CN103173485B - Method for cultivating starch-content-increased transgenic plant through multi-gene transformation - Google Patents

Abstract

The invention discloses a method for cultivating a starch-content-increased transgenic plant through multi-gene transformation. According to the transgenic plant cultivation method provided by the invention, a selection marker gene, an adenosine diphosphate glucose pyrophosphorylase small subunit gene, an adenosine diphosphate glucose pyrophosphorylase large subunit gene, a sucrose synthase gene, and a granule-bound starch synthase gene are introduced into a target plant, such that a transgenic plant is obtained. The total starch content of the transgenic plant is higher than that of the target plant. As a result of experiment of the invention, a plurality of genes can be simultaneously transferred in one-time through one time of gene gun bombardment, such that transgenic material cultivation period and work load can be greatly shortened. Specifically, the 4 genes related to starch metabolism are simultaneously transferred in, such that the total starch content of a transgenic regenerated plant is higher than that of wild-type plant.

Description

A kind of method utilizing polygene to transform cultivation starch content raising transgenic plant

Technical field

The present invention relates to biological technical field, particularly relate to a kind of method utilizing polygene to transform cultivation starch content raising transgenic plant.

Background technology

First Ackermann in 1977 etc. obtain regeneration plant with Ri Plastid transformation tobacco cell, have started the history of plant transgene.After this, multiple technologies are had to be invented and be applied to plant transgene, mainly contain agrobacterium-mediated transformation, particle bombardment, protoplasm body and pollen tube passage method, virus-mediated methods, electric shocking method, microinjection, ultrasonic delivery method, imbibition method, pollen is also had to carry method, liposome method, Laser microbeam puncture, ionic fluid method etc. in addition, apply these methods, existing a large amount of plant species is converted successfully and creates transfer-gen plant.These method for transformation are generally once a goal gene imported vegetable cell and make its stable integration in Plant Genome.

In order to improve output or other economical character of farm crop, often need several channel genes in recipient plant, adopt common transgenic method can only adopt several times, proceed to the strategy of a gene at every turn, transformation efficiency is lower, therefore, creates some polygene method for transformation, one is when building conversion carrier, be connected in series to by multiple gene expression frame in T-DNA district, this technique construction carrier is more loaded down with trivial details, holds quantitative limitation cannot build the carrier comprising and be greater than 50Kb insertion sequence by Ti-plasmids; Two is the T-DNA regions be building up to respectively by different foreign gene on different expression vector, then will proceed in same agrobatcerium cell containing heterogeneic expression vector, carry out polygene conversion, but need when adopting in this way to consider that Agrobacterium holds the ability of multiple plasmid.By other strategy, multiple transgenosis can be imported in same plant material in addition, such as, will hybridize containing different genetically modified plant, but these methods inevitably need multiple plant growing cycle to realize.

Very polygenic expression has tissue specificity, some Starch synthesis, gluten synthesis related gene is specifically expressing in the seed of cereal crop only, the synthesis of the various starch of its product major catalytic and gluten, they constitute the main component of endosperm, the tissue specific expression of these genes is determined by the specificity of its promotor, as: wheat high-molecular-weight glutelin (HMW) promotor, barley D group prolamine (D-hordin) promotor, barley B group prolamine (B-hordin) promotor, Rice Glutelin (Gt1) promotor, barley isoamylase (Isa) promotor etc.

In the seed of cereal crop, often accumulate starch in a large number, the gene relevant to Starch synthesis, also in the stage specific great expression of endosperm development, wherein important key enzyme or rate-limiting enzyme gene have: sucrose synthase gene (Sh1); ADP-glucose pyrophosphorylase (AGPase) large and small subunit, respectively by Sh2 and Bt2 genes encoding; Granule-Bound Starch Synthase (GBSSIIa) gene, determines the synthesis of amylose starch.

Summary of the invention

An object of the present invention is to provide a kind of method of cultivating transgenic plant.

Method provided by the invention is following 1) or 2):

1) for import in object plant altogether by ADP-glucose pyrophosphorylase small ylidene gene, the large subunit gene of ADP-glucose pyrophosphorylase, sucrose synthase gene and Granule-Bound Starch Synthase gene, transgenic plant are obtained; The total starch content of described Transgenic plant tissue is higher than described object plant;

2) for import in object plant altogether by selection markers protein gene, ADP-glucose pyrophosphorylase small ylidene gene, the large subunit gene of ADP-glucose pyrophosphorylase, sucrose synthase gene and Granule-Bound Starch Synthase gene, transgenic plant are obtained; The total starch content of described Transgenic plant tissue is higher than described object plant.

In aforesaid method, described selection markers albumen be PPT(it be the protein expressioning product of Bar gene, English name Phosphinothricin N-acetyltransferase, in translate careless fourth phosphine N-acetyl-transferase), its aminoacid sequence is sequence 6 in sequence table;

Described ADP-glucose pyrophosphorylase small subunit is Bt2, and its aminoacid sequence is sequence 7 in sequence table;

The large subunit of described ADP-glucose pyrophosphorylase is Sh2, and its aminoacid sequence is sequence 8 in sequence table;

Described sucrose synthase is Sh1, and its aminoacid sequence is sequence 9 in sequence table;

Described Granule-Bound Starch Synthase is GBSSIIa, and its aminoacid sequence is sequence 10 in sequence table.

Described selection markers protein gene is specially Bar, and its nucleotides sequence to be classified as in sequence table sequence 1 from 5 ' end 2036-2584 position Nucleotide;

Described ADP-glucose pyrophosphorylase small ylidene gene is specially Bt2, and its nucleotides sequence to be classified as in sequence table sequence 2 from 5 ' end 1935-3362 position Nucleotide;

The large subunit gene of described ADP-glucose pyrophosphorylase is specially Sh2, and its nucleotides sequence to be classified as in sequence table sequence 3 from 5 ' end 1085-2635 position Nucleotide;

Described sucrose synthase gene is specially Sh1, and its nucleotide sequence is specifically for sequence 4 in sequence table is from 5 ' end 592-3000 position Nucleotide;

Described Granule-Bound Starch Synthase gene is specially GbssIIa, and its nucleotide sequence is specifically for sequence 5 in sequence table is from 5 ' end 478-2307 position Nucleotide.

In aforesaid method, described selection markers protein gene imports object plant with the form of Bar expression casette; Described Bar expression casette specifically comprises Ubi promotor, Bar gene and no terminator;

Described ADP-glucose pyrophosphorylase small ylidene gene imports object plant with the form of Bt2 expression casette; Described Bt2 expression casette specifically comprises Gt1 promotor, Bt2 gene and 35S terminator;

The large subunit gene of described ADP-glucose pyrophosphorylase imports object plant with the form of Sh2 expression casette; Described Sh2 expression casette specifically comprises ISA promotor, Sh2 gene and 35S terminator;

Described sucrose synthase gene imports object plant with the form of Sh1 expression casette; Described Sh1 expression casette specifically comprises B1hordein promotor, Sh1 gene and 35S terminator;

Described Granule-Bound Starch Synthase gene imports object plant with the form of GbssIIa expression casette; Described GbssIIa expression casette specifically comprises HMW-Glutenin promotor, GbssIIa gene and 35S terminator.

The sequence of the gene in above-mentioned expression cassette is coding sequence.

In aforesaid method, described Bar expression casette imports in object plant by recombinant expression vector pTRAuxBar;

Described Bt2 expression casette imports in object plant by recombinant expression vector pGt1-Bt2;

Described Sh2 expression casette imports in object plant by recombinant expression vector pISA-Sh2;

Described Sh1 expression casette imports in object plant by recombinant expression vector pB1hor-Sh1;

Described GbssIIa expression casette is imported in object plant by recombinant expression vector pHMW-GbssIIa.

In aforesaid method, described in be organized as the endosperm of seed; Described object plant is dicotyledons or monocotyledons.The monocotyledons adopted in an embodiment of the present invention is corn, is specially corn H99.

Another object of the present invention is to provide a kind of method entering multiple goal gene to corotation in object plant.

Method provided by the invention, comprises the steps:

1) mixed carrier and transgene receptor is prepared respectively:

Described mixed carrier is made up of multiple recombinant expression vectors of equimolar ratio;

Each described recombinant expression vector contains the carrier of a corresponding described goal gene;

Described transgene receptor is prepared as follows:

A, the explant of object plant is carried out preculture, obtain explant after preculture;

B, explant after described preculture is carried out height ooze preculture, obtain height and ooze explant after preculture, be transgene receptor;

2) by described mixed carrier bag by bronze, then to be imported in described transgene receptor by particle gun, obtain bombarding rear explant;

3) explant after described bombardment is carried out Secondary Culture, screening and culturing, differentiation culture and root culture successively, namely obtain transgenic plant, realize corotation in object plant and enter multiple goal gene.

In aforesaid method, in step 1), the substratum that described preculture adopts is callus inducing medium N6E, described callus inducing medium N6E is prepared as follows: in N6 minimum medium, add that final concentration is 2.76g/L proline(Pro), final concentration is 100mg/L inositol, final concentration is 2mg/L2,4-D, final concentration are 100mg/L caseinhydrolysate, final concentration is 25uM Silver Nitrate, final concentration is 30g/L sucrose and final concentration is 2.5g/L plant gel, supply volume with water;

The substratum that described height oozes preculture employing is N6OSM substratum, described N6OSM substratum is prepared as follows: in N6 minimum medium, add that final concentration is 0.69g/L proline(Pro), final concentration is 100mg/L inositol, final concentration is 2mg/L2,4-D, final concentration are 100mg/L caseinhydrolysate, final concentration is 36.4g/L sorbyl alcohol, final concentration is 36.4g/L N.F,USP MANNITOL, final concentration is 29mg/L Silver Nitrate, final concentration is 30g/L sucrose and final concentration is 2.5g/L plant gel, supply volume with water;

Step 2) in, the mass ratio of described bronze and described mixed carrier is 20:1-500:1; Be 100:1 in an embodiment of the present invention;

Particle gun vacuum tightness 27 ~ 28psi, can split film with 650psi and 1100psi and respectively bombard once, can split film to target spot distance: 6cm/9cm;

In step 3), described Secondary Culture, for explant after described bombardment is carried out Secondary Culture, obtains Secondary Culture explant;

The substratum that described Secondary Culture adopts is described callus inducing medium N6E;

Described screening and culturing, for described Secondary Culture explant is carried out screening and culturing (herbicide screening), obtains callus (antiweed biolaphos);

The substratum that described screening and culturing adopts is N6S substratum; Described N6S substratum is prepared as follows: in N6 minimum medium, add that final concentration is 100mg/L inositol, final concentration is 2mg/L2,4-D, final concentration are the two propylamine phosphine of 2mg/L Bialaphos(), final concentration is 6mg/L Silver Nitrate, final concentration be 30g/L sucrose and final concentration is 2.5g/L plant gel, supplies volume with water;

Described differentiation culture, for described callus is carried out differentiation culture, obtains the callus (comprising the callus of over-ground part spire and underground part) with spire;

The substratum that described differentiation culture adopts is RMI substratum; Described RMI substratum is prepared as follows: in MS minimum medium, add that final concentration is 100mg/L inositol, final concentration is the two propylamine phosphine of 3mg/L Bialaphos(), final concentration be 60g/L sucrose and final concentration is 3g/L plant gel, supplies volume with water;

Described root culture is that the described callus with spire is carried out root culture, namely obtains transgenic plant;

The substratum that described root culture adopts is RMII substratum; Described RMII substratum is prepared as follows: in MS minimum medium, add that final concentration is 100mg/L inositol, final concentration is 60g/L sucrose and final concentration is 3g/L plant gel, supplies volume with water.

In aforesaid method, in step 1), described pre-incubated condition is 25-28 DEG C, light culture 1-3 days; Described pre-incubated condition is specially 28 DEG C, light culture 3 days;

It is 25-28 DEG C, light culture 4-10h that described height oozes pre-incubated condition; Described height oozes pre-incubated condition and is specially 28 DEG C, light culture 8h;

In step 3), the condition of described Secondary Culture is 25-28 DEG C of light culture 14-21 days; The condition of described Secondary Culture is specially 28 DEG C of light culture 14 days;

The condition of described screening and culturing is 25-28 DEG C of light culture 2-3 week each time, and described screening number of times is 3-6 time;

The condition of described differentiation culture is 23-25 DEG C, light culture 1-3 week; The condition of described differentiation culture is specially 25 DEG C, light culture 3 weeks;

The condition of described root culture is 22-25 DEG C, 16h light/8h light culture 15 days, intensity of illumination are 4000-8000lux; The condition of described root culture is specially 25 DEG C, intensity of illumination is 4000lux;

In step 2) and step 3) between also comprise the steps: explant after described bombardment to ooze preculture through again high; Described again high to ooze the substratum that preculture adopts be N6SOM substratum, and described again high to ooze pre-incubated condition be 25-28 DEG C of light culture 12-24h; Describedly again highly ooze pre-incubated condition and be specially 28 DEG C again high and ooze preculture 20h;

Described object plant is pollination latter 12 days plants.

In aforesaid method, described object plant is dicotyledonous or monocotyledons; Described monocotyledons is specially corn, is specially corn H99; Described explant is the embryo (rataria of latter 12 days plant seeds of pollinating) of seed;

Described multiple goal gene is selection markers protein gene Bar, ADP-glucose pyrophosphorylase small ylidene gene Bt2, the large subunit gene Sh2 of ADP-glucose pyrophosphorylase, sucrose synthase gene Sh1 and Granule-Bound Starch Synthase gene GbssIIa totally 5 genes;

Described multiple recombinant expression vector is pTRAuxBar, pGt1-Bt2, pISA-Sh2, pB1hor-Sh1 and pHMW-GbssIIa totally 5 recombinant expression vectors;

Described recombinant expression vector pTRAuxBar is the recombinant vectors containing Bar expression casette;

Described recombinant expression vector pGt1-Bt2 is the recombinant vectors containing Bt2 expression casette, for the Gt1 promotor of sequence in sequence table 2 in the Bt2 expression casette shown in 5 ' end 34-3362 position Nucleotide and Bt2 gene being inserted the carrier that pB7RWG2 carrier (between attB1 and attB2 site) obtains; Concrete construction process is shown in of embodiment 1 2) obtain;

Described recombinant expression vector pISA-Sh2 is the recombinant vectors containing Sh2 expression casette; For the ISA promotor of sequence in sequence table 3 in the Sh2 expression casette shown in 5 ' end 28-2635 position Nucleotide and Sh2 gene coding region are inserted pB7RWG2 carrier (between attB1 and attB2 site); Concrete construction process is shown in of embodiment 1 3) obtain;

Described recombinant expression vector pB1hor-Sh1 is the recombinant vectors containing Sh1 expression casette; For the B1hordein promotor of sequence in sequence table 4 in the Sh1 expression casette shown in 5 ' end 28-3000 position Nucleotide and Sh1 gene coding region being connected into the carrier that pB7RWG2 carrier (between attB1 and attB2 site) obtains; Concrete construction process is shown in of embodiment 1 4) obtain;

Described recombinant expression vector pHMW-GbssIIa is the recombinant vectors containing GbssIIa expression casette; For the HMW-Glutenin promotor of sequence in sequence table 5 in GbssIIa expression casette shown in 5 ' end 28-2307 position Nucleotide and GbssIIa gene coding region being inserted the carrier that pB7RWG2 carrier (between attB1 and attB2 site) obtains; Concrete construction process is shown in of embodiment 1 5) obtain.

Described Bar expression casette specifically comprises Ubi promotor, Bar gene and no terminator;

Described Bt2 expression casette specifically comprises Gt1 promotor, Bt2 gene and 35S terminator;

Described Sh2 expression casette specifically comprises ISA promotor, Sh2 gene and 35S terminator;

Described Sh1 expression casette specifically comprises B1hordein promotor, Sh1 gene and 35S terminator;

Described GbssIIa expression casette specifically comprises HMW-Glutenin promotor, GbssIIa gene and 35S terminator.

The nucleotides sequence of described Bar expression casette is classified as the sequence 1 in sequence table;

The nucleotides sequence of described Bt2 expression casette is classified as the sequence 2 in sequence table;

The nucleotides sequence of described Sh2 expression casette is classified as the sequence 3 in sequence table;

The nucleotides sequence of described Sh1 expression casette is classified as the sequence 4 in sequence table;

The nucleotides sequence of described GbssIIa expression casette is classified as the sequence 5 in sequence table.

The expression cassette group transformed for polygene or the recombinant expression vector group for polygene conversion are also the scope of protection of the invention;

Or described expression cassette group or described recombinant expression vector group are also the scope of protection of the invention improving the application in plant tissue total starch content;

Or for polygene transform substratum group be also the scope of protection of the invention;

Described expression cassette group is following 1) or 2):

1) be made up of the described Bt2 expression casette in aforesaid method, described Sh2 expression casette, described Sh1 expression casette and described GbssIIa expression casette;

2) be made up of the described Bar expression casette in aforesaid method, described Bt2 expression casette, described Sh2 expression casette, described Sh1 expression casette and described GbssIIa expression casette;

Described recombinant expression vector group be following a) or b):

A) be made up of pGt1-Bt2, pISA-Sh2, pB1hor-Sh1 and pHMW-GbssIIa in aforesaid method;

B) be made up of pTRAuxBar, pGt1-Bt2, pISA-Sh2, pB1hor-Sh1 and pHMW-GbssIIa in aforesaid method;

Described object plant specifically dicotyledons or monocotyledons; Described tissue is specially the endosperm of seed; Described monocotyledons is specially corn, is specially corn H99.The described substratum group for polygene conversion is made up of the N6E of callus inducing medium described in aforesaid method, described N6OSM substratum, described N6S substratum, described RMI substratum and described RMII substratum.

In order to overcome above traditional single-gene or polygene method for transformation efficiency low, can the few defect of cotransformation gene, the present invention is based on Bombardment-Mediated Transformation technology, adopt multiple plasmid, wherein often kind of plasmid contains a different destination gene expression box, by these plasmid equimolar ratio example mixing, be coated on bronze surface, and with biolistic bombardment, transformation receptor vegetable material, adopt the tissue culturing system optimized, screen through antiweed, plant tissue culture and plant regeneration, exogenous origin gene integrator detects, the steps such as exogenous gene expression detection and kernel starchness detection, establish efficient polygene cotransformation system, and obtain Absorbable organic halogens heredity, the polygene corotation gene height starch plant of expressing.

Experiment of the present invention proves, on the one hand, adopts method of the present invention, by a biolistic bombardment, disposablely proceeds to multiple gene simultaneously, obtains transformation efficiency more much higher gene cotransformation regeneration plant; In addition on the one hand, owing to proceeding to 4 kinds of genes relevant to starch metabolism and a kind of riddled basins simultaneously, make the total starch content content of transgenic regenerated plant higher than wild-type plant; In a word, method of the present invention not only can control multiple genes of certain biological character, even can by all genes in a pathways metabolism, all disposable, efficiently, be stably transferred in acceptor material, drastically increases transgene efficiency; And the transgenic plant of high-content of starch can be obtained.

Accompanying drawing explanation

Fig. 1 is GUS coloration result

Fig. 2 is ELISA test strip result

To be T4 detect for the Southern blot of material Fig. 3

Fig. 4 is the gene expression abundance of 5 genes in different transgenic line

Fig. 5 be the T4 of cotransformation for seed total starch content and amylose content determination,

Wherein, a, b, c represent significant difference significantly (P<0.05, Duncan ' s test).

Embodiment

The experimental technique used in following embodiment if no special instructions, is ordinary method.

Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.

Embodiment 1, the common acquisition turning the transgenic plant of 5 genes

One, the acquisition of 5 expression vectors

Expression vector required for 5 transgenosiss is respectively pTRAuxBar, pGt1-Bt2, pISA-Sh2, pB1hor-Sh1, pHMW-GbssIIa; The concrete integral part of above-mentioned 5 expression vectors is shown in Table 1, and the primer built needed for above-mentioned 5 expression vectors is as shown in table 2.

The expression vector that table 1 uses for polygene cotransformation

The primer that table 2 cloning promoter and gene use

* primer flank position (underscore part) adds corresponding att recombination site;

The construction process of above-mentioned 5 expression vectors is specific as follows:

1）pTRAuxBar

Carrier pTRAuxBar is provided by Zhu, be documented in as in Publication about Document: Cost-effective production of avaginal protein microbicide to prevent HIV transmission, Proc Natl Acad Sci USA, March11,2008(105) 10:3727 – 3732; The public can obtain from Northeast Normal University.

Containing the Bar expression casette shown in sequence 1 in ordered list in this carrier; Bar expression casette to comprise in sequence table sequence 1 from the no terminator shown in the Ubi promotor shown in 5 ' end 1-949 position Nucleotide, the Bar gene (aminoacid sequence of the albumen PPT of coding is sequence in sequence table 6) shown in the Nucleotide of 2036-2584 position, 2585-2808 position Nucleotide.

2）pGt1-Bt2

With fine (the Oryza sativa L.var.nipponbare of paddy rice Japan; Be documented in as in Publication about Document: Zhu, J., Finemapping of a major QTL controlling panicle number in rice, Molecular Breeding, Volume27, Issue2, February2011, Pages171-180; The public can obtain from Northeast Normal University) genomic dna be template, with Gt1promoter primers F and R for primer (sequence is in table 2), carry out pcr amplification, the PCR primer obtaining 1883bp is Gt1 promotor;

With corn H99 (being documented in as in Publication about Document: adopt maize Ubi-1 promoter to obtain low copy transgenic corn plant, biotechnology journal, 2004(20) 1:120-126; The public can obtain from Northeast Normal University) endosperm cDNA is template, with F and the R primer (sequence is in table 2) of Bt2, carry out pcr amplification, the PCR primer obtaining 1428bp is Bt2 full length gene coding region.

The Gt1 promotor that above-mentioned amplification obtains is with attB1 and attB5r recombination site, and the Bt2 gene that above-mentioned amplification obtains is with attB5 and attB2 recombination site; By the Gateway recombination kit (Multisite that 2 provide in Invitrogen company with the sequence of recombination site pro Plus Kit for2-, 3-or4-fragmentrecombination (12537-100), Invitrogen) under reaction, 2 object fragments are directly connected to carrier pB7RWG2(purchased from Plant system biology company by once recombinating, pB7RWG2, http://www.psb.ugent.be/) in obtain pGt1-Bt2.

By pGt1-Bt2 through order-checking, result is the carrier of this carrier for the Gt1 promotor of sequence in sequence table 2 in the Bt2 expression casette shown in 5 ' end 34-3362 position Nucleotide and Bt2 gene insertion pB7RWG2 carrier (between attB1 and attB2 site) being obtained.Bt2 expression casette comprises the 35S terminator of sequence 2 on pB7RWG2 carrier framework shown in the Gt1 promotor shown in 5 ' end 34-1904 position Nucleotide, the Bt2 gene (aminoacid sequence of the albumen ADP-glucose pyrophosphorylase small subunit of coding is sequence in sequence table 7) shown in the Nucleotide of 1935-3362 position, 4089-4314 position Nucleotide in sequence table.

3）pISA-Sh2

With barley (Hordeum vulgare var Bomi; be documented in as in Publication about Document: The nutritive value ofbotanically defined mill fractions of barley.2.The influence of hind-gut microflorain rats on digestibility of protein and energy of endosperm and husk of Bomi and M-1508.Bach Knudsen KE; Wolstrup J, Eggum BO.Z Tierphysiol Tierernahr Futtermittelkd.1982Nov; 48 (5): 276-87.; The public can obtain from Northeast Normal University) genomic dna be template, with ISA promoter primers F and R for primer (sequence is in table 2), carry out pcr amplification, the PCR primer obtaining 1033bp is ISA promotor;

With corn H99 endosperm cDNA for template, with F and the R primer (sequence is in table 2) of Sh2, carry out pcr amplification, the PCR primer obtaining 1551bp is Sh2 gene coding region.

The ISA promotor that above-mentioned amplification obtains is with attB1 and attB5r recombination site, and the Sh2 gene that above-mentioned amplification obtains is through attB5 and attB2 recombination site; By the Gateway recombination kit (Multisite that 2 provide in Invitrogen company with the sequence of recombination site pro Plus Kit for2-, 3-or4-fragmentrecombination (12537-100), Invitrogen) under reaction, directly connect 2 object fragments by once recombinating and obtain pISA-Sh2 in carrier pB7RWG2.

By pISA-Sh2 through order-checking, this carrier is for this carrier is for by the ISA promotor of sequence in sequence table 3 in the Sh2 expression casette shown in 5 ' end 28-2635 position Nucleotide and Sh2 gene coding region insertion pB7RWG2 carrier (between attB1 and attB2 site).Sh2 expression casette comprises the 35S terminator of sequence 3 on pB7RWG2 carrier framework shown in the ISA promotor shown in 5 ' end 28-1060 position Nucleotide, the Sh2 gene coding region (aminoacid sequence of the Protein S h2 of coding is sequence in sequence table 8) shown in the Nucleotide of 1085-2635 position, 3362-3587 position Nucleotide in sequence table.

4）pB1hor-Sh1

With the genomic dna of barley (Hordeum vulgare var.Bomi) for template, with B1hordein promoter primers F and R for primer (sequence is in table 2), carry out pcr amplification, the PCR primer obtaining 540bp is B1hordein promotor;

With corn H99 endosperm cDNA for template, with F and the R primer (sequence is in table 2) of Sh1, carry out pcr amplification, the PCR primer obtaining 2409bp is Sh1 gene coding region.

The B1hordein promotor that above-mentioned amplification obtains is with attB1 and attB5r recombination site, and the Sh1 gene coding region that above-mentioned amplification obtains is through attB5 and attB2 recombination site; By the GateWay recombination kit (Multisite that 2 provide in Invitrogen company with the sequence of recombination site pro Plus Kit for2-, 3-or4-fragment recombination (12537-100), Invitrogen) under reaction, directly connecting 2 object fragments in carrier pB7RWG2 by once recombinating, obtaining pB1hor-Sh1.

By pB1hor-Sh1 through order-checking, the carrier that result obtains for the B1hordein promotor of sequence in sequence table 4 in the Sh1 expression casette shown in 5 ' end 28-3000 position Nucleotide and Sh1 gene coding region being connected into pB7RWG2 carrier (between attB1 and attB2 site) for this carrier.Wherein, Sh1 expression casette comprises the 35S terminator of sequence 4 on pB7RWG2 carrier framework shown in the B1hordein promotor shown in 5 ' end 28-567 position Nucleotide, the Sh1 gene coding region (aminoacid sequence of the albumen sucrose synthase of coding is sequence in sequence table 9) shown in the Nucleotide of 592-3000 position, 3727-3952 position Nucleotide in sequence table.

5）pHMW-GbssIIa

With wheat (Triticum astivum var.Chinese spring, be documented in as in Publication about Document: Johnson, J.W., Adult-plant resistance to powdery mildew in Knox62wheat, Cereal ResearchCommunications, Volume31, Issue3-4,2003, Pages281-288; The public can obtain from Northeast Normal University) genomic dna be template, with HMW-Glutenin promoter primers F and R for primer (sequence is in table 2), carry out pcr amplification, the PCR primer obtaining 426bp is HMW-Glutenin promotor;

With Maize leaf cDNA for template, with F and the R primer (sequence is in table 2) of GbssIIa, carry out pcr amplification, the PCR primer obtaining 1830bp is GbssIIa gene coding region.

The HMW-Glutenin promotor that above-mentioned amplification obtains is with attB1 and attB5r recombination site, and the GbssIIa gene coding region that above-mentioned amplification obtains is through attB5 and attB2 recombination site; By the GateWay recombination kit (Multisite that 2 provide in Invitrogen company with the sequence of recombination site pro Plus Kit for2-, 3-or4-fragmentrecombination (12537-100), Invitrogen) under reaction, directly connect 2 object fragments in carrier pB7RWG2 by a recombining reaction, obtain pHMW-GbssIIa.

By pHMW-GbssIIa through order-checking, result is the carrier of this carrier for the HMW-Glutenin promotor of sequence in sequence table 5 in GbssIIa expression casette shown in 5 ' end 28-2307 position Nucleotide and GbssIIa gene coding region insertion pB7RWG2 carrier (between attB1 and attB2 site) being obtained.GbssIIa expression casette comprises the 35S terminator on pB7RWG2 carrier framework shown in the HMW-Glutenin promotor shown in 5 ' end 28-453 position Nucleotide, GbssIIa gene coding region shown in the Nucleotide of 478-2307 position (protein grain of coding is sequence in sequence table 10 in conjunction with the aminoacid sequence of amylosynthease GbssIIa), 3034-3259 position Nucleotide of sequence 5 in sequence table.

Two, the acquisition of transgenic plant

1, particle bombardment obtains transgenic plant

Utilize the desk-top particle gun of PDS-1000 to carry out corn (H99, hereinafter also referred to wild-type corn) rataria transgeneic procedure, concrete steps are as follows:

1) material selection: according to pollination time, get the rataria of pollination latter 12 days corn H99 seeds, now maize immature embryos is about 1.8mm;

2) rinse mealie: add 1 Tween20, at clear underwater soaking, rinse 30min, then steep 30min with the ethanol of 75%, then use aseptic water washing three times;

3) preculture: will through 2) rataria after process, plumular axis is downward, shield towards upper, be placed on be covered with filter paper (2x2cm) containing in the culture dish of callus inducing medium N6E, 30 rataria/culture dish; Twine sealed membrane, be placed in incubator, 28 DEG C, light culture 3 days; Obtain rataria after preculture;

Callus inducing medium N6E is prepared as follows: in N6 minimum medium, add that final concentration is 2.76g/L proline(Pro), final concentration is 100mg/L inositol, final concentration is 2mg/L2,4-D, final concentration are 100mg/L caseinhydrolysate, final concentration is 25uM Silver Nitrate, final concentration is 30g/L sucrose and final concentration is 2.5g/L plant gel, supply volume with water, regulate Medium's PH Value to be 5.8.

The final concentration of the concrete component of N6 minimum medium and each component is as follows: ammonium sulfate 463mg/L, boric acid 1.6mg/L, Calcium Chloride Powder Anhydrous 125.33mg/L, two water disodium ethylene diamine tetraacetate 37.25mg/L, green vitriol 27.85mg/L, anhydrous magnesium sulfate 90.37mg/L, manganese sulfate monohydrate 3.3mg/L, potassiumiodide 0.8mg/L, saltpetre 2830mg/L, potassiumphosphate 400mg/L, Zinc Sulphate Heptahydrate 1.5mg/L, glycine 2mg/L, nicotinic acid 0.5mg/L, pyridoxine hydrochloride 0.5mg/L.

4) height oozes preculture:

Proceeded in the culture dish (diameter 3.5cm) containing N6OSM substratum by rataria after preculture (be namely shaped and the rataria expanded, think and start to form TypeII callus), 28 DEG C, light culture, carries out high osmotic treatment 8h; Obtain height and ooze rataria after preculture;

N6OSM culture medium prescription and final concentration specific as follows: N6 minimum medium, 0.69g/L proline(Pro), 100mg/L inositol, 2mg/L2,4-D, 100mg/L caseinhydrolysate, 36.4g/L sorbyl alcohol, 36.4g/L N.F,USP MANNITOL, 29mg/L Silver Nitrate, 30g/L sucrose, final concentration are 2.5g/L plant gel; Supply volume with water, regulate Medium's PH Value to be 5.8.

5) vehicle treated

During high osmotic treatment, sterilizing Holder and stop net, in bronze bullet, add the 5 μ l mixed carrier DNA that equimolar ratio is mixed in advance, mixing, is placed on after being ready on ice, obtains the bronze suspension having wrapped up plasmid.

The concentration of mixed carrier DNA is 1 μ g/ μ l, and the add-on of carrier is 5 μ g; The mass ratio that 0.5mg bronze wraps up 5 μ g mixed carrier DNA(bronzes and mixed carrier is 100:1).Mixed carrier DNA is 5 kinds of carriers pTRAuxBar, pGt1-Bt2, pISA-Sh2, pB1hor-Sh1 and pHMW-GbssIIa according to mol ratio 1:1:1:1:1 mixing.

6) by 4) height that obtains ooze preculture after rataria put into particle gun, drip 5 on a carrier film) the bronze suspension having wrapped up plasmid that obtains, particle gun vacuum tightness 27 ~ 28psi, can split film with 650psi and 1100psi and respectively bombard once, can split film to target spot distance: 6cm/9cm; Obtain bombarding rear rataria;

7) will bombard after rataria (on filter paper) on N6SOM substratum 28 DEG C again high ooze preculture 20h, adopt light culture, obtain bombarding rear high osmotic treatment rataria;

8) be transferred to by high osmotic treatment rataria after bombardment on the N6E substratum without filter paper and carry out Secondary Culture, Secondary Culture condition is 28 DEG C of light culture 14 days, obtains Secondary Culture rataria;

9) Secondary Culture rataria is transferred to screening and culturing on N6S substratum, screening and culturing condition is 28 DEG C of light culture 3 weeks/time, screens 3 times altogether, obtains callus (antiweed biolaphos).

N6S culture medium prescription is specific as follows: N6 minimum medium, 100mg/L inositol, 2mg/L2,4-D, 2mg/L Bialaphos, 6mg/L Silver Nitrate, 30g/L sucrose, 2.5g/L plant gel; Supply volume with water, regulate Medium's PH Value to be 5.8.

10) callus (is selected frangible TypeII callus, within diameter 4mm) transfer on induction substratum RMI and carry out differentiation culture, the condition of differentiation culture is 25 DEG C, light culture 3 weeks, obtains the callus (comprising the callus of over-ground part spire and underground part) with spire;

Induction substratum RMI specifically fills a prescription as follows: the two propylamine phosphine (Bialaphos) of MS minimum medium, 6-BA1mg/L, 100mg/L inositol, 3mg/L, 60g/L sucrose, final concentration are 3g/L plant gel; Supply volume with water, regulate Medium's PH Value to be 5.8.

MS minimum medium is specifically filled a prescription and is: saltpetre 1900mg/L, ammonium nitrate 1650mg/L, potassium primary phosphate 170mg/L, magnesium sulfate heptahydrate 370mg/L, Calcium dichloride dihydrate 440, potassiumiodide 0.83mg/L, boric acid 6.2mg/L, four water manganous sulfates

22.3mg/L, Zinc Sulphate Heptahydrate 8.6mg/L, Sodium Molybdate Dihydrate 0.25mg/L, cupric sulfate pentahydrate 0.025mg/L, CoCL2 6H2O 0.025mg/L, disodium ethylene diamine tetraacetate 37.25mg/L, iron vitriol 27.85mg/L, glycine

2mg/L, vitamin 0.1mg/L, pyridoxine hydrochloride 0.5mg/L, nicotinic acid 0.5mg/L; Volume is supplied with water.

11) callus with spire is transferred to root culture in RMII substratum, root culture condition is 25 DEG C of 16h light/8h light culture 15 days, and intensity of illumination is 4000lux, can grow seedling (namely obtaining transgenic plant);

RMII culture medium prescription is: MS minimum medium, 100mg/L inositol, 60g/L sucrose, final concentration are 3g/L plant gel; Supply volume with water, regulate Medium's PH Value to be 5.8.

12) treat that seedling grows to more than 3cm, when root system is complete, be transplanted to the dixie cup filling soil by seedling from RMII substratum, 25 DEG C, light is cultivated, and observes soil surface every day, waters after finish-drying; Can be transplanted in large basin when seedling in dixie cup grows to 25cm height, tear dixie cup, by soil and transplantation of seedlings falling flowerpot or experiment field, obtain 250 strain T0 for transgenic corns.

Being adopted to use the same method by empty carrier pB7RWG2 proceeds in wild-type corn, obtains turning empty carrier corn.

2, the qualification of transgenic corns

1), Gus staining examine reporter gene transient expression

In order to detect the optimum configurations in particle bombardment transgenosis, whether micropellet bombardment rataria is even, proceeded to an expression vector with transient expression gus gene.After rataria transforms, cultivate 1 ~ 2 day at incubator, carry out GUS dyeing.Concrete operation step is as follows:

(1) after the bombardment step 6) of above-mentioned 1 obtained, rataria immerses in 0.4% formaldehyde solution, 45min under room temperature;

(2) plant tissue is rinsed 3 times with the phosphate buffered saline buffer of 0.1M pH7.0;

(3) plant tissue is put into substrate working fluid, 3h (can spend the night) under 37 DEG C of states;

(4) background color is sloughed with the ethanol of 75%;

(5) blue spot of making plant tissue.

Prep solution is as follows:

A.0.2M phosphate buffered saline buffer, pH7.0:

Potassium primary phosphate KH ₂pO ₄(MW136.09) 22.22g/L

Dipotassium hydrogen phosphate K ₂hPO ₄(MW174.20) 34.84g/L

With 10N KOH, pH is adjusted to 7.0

B.0.1M phosphate buffered saline buffer (P-buffer), pH7.0:

By solution A and the mixing of distilled water equal-volume

C．10%Triton X-100：

10mL Triton X-100 is joined in distilled water to final volume 100mL.

D.38.8mM X-Gluc stock solution:

1g X-Gluc is dissolved in 49.4mL dimethyl sulfoxide (DMSO), uses centrifuge tube packing, 20 DEG C of storages.

E.50mM Tripotassium iron hexacyanide K ₃fe (CN) ₆(MW329.26):

By 16.464g K ₃fe (CN) ₆be dissolved in 1L distilled water.

F.50mM yellow prussiate of potash K ₄fe (CN) ₆(MW422.39):

By 21.12g K ₄fe (CN) ₆be dissolved in 1L distilled water

G．100mM EDTA(MW380)：

38g EDTA is dissolved in 1L distilled water

H. staining fluid, sees the following form 3:

Table 3 is GUS prescription of its dyeing liquor (volume: microlitre)

Result as shown in Figure 1, after having dyeed, is examined under a microscope, and result shows that the micro-bullet of particle bombardment transgenosis is evenly distributed, and changing effect is good.The particle gun significant parameter of Select to use is: can split film: 600psi/1100psi; Film can be split to target spot distance: 6cm/9cm.

2) detection of bar in transfer-gen plant

(1) herbicide test kit

In order to whether Preliminary detection transgenosis is successful, adopt envirologix company of U.S. test kit QuickStix ^tMkit for (bar) Cotton leaf & seed detects for transgenic corns the 250 strain T0 that Basta screens:

A. the blade of T0 for transgenic corns is clamped with the pipe lid of Disposable Tissue Extractor tube in test kit and pipe cap, take off the leaf tissue of one or two circle, push bottom tapered tube with the pestle carried in test kit by leaf tissue, the effective waterproof marking pen that sample is housed marks;

B. being inserted by pestle contains in organized pipe, by rotating pestle leaf tissue, continues 20 to 30 seconds, until leaf tissue mill is enough broken;

C. in pipe, 0.5mL Extraction Buffer is added;

D. blade smashed to pieces by continuation pestle rod, and the leaf tissue smashed to pieces and Extraction Buffer are fully mixed;

E. take out pestle rod, test strip is inserted in the Extraction Buffer and leaf tissue mixed and detects, wait for about one minute, observing response result.

Application test kit detects for transfer-gen plant the 250 strain T0 screened through Basta, and result as shown in Figure 2, test strip occurs two bands are for positive, only has an explanation to be negative; Obtain 193 strain bar gene masculine T0 for transgenic corns.

(2) the bar gene PCR of transfer-gen plant is analyzed

Whether successful in order to detect transgenosis further, mark bar gene design special primer according to herbicide screening.Primer

Sequence is: upstream primer P1:5'-GCACCATCGTCAACCACTACATC-3'

Downstream primer P2:5'-AGCTGCCAGAAACCCACGT-3'

With 193 strain bar gene masculine T0 for transgenic corns genomic dna for template, be that primer carries out pcr amplification with P1 and P2, obtain 433bp amplified production for positive, prove further to obtain 193 strain bar gene masculine T0 for transgenic corns.

3) Southern hybridization analysis

By above-mentioned 193 strain bar gene masculine T0 for transgenic corns sowing, sowing, until obtain T4 for transgenic corns, extract genomic dna.To turn empty carrier corn and wild-type corn (H99) for contrast.

(1) enzyme of corn gene group DNA is cut

Genomic dna (this tests restriction enzyme used all purchased from New England Biolabs company) is cut according to specification sheets enzyme: T4 is for transgenic corns genomic dna 30 μ g with EcoRI restriction enzyme, EcoRI Buffer5 μ l, EcoRI enzyme 1 μ l, 100 × BSA0.5 μ l, with deionized water mend to cumulative volume be 50 μ l.37 DEG C, enzyme cuts 8 hours.

(2) genomic dna transferring film

Digestion products is separated through 1% agarose gel electrophoresis (voltage is 1v/cm, 24h).Ultraviolet gel analysis instrument cuts the unnecessary glue of sample surrounding, but leaves the position of bromjophenol blue, cut in the upper right corner of glue the mark that " triangle " does front, write down the length and width of glue.Gel pre-treatment in the HCl of 0.125M is vibrated exactly 10min, and the color to bromophenol blue indicator is turned yellow by indigo plant, makes DNA depurination, outwells HCl, with distilled water rinsing 5 times, in order to avoid the NaOH of HCl and lower step neutralizes.With neutrality transfer liquid (10X SSC: sodium-chlor 1.5M, Trisodium Citrate 1.5M) with siphonage, DNA is transferred on Hybond N+ nylon membrane (Amersham), transfer is carried out UV-crosslinked after spending the night, then by film seasoning again after 2x SSC immersion 2-5min, normal temperature saves backup.

(3) probe preparation and mark

Probe is respectively the PCR primer of GbssIIa, Sh1, Sh2, Bt2 and bar gene C DS, and the primer needed for PCR primer of above-mentioned each gene C DS is identical with primer sequence during these genes of clone, refers to table 2.

The DIG DNA Labeling Kit test kit that the mark of probe uses Roche company to produce carries out: first, DNA sample (the 10ng-3 μ g of needs mark will be added, three uses can be divided) after general 1 μ g marks, 15 μ l are diluted to bi-distilled water, be placed in boiling water and make it complete sex change in about 10 minutes, then take out rapidly and be put on ice.Following reagent is added in the pipe that denatured DNA is housed:

Hexa nucleotide Mix,10× 2μl

dNTP Labeling Mix 2μl

Klenow enzyme labeling grade 1μl

Centrifugal after mixing, 37 DEG C of reaction 1-20h, different with the reaction times, not etc., concrete reference parameter is not as follows for reaction product output:

Table 4 probe mark output and efficiency

After having reacted, add 0.2M EDTA(pH8.0) 2 μ l termination reactions, or 65 DEG C of heating 10min termination reactions.The content of terminal crossing liquid middle probe is be less than 25ng in every ml.

(4) Southern hybridization

First carry out prehybridization, prehybridization solution (10g/L BSA) is melted, pours in hybrid pipe, 42 DEG C of prehybridizations.New film was more preferably greater than 4 hours.Hybridization solution [the Liquid block(test kit of 5 × SSC, 0.1% (w/v) SDS, 5% T 500,1/20 volume provides)] the sex change 10min in boiling water of probe (probe is respectively the PCR primer of GbssIIa, Sh1, Sh2, Bt2 and bar gene C DS) will be mixed with, be placed on rapidly on ice, prehybridization solution is poured out, probe is joined in the pipe that prehybridization crosses, 42 DEG C of hybridized overnight.Next day wash-out: poured out by probe, add elutriant I [1 × SSC, 0.1%(W/V) SDS], 65 DEG C of reaction 15min, repeat this step once.Then elutriant II(0.5 × SSC, 0.1%(W/V is added) SDS), 65 DEG C of reactions twice, each 20min.

The detection of hybridization signal and the removal of hybridization signal:

Under normal temperature, the nylon membrane of hybridizing is put into appropriate Washing buffer, shaken at room temperature 1-5 minute.Film is put into appropriate Blocking solution, in hybrid pipe, react twice, 30min/ time.Blockingsolution in pipe is discarded, pours in appropriate Antibody solution, reaction 0.5-1h.Discard Antibody solution, film is put into appropriate Washing buffer rinsing 2 times, each 15min.Washing buffer on film is discarded, film is put into appropriate Detection buffer 2-5 minute.Hybond membrane is placed on a clean preservative film, and make to face up with one of DNA, appropriate detection liquid (being generally 1ml CSPD solution) is dropped on preservative film equably along film side, making detection liquid be uniformly distributed film front by pulling preservative film four limit, then leaving standstill 2-5min.Reclaim unnecessary CSPD solution.The Hybond membrane be painted with is placed in 37 DEG C of reactions 15 minutes, to strengthen luminous reaction, by exposed for the film placement that faces up.Attention: during this reaction process exposes, film is in moistening air, film absolutely not can be dry.Film is faced up, is put in magazine.Be pressed on film by exograph in darkroom, room temperature exposes carries out compressing tablet in more than 30 minutes, then develops to X-ray, stops shadow and fixing.

Wash away the probe on Hybond membrane: first in distilled water, rinse the Hybond membrane of hybridizing, then use 0.1%SDS, 0.2M NaOH is rinsing twice in 37 DEG C, each 15 minutes, then uses 2 × SSC rinsing 5 minutes, and preservative film is wrapped, preserve in order to hybridization next time for-20 DEG C.

As shown in Figure 3, A is that careless fourth phosphine resistant gene (Bar) coding region is probe to Southern blot result, B is that ADP-glucose pyrophosphorylase small ylidene gene (Bt2) coding region is probe, C is that the large subunit gene of ADP-glucose pyrophosphorylase (Sh2) coding region is probe, D is that granule bound starch synthetase II a gene (GbssIIa) coding region is probe, E be sucrose synthase gene (Sh1) coding region is probe; The P31-4-2 of each figure swimming lane 1-4 is T4 for transgenic corns; Can find out, wild-type corn (H99) is to bar gene probe amixia signal, and T4 has obvious bar gene probe hybridization signal for transgenic corns; Wild-type H99 all has obvious hybridization signal to the detection probes of other 4 genes, but the number of signal is less than T4 for transgenic corns, illustrate that probe signals on wild-type H99 should from native gene, and T4 for probe signals newly-increased in transgenic corns namely from the foreign gene proceeded to; 193 positive strain T0 are accredited as in transgenic corns at antiweed and bar gene PCR, by identifying the southern blot in its T4 generation, it is that 5 genes all proceed to that confirmation has 87 T4 for transgenic corns strain, copy number is less, transformation efficiency is 45.08%, and after being identified for transgenic corns strain called after Southern blot by these 87 T4, positive T4 is for transgenic corns.Can find out, adopt method of the present invention to carry out 5 gene cotransformations, obtain the coexpression transgenic plant of high conversion efficiency.

4) real-time fluorescence quantitative RT-PCR

After being identified by above-mentioned 87 Southern blot, positive T4 extracts RNA respectively for the endosperm of transgenic corns, reverse transcription obtains cDNA as template, carry out Real-Time PCR respectively with following primer pair, detect 5 genes and identify that rear positive T4 is for the expression in transgenic corns at Southern blot.To turn empty carrier corn and wild-type corn (H99) for contrast.

The primer of the RT-PCR of GbssIIa is 5'-AGATAAGGGTGTTGAGTTGGATGG and 5'-TCGAGACGCCCGACGAA;

The primer of the RT-PCR of Sh1 is 5'-ATGCCTCCTTTCCTCGTCCT and 5'-ATCATCGTCGTGCCCTTGTAG;

The primer of the RT-PCR of Sh2 is 5'-TTGGCCCTCACTGAGCAGC and 5'-CACGGAGTCCTTGAGTTCACATC;

The primer of the RT-PCR of Bt2 is 5'-CTGTGCAGCTAAGACTTCAACAAAC and 5'-CTGTGCAGCTAAGACTTCAACAAAC;

The primer of the RT-PCR of bar is 5'-GGCACGCAACGCCTACGACT and 5'-AGCCCGATGACAGCGACCAC;

Internal reference is corn actin1 gene, and primer is 5'-CCTGAAGATCACCCTGTGCT and 5'-GCAGTCTCCAGCTCCTGTTC.

Result as shown in Figure 4, A is ADP-glucose pyrophosphorylase small subunit (Bt2) gene expression dose, B is the large subunit gene of ADP-glucose pyrophosphorylase (Sh2) expression level, C is granule bound starch synthetase II a gene (GbssIIa) expression level, D is sucrose synthase gene (Sh1) expression level, and E is Bar gene expression dose; 1-1-1,1-1-2,1-1-3,1-1-4,1-1-5,1-1-6,1-4-1,1-4-2,1-4-3,1-4-4,1-4-5,1-4-6,2-5-1,2-5-2,2-5-3,2-5-4,2-5-5,2-5-6,2-8-1,2-8-2,2-8-3,2-8-4,2-8-5,2-8-6 are that the rear positive T4 of Southern qualification is for transgenic corns; Compared with wild-type corn H99, totally 28 strains that after 87 strain Southern identify, positive T4 all improves for the expression amount of 5 genes of transgenic corns, after accounting for Southern qualification positive 32.18%.Explanation has 28 strain, 5 gene co-expressing T4 for transgenic corns.

The possible cause that above-mentioned transformation efficiency is high: (1) uses various carrier all with the mixing of equimolar ratio example, the frequency simultaneously proceeding to 4 kinds of other foreign genes in Herbicid resistant plant is significantly improved, and other polygene cotransformation such as Zhu uses the carrier ratio of 3:1, Bar genophore ratio height of the present invention; (2) use less plasmid vector for transforming, often criticizing when bullet prepared by bronze uses 5 μ g mixing plasmid DNA(to be less than the 10-20 μ g of general experimental program), the transfer-gen plant of the low copy of easy acquisition, makes exogenous gene expression efficiency higher, avoids transgene silencing; (3) use and highly ooze substratum pre-treatment rataria time lengthening to 8 hour, the transformation efficiency after biolistic bombardment rataria is significantly improved; (4) use the culture system optimized, the culture medium prescription comprising each step all through optimization, makes plant regeneration frequency, transgenic positive plant frequency all significantly improves than prior art.

Turn empty carrier corn and wild-type corn (H99) result without significant difference.

5) the genetically modified insertion point of reverse pcr analysis

Reverse PCR method is used to analyze genetically modified insertion point.The genomic dna of 28 strain, 5 gene co-expressing T4 for the different strain of transgenic corns is cut with different restriction enzymes, object is on genomic dna, produce short-movie section, but does not have cleavage site for having on the promotor of function, gene order and terminator of proceeding to.

The restriction endonuclease detected needed for pTRAuxBar carrier is EcoRV, and required amplimer is as follows;

pG-G1-F1：TTCCTAAAACCAAAATCCAGTG，

pG-G1-R1：AGACATGCAATGCTCATTATCT；

The restriction endonuclease detected needed for carrier pGt1-Bt2 is restriction endonuclease BamHI, and required amplimer is as follows;

pG-G1-F1：TCTGCTTCCCTCAACCGTCAC，

pG-G1-R1：CGCCACCACATTCACATCCA；

The restriction endonuclease detected needed for carrier pISA-Sh2 is XhoI, and required amplimer is as follows;

25-G2-F2：GGCGTTCCGGGTTTCTGG，

22-G2-R2：TGGAGCATAGACGACA；

The restriction endonuclease detected needed for carrier pB1hor-Sh1 is AseI, and required amplimer is as follows;

28-G9-F1：CCGAGAATGAACGCCAAGAG，

28-G9-R1：CGAACCCAGTGGACATAAGC；

The restriction endonuclease detected needed for carrier pHMW-GbssIIa is restriction endonuclease AseI, and required amplimer is as follows;

29-G10-F1：TTACACTTTTCTTATTTCAGCCA，

29-G10-R1：CGTCAATTTGTTTACACCACA；

Detailed process is as follows:

(1) extracting genomic dna from 5 gene co-expressing T4 respectively for the different individual plants of transgenic corns, cutting 1 μ g respectively with detecting the restriction endonuclease of different carriers, it is as follows that enzyme cuts system:

Enzyme cuts 4hr ~ spend the night, and obtains enzyme and cuts rear DNA.

Note: if need to cut more genomic dna, then system wants proportional expansion.

(2) cyclisation is connected:

Room temperature is placed 2hr or 16 DEG C and is spent the night, and obtains connecting product.

(3) purifying connects product: with alcohol settling or mistake column purification, heavy molten DNA, in 50 μ l water, obtains purifying and connects product.

(4) with above-mentioned connection product for template, increase with amplimer;

PCR system:

1X: 95℃ 5min.

35X: 95℃ 30 sec.，55℃ 1min.，72℃ 2.5min.

1X: 72℃ 10min.

(5) different PCR primer is sent to order-checking, determine insertion point.

Partial results is as shown in table 5:

Table 5 is foreign gene insertion point in transgenic corns genome

Can find out, the insertion point of expression cassette can be identified.

Three, the Function Identification of transgenic plant

Get 5 gene co-expressing T4 for the strain P31-4-2 of two in transgenic corns, P31-11-5; By these two strains through backcrossing, male parent is respectively these two 5 gene co-expressing T4 for transgenic corns, and female parent is wild-type corn (H99); By backcrossing, the seed produced carries out starch content detection.With wild-type corn (H99) for contrast.

Total starch content measures and selects perchloric acid method, and amylose content determination selects National Standard Method (GB5006-1985).

Perchloric acid method is specific as follows:

1) Crude starch obtains

Random choose 5 from each strain corn seed, boiling water boiling sloughs seed coat in 3 minutes, is dried to constant weight by endosperm after removing embryo in 50 DEG C; Pulverize with the endosperm of mortar by oven dry, cross 80 mesh sieves, namely obtain Crude starch.

2) soluble sugar is sloughed

(1) 5O mg1 is taken) Crude starch that obtains, pour in 7.5ml test tube, add 4ml50% ethanol, 8O DEG C of water-bath 40min, therebetween continuous stirring and evenly mixing;

(2) the centrifugal l0min of 5000rpm, cleer and peaceful precipitation in collection;

(3) in precipitation, add 2ml80% ethanol, repeat extracting 2 times, merge supernatant liquor, collect residue.

3), the mensuration of Crude starch content

(1) by above-mentioned 2) (3) residue of obtaining 50 DEG C of oven dry, then add 3ml ddH ₂o, mixing, stir, boiling water bath 15min, adds 2ml perchloric acid (72%) after cooling, and the centrifugal 5min of 15min, l000Orpm is extracted in concussion, gets supernatant liquor and adds in 1Oml pipe, collecting precipitation;

(2) 2ml perchloric acid (72%) is added in the precipitation obtained toward above-mentioned (1), repeat extracting once, (this time the centrifugal rear insolubles of extracting is suspended substance, floats on liquid level to merge supernatant, easy fragmentation, is very careful when drawing supernatant);

(3) get 0.5ml supernatant liquor and be diluted to 10ml, therefrom draw 0.5ml liquid, add 5ml anthrone reagent (0.2g anthrone, is dissolved in 5ml ethanol, with 75% sulfuric acid constant volume in 100ml volumetric flask), boiling water bath 2min, measure OD ₆₂₀the absorbance value of nm;

Starch content calculation formula: starch content %=G*O.9/DW*100%

G representative sample is in the absorbance at 620nm place; DW represents dry seed weight.

Result as shown in Figure 5, the total starch content of wild-type corn H99 is 65.05%, 5 gene co-expressing T4 are 75.41%, 5 gene co-expressing T4 for the total starch content of transgenic corns P31-11-5 for the total starch content of transgenic corns P31-4-2 is 75.96%; The amylose content of wild-type corn H99 is 29.27%, 5 gene co-expressing T4 be 30.17%, 5 gene co-expressing T4 for transgenic corns P31-4-2 amylose content is 28.35% for transgenic corns P31-11-5 amylose content.

Can find out, the total starch content of polygene cotransformation transgenic corns comparatively wild-type corn increases all to some extent, and amylose content does not obviously change.

Turn empty carrier corn and wild-type corn (H99) result without significant difference.

In this research cotransformation 4 Starch-synthesizing genes in, Sh1 and GbssIIa has no report in corn gene, in transfer-gen plant endosperm starch content detection, their starch content significantly improves, and illustrates that these gene actings in conjunction make total starch content higher than the content of report.

Compared with the existing methods: (the Li such as Li Ning, N., S.Zhang, et al. (2011). " Over-expression ofAGPase genes enhances seed weight and starch content in transgenic maize. " Planta233 (2): 241-250.) from corn embryosperm cDNA, large small ylidene gene Sh2 and Bt2 of corn AGPase is cloned by the method for RT-PCR, corn embryosperm specificity promoter is selected to start Sh2 and Bt2 genetic expression, take herbicide resistance gene as selective marker, construct Sh2, the process LAN plant vector of Bt2 single-gene process LAN plant vector and the two series connection, agriculture bacillus mediated maize bud point genetic transforming method is adopted target gene on three kinds of carriers to be proceeded to respectively the prosperous 7-2 of Elite Maize Inbred Lines and tuck in 478, total starch content reaches 74%, amylose starch ratio is 23%, the parent used in the research such as Li Ning belongs to different blood lineages from the parent material used in this patent, the hybrid vigour that they produce from other self-mating system assembly is different, and material itself is the kind of high-content of starch, the H99 parent that the present invention uses belongs to low starch content kind, transgenic line of the present invention starch content compared with parent improves about 10%.

Claims (6)

1. cultivating a method for transgenic plant, is following 1) or 2):

1) for import in object plant altogether by ADP-glucose pyrophosphorylase small ylidene gene, the large subunit gene of ADP-glucose pyrophosphorylase, sucrose synthase gene and Granule-Bound Starch Synthase gene, transgenic plant are obtained; The total starch content of described Transgenic plant tissue is higher than described object plant;

2) for import in object plant altogether by selection markers protein gene, ADP-glucose pyrophosphorylase small ylidene gene, the large subunit gene of ADP-glucose pyrophosphorylase, sucrose synthase gene and Granule-Bound Starch Synthase gene, transgenic plant are obtained; The total starch content of described Transgenic plant tissue is higher than described object plant;

Described selection markers albumen is PPT, and its aminoacid sequence is sequence 6 in sequence table;

Described ADP-glucose pyrophosphorylase small subunit is Bt2, and its aminoacid sequence is sequence 7 in sequence table;

The large subunit of described ADP-glucose pyrophosphorylase is Sh2, and its aminoacid sequence is sequence 8 in sequence table;

Described sucrose synthase is Sh1, and its aminoacid sequence is sequence 9 in sequence table;

Described Granule-Bound Starch Synthase is GBSSIIa, and its aminoacid sequence is sequence 10 in sequence table;

Described selection markers protein gene is Bar;

Described ADP-glucose pyrophosphorylase small ylidene gene is Bt2;

The large subunit gene of described ADP-glucose pyrophosphorylase is Sh2;

Described sucrose synthase gene is Sh1;

Described Granule-Bound Starch Synthase gene is GbssIIa;

Described selection markers protein gene imports in object plant by recombinant expression vector pTRAuxBar; Described recombinant expression vector pTRAuxBar is the recombinant vectors containing Bar expression casette; Described Bar expression casette specifically comprises Ubi promotor, Bar gene and no terminator;

Described ADP-glucose pyrophosphorylase small ylidene gene imports in object plant by recombinant expression vector pGt1-Bt2; Described recombinant expression vector pGt1-Bt2 is the recombinant vectors containing Bt2 expression casette; Described Bt2 expression casette specifically comprises Gt1 promotor, Bt2 gene and 35S terminator;

The large subunit gene of described ADP-glucose pyrophosphorylase imports in object plant by recombinant expression vector pISA-Sh2; Described recombinant expression vector pISA-Sh2 is the recombinant vectors containing Sh2 expression casette; Described Sh2 expression casette specifically comprises ISA promotor, Sh2 gene and 35S terminator;

Described sucrose synthase gene imports in object plant by recombinant expression vector pB1hor-Sh1; Described recombinant expression vector pB1hor-Sh1 is the recombinant vectors containing Sh1 expression casette; Described Sh1 expression casette specifically comprises B1hordein promotor, Sh1 gene and 35S terminator;

Described Granule-Bound Starch Synthase gene imports in object plant by recombinant expression vector pHMW-GbssIIa; Described recombinant expression vector pHMW-GbssIIa is the recombinant vectors containing GbssIIa expression casette; Described GbssIIa expression casette specifically comprises HMW-Glutenin promotor, GbssIIa gene and 35S terminator;

Described plant is corn.

2. method according to claim 1, is characterized in that:

The nucleotides sequence of described selection markers protein gene Bar to be classified as in sequence table sequence 1 from 5 ' end 2036-2584 position Nucleotide;

The nucleotides sequence of described ADP-glucose pyrophosphorylase small ylidene gene Bt2 to be classified as in sequence table sequence 2 from 5 ' end 1935-3362 position Nucleotide;

The nucleotides sequence of the large subunit gene Sh2 of described ADP-glucose pyrophosphorylase to be classified as in sequence table sequence 3 from 5 ' end 1085-2635 position Nucleotide;

The nucleotides sequence of described sucrose synthase gene Sh1 to be classified as in sequence table sequence 4 from 5 ' end 592-3000 position Nucleotide;

The nucleotides sequence of described Granule-Bound Starch Synthase gene GbssIIa to be classified as in sequence table sequence 5 from 5 ' end 478-2307 position Nucleotide.

3. enter a method for multiple goal gene to corotation in object plant, comprise the steps:

1) mixed carrier and transgene receptor is prepared respectively: described mixed carrier is made up of multiple recombinant expression vectors of equimolar ratio;

Each described recombinant expression vector contains the carrier of a corresponding described goal gene; Described transgene receptor is prepared as follows:

A, the explant of object plant is carried out preculture, obtain explant after preculture;

B, explant after described preculture is carried out height ooze preculture, obtain height and ooze explant after preculture, be transgene receptor;

2) by described mixed carrier bag by bronze, then to be imported in described transgene receptor by particle gun, obtain bombarding rear explant;

3) explant after described bombardment is carried out Secondary Culture, screening and culturing, differentiation culture and root culture successively, namely obtain transgenic plant, realize corotation in object plant and enter multiple goal gene;

Described multiple goal gene is selection markers protein gene Bar according to claim 2, ADP-glucose pyrophosphorylase small ylidene gene Bt2, the large subunit gene Sh2 of ADP-glucose pyrophosphorylase, sucrose synthase gene Sh1 and Granule-Bound Starch Synthase gene GbssIIa totally 5 genes;

Described multiple recombinant expression vector is pTRAuxBar, pGt1-Bt2, pISA-Sh2, pB1hor-Sh1 and pHMW-GbssIIa totally 5 recombinant expression vectors;

Described recombinant expression vector pTRAuxBar is the recombinant vectors containing Bar expression casette;

Described recombinant expression vector pGt1-Bt2 is the recombinant vectors containing Bt2 expression casette;

Described recombinant expression vector pISA-Sh2 is the recombinant vectors containing Sh2 expression casette;

Described recombinant expression vector pB1hor-Sh1 is the recombinant vectors containing Sh1 expression casette;

Described recombinant expression vector pHMW-GbssIIa is the recombinant vectors containing GbssIIa expression casette;

Described Bar expression casette specifically comprises Ubi promotor, Bar gene and no terminator;

Described Bt2 expression casette specifically comprises Gt1 promotor, Bt2 gene and 35S terminator;

Described Sh2 expression casette specifically comprises ISA promotor, Sh2 gene and 35S terminator;

Described Sh1 expression casette specifically comprises B1hordein promotor, Sh1 gene and 35S terminator;

Described GbssIIa expression casette specifically comprises HMW-Glutenin promotor, GbssIIa gene and 35S terminator;

Described plant is corn.

4. method according to claim 3, it is characterized in that: step 1) in, the substratum that described preculture adopts is callus inducing medium N6E, described callus inducing medium N6E is prepared as follows: in N6 minimum medium, add that final concentration is 2.76g/L proline(Pro), final concentration is 100mg/L inositol, final concentration is 2mg/L2,4-D, final concentration are 100mg/L caseinhydrolysate, final concentration is 25uM Silver Nitrate, final concentration is 30g/L sucrose and final concentration is 2.5g/L plant gel, supply volume with water;

The substratum that described height oozes preculture employing is N6OSM substratum, described N6OSM substratum is prepared as follows: in N6 minimum medium, add that final concentration is 0.69g/L proline(Pro), final concentration is 100mg/L inositol, final concentration is 2mg/L2,4-D, final concentration are 100mg/L caseinhydrolysate, final concentration is 36.4g/L sorbyl alcohol, final concentration is 36.4g/L N.F,USP MANNITOL, final concentration is 29mg/L Silver Nitrate, final concentration is 30g/L sucrose and final concentration is 2.5g/L plant gel, supply volume with water;

Step 2) in, the mass ratio of described bronze and described mixed carrier is 20:1-500:1;

Step 3) in, described Secondary Culture, for explant after described bombardment is carried out Secondary Culture, obtains Secondary Culture explant;

The substratum that described Secondary Culture adopts is described callus inducing medium N6E;

Described screening and culturing, for described Secondary Culture explant is carried out screening and culturing, obtains callus;

The substratum that described screening and culturing adopts is N6S substratum; Described N6S substratum is prepared as follows: in N6 minimum medium, add that final concentration is 100mg/L inositol, final concentration is 2mg/L2,4-D, final concentration are the two propylamine phosphine of 2mg/L, final concentration is 6mg/L Silver Nitrate, final concentration be 30g/L sucrose and final concentration is 2.5g/L plant gel, supply volume with water;

Described differentiation culture, for described callus is carried out differentiation culture, obtains the callus with spire;

The substratum that described differentiation culture adopts is RMI substratum; Described RMI substratum is prepared as follows: in MS minimum medium, add that final concentration is 100mg/L inositol, final concentration is 3mg/L Bialaphos, final concentration is 60g/L sucrose and final concentration is 3g/L plant gel, supplies volume with water;

Described root culture is that the described callus with spire is carried out root culture, namely obtains transgenic plant;

The substratum that described root culture adopts is RMII substratum; Described RMII substratum is prepared as follows: in MS minimum medium, add that final concentration is 100mg/L inositol, final concentration is 60g/L sucrose and final concentration is 3g/L plant gel, supplies volume with water.

5. the method according to claim 3 or 4, is characterized in that:

Step 1) in, described pre-incubated condition is 25-28 DEG C, light culture 1-3 days;

It is 25-28 DEG C, light culture 4-10h that described height oozes pre-incubated condition;

Step 3) in, the condition of described Secondary Culture is 25-28 DEG C of light culture 14-21 days;

The condition of described screening and culturing is 25-28 DEG C of light culture 2-3 week each time, and described screening number of times is 3-6 time;

The condition of described differentiation culture is 23-25 DEG C, light culture 1-3 week;

The condition of described root culture is 22-25 DEG C, 16h light/8h light culture 15 days, intensity of illumination are 4000-8000lux;

In step 2) and step 3) between also comprise the steps: explant after described bombardment to ooze preculture through again high; Described again high to ooze the substratum that preculture adopts be N6SOM substratum, and described again high to ooze pre-incubated condition be 25-28 DEG C of light culture 12-24h;

Described object plant is pollination latter 12 days plants.

6. method according to claim 5, is characterized in that:

Described pre-incubated condition is specially 28 DEG C, light culture 3 days;

Described height oozes pre-incubated condition and is specially 28 DEG C, light culture 8h;

The condition of described Secondary Culture is specially 28 DEG C of light culture 14 days;

The condition of described screening and culturing is specially 28 DEG C of light culture 3 weeks each time, and described screening number of times is 3 times;

The condition of described differentiation culture is specially 25 DEG C, light culture 3 weeks;

The condition of described root culture is specially 25 DEG C, intensity of illumination is 4000lux;

Describedly again highly ooze pre-incubated condition and be specially 28 DEG C again high and ooze preculture 20h.