-19 | 武汉大学 | Lotus Root Starch related gene AGP Functional marker primer and application |
| WO2017221112A1 (en) * | 2016-06-22 | 2017-12-28 | Benson Hill Biosystems, Inc. | Increasing plant growth and yield by using an adp-glucose pyrophosphorylase sequence |
| CN109642238A (en) * | 2016-06-22 | 2019-04-16 | 本森希尔生物系统股份有限公司 | Increase plant growth and yield using ADP- glucose pyrophosphorylase sequence |
| US11008583B2 (en) | 2016-06-22 | 2021-05-18 | Benson Hill, Inc. | Increasing plant growth and yield by using an ADP-glucose pyrophosphorylase sequence |
| CN113025556A (en) * | 2021-04-26 | 2021-06-25 | 东北师范大学 | Separation method of wheat protoplast, cytoplasm and chloroplast |
| CN113025556B (en) * | 2021-04-26 | 2023-08-29 | 东北师范大学 | Separation method of wheat protoplast, cytoplasm and chloroplast |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103173485B (en) | 2015-05-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3252162B1 (en) | Method for conducting site-specific modification on entire plant via gene transient expression | |
| AU2001279510B2 (en) | Method for genetic transformation of woody trees | |
| CN109153988A (en) | The genome edit methods of plant | |
| AU2001279510A1 (en) | Method for genetic transformation of woody trees | |
| CN104450777B (en) | One kind improves plant potassium absorption efficiency, the recombinant expression carrier for resisting the method for potassium deficiency and wherein using | |
| CN104004781A (en) | Preparation method of glyphosate resistant transgenic rice | |
| CN109566396A (en) | A kind of plant hybridization system and application | |
| CN105087640B (en) | Adjust gene and its application of vegetable seeds development | |
| CN107302915B (en) | Crop weed control method | |
| CN101092633A (en) | Method for raising conversion efficiency of pollen tube chnnael method by using toxoprotein gene of Agrobacterium | |
| CN107002030A (en) | The application of the method for method, genetically modified plants, transgenic cell or genetically modified organism, culture medium and conversion plant cell or the tissue of plant cell or plant tissue is converted using agrobacterium | |
| CN103173485B (en) | Method for cultivating starch-content-increased transgenic plant through multi-gene transformation | |
| CN103525864A (en) | Soybean conversion method | |
| CN103348009B (en) | A kind of method for preparing fertility-lowered plant | |
| CN108265076A (en) | The application of OsSAPK9 albumen and its encoding gene in rice Aluminum toxicity is improved | |
| CN110268973B (en) | Production method of rice hybrid | |
| Chen et al. | Maize (Zea mays L.) transformation by Agrobacterium tumefaciens infection of pollinated ovules | |
| CN102965374B (en) | Preparation method and applications of rape BnRabGDI3 promoter | |
| CN105968178B (en) | The application of rice Os RAD1 albumen and its encoding gene in regulation pollen fertility | |
| CN107459564A (en) | The application of rice ZYGO1 albumen and its encoding gene in pollen fertility is regulated and controled | |
| CN104805093B (en) | Applications of the paddy gene OsLOL3 in delaying plant leaf blade aging and improving drought resistance in plants | |
| FR2687284A1 (en) | PLANT CARRYING GENES ENCODING ENZYMES IN THE BIOSYNTHESIS PATHWAY OF PHYTOSTEROLS, AND PROCESS FOR OBTAINING SAME. | |
| CN104004072B (en) | The application in regulating growth of plants of DUF994 albumen and encoding gene thereof | |
| CN102051377B (en) | Non-tissue culture corn genetic transformation method | |
| CN102618573B (en) | Soybean efficient genetic transformation method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150513 Termination date: 20190305 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |