CN1210145A

CN1210145A - Engineering bacteria for epidermal growth factor and preparation of epidermal growth factor by using this bacteria

Info

Publication number: CN1210145A
Application number: CN 97115284
Authority: CN
Inventors: 黄秉仁
Original assignee: Institute of Basic Medical Sciences of CAMS
Current assignee: Institute of Basic Medical Sciences of CAMS
Priority date: 1997-08-29
Filing date: 1997-08-29
Publication date: 1999-03-10
Anticipated expiration: 2017-08-29
Also published as: CN1138856C

Abstract

An engineering bacterium for preparing epidermal growth factor is a methyl nutrition type yeast cell, which cotains at least one gene sequence of human epidermal growth factor, which is copied and can encode 51 amino acids. It features that the gene sequence has a 5' end connected by one a-factor leading peptide, and a kozak sequence is combined before the DNA sequence of a-factor leading peptide and then cloned to downstream of alcohol oxidase promoter to build-up a condordant sequence able to express mono-copy human epidermal growth factor.

Description

Epdermal growth favtur (hEGF) engineering bacteria and use this bacterium to prepare the method for Urogastron

The present invention relates to employed novel recombinant plasmid in a kind of preparation epidermal growth factor subprocess, and adopt this plasmid to transform the genetic engineering bacterial strain that generates, particularly relate to the improved preparation method of Urogastron (EGF).

Urogastron be a kind of submaxillary gland of finding the sixties mouse exist have only 53 amino acid whose polypeptide, have the effect that stimulates cellular proliferation widely.From people's urine, extracted the analogue human epidermal growth factor in 1975, but its gastric acid inhibitory secretion is so claim gastrone again.EGF can stimulate the propagation of various kinds of cell, mainly is the propagation of endothelium and epidermic cell, thereby the possibility that is applied to corneal wound, skin burn, gastroenteritic ulcer treatment is arranged.Recombinant human epidermal growth factor has begun to be used for the clinical experiment of above-mentioned disease by experimentation on animals.Owing to Urogastron has the effect of neurotransmitter and finds to have effect (the Harvey Bialy.Epidermal Growth Factor:Anti-Tumoral Too .Bio/technology.September 1988 that suppresses tumor cell proliferation again as a kind of braingut petide; 6:997), its Its Mechanisms prospect of in addition can be used for clinical applications such as skin burn, keratohelcosis makes the research of EGF and acceptor thereof become one of biochemical research focus in recent years.

Human epidermal growth factor gene can be synthetic with chemical method, (the TakanoriOka in the intestinal bacteria system is all arranged both at home and abroad, et al., Synthesis and secretion of human epidermal growth factorby Escherichia coli.Biochemistry 1985; 82:7212-7216) or Yeast system express successful report (Carlos George-Nascimento, et al., Characterization ofrecombinant Human Epidermal Growth Factor produced in yeast.Biochemistry.1988; 27:797-802).

U.S. Chiron company in 1984 has reported the material chamber of testing that application α-factor promotor and leading peptide express secretion property EGF in the cereuisiae fermentum system, expression output is 4.6mg/L (Anthony J.Brake, et al. α-Factor-directed synthesis and secrection of mature foreign protein inSaccharomyces cerevisiae.Proc.Natl.Acad.Sci.USA 1984; 814642-4646).

Philips Research Center in 1991, Bartlesville, OK, 74004, the USA report is used the AOX promotor, whole and the type expression plasmid of 19 copies in Yeast Pichia pastoris system the secretion expression mouse EGF, expression amount is 450mg/L (Jeffrey J.Clare.et al., Production of mouthepidermal growth factor in yeast:high-level secretion using Pichia pastorisstrains containing m μ ltiple gene copies.Gene 105:205-212).

United States Patent (USP) 5,102 in 1992, and 789 disclose a kind of methylotrophic yeast (Yeast Pichiapastoris) system of utilizing prepares the human epidermal growth factor.The human epidermal growth factor's who reports in the literary composition expression output can reach 600mg/L.

Be the genetic engineering bacterial strain that overcomes the deficiencies in the prior art, the object of the present invention is to provide employed novel plasmid in a kind of novel preparation Urogastron and adopt this plasmid to make, another object of the present invention is to adopt described genetic engineering bacterial strain to use improving one's methods of the present invention, improve and express output, favourable Application and Development.

The inventor has manually synthesized coding 51 amino acid whose hEGFs (hEGF) gene; Using on α-factor promoter acquisition EGF expression basis; Use again strong promoter-alcohol dehydrogenase (ADH) promoter in the brewer's yeast system, to express the hEGF; Rear for obtaining more to efficiently express and select methylotrophic yeast (Yeast Pichia pastoris) system; Wherein, 51：1 2 3 4 5 6 7 8 9 10 11 12 13 14 15Asn Ser Asp Ser Glu Cys Pro Leu Ser His Asp Gly Tyr Cys LeuAAC TCC GAC TCC GAA TGT CCA TTG TCC CAC GAC GGT TAC TGT TTGTTG AGG CTG AGG CTT ACA GGT AAC AGG GTG CTG CCA ATG ACA AAC16 17 18 19 20 21 22 23 24 25 26 27 28 29 30His Asp Gly Val Cys Met Tyr Ile Glu Ala Leu Asp Lys Tyr AlaCAC GAC GGT GTT TGT ATG TAC ATC GAA GCT TTG GAC AAG TAC GCCGTG CTG CCA CAA ACA TAC ATG TAG CTT CGA AAC CTG TTC ATG CGG31 32 33 34 35 36 37 38 39 40 41 42 43 44 45Cys Asp Cys Val Val Gly Tyr Ile Gly Glu Arg Cys Glu Tyr ArgTGT AAC TGT GTT GTT GGT TAC ATC GGT GAA AGA TGT CAA TAC AGAACA TTG ACA CAA CAA CCA ATG TAG CCA CTT TCT ACA GTT ATG TCT46 47 48 49 50 51Asp Leu Lys Trp Trp Glu stop code 1-2, EcoRⅠGAC TTG AAG TGG TGG GAA TAA TGA GAATTCCTG AAC TTC ACC ACC ATT ATT ACT CTTAAG

Methylotrophic yeast is a kind of high-density culture that is easy to, the novel gene engineering host bacterium of efficiently expressing exogenous gene and the similar mammalian cell of expressing protein glycosylation, and the utmost point has development prospect.

The present invention includes by yeast and have a liking for codon chemosynthesis human epidermal growth factor gene, the human epidermal growth factor gene of chemosynthesis and the dna fragmentation of coding yeast α-factor leading peptide are merged, through before the alpha factor leading peptide, adding the Kozak order, be cloned into alcohol oxidase promotor downstream again to be built into integrated single copy EGF expression vector;

With this carrier is the expression vector that the basis has made up integrated three copy EGF again;

This carrier filters out integrated Mut after transforming methylotrophic yeast strain GS115 ^sGenotype strain (GS115-3EGF);

This strain can be secreted the human epidermal growth factor behind high-density culture and the abduction delivering.

In addition, the human epidermal growth factor gene of chemosynthesis of the present invention contains 51 aminoacid sequences, is connected with two terminator TAA and TGA at the 51st amino acid whose end.This design helps the separation and purification of human epidermal growth factor gene expression product and the termination that human epidermal growth factor gene is transcribed.And being incorporated as of Kozak order efficiently expresses the human epidermal growth factor and provides the foundation.

Use the AOX promotor, whole and the type expression plasmid of α-factor leading peptide-EGF gene expression frame that contains 3 copies in Yeast Pichia pastoris system the secretion expression people EGF, expression amount is 300mg/L, can reach the output of 900mg/L by technological transformations such as high density fermentations.Promptly express the difference that output reaches according to high-density culture and can reach 300-900mg/L, purification purity can reach 95% or higher, the protein product of purifying after testing, the result shows that it is a high purity, no thermal source, no intracellular toxin, no methylotrophic yeast chromosomal DNA pollute, correct molecular weight is arranged, have identical iso-electric point, amino terminal amino acid order, UV spectrum with natural EGF albumen, and intact biologic activity character has a recombinant protein that can repeat peptide figure.

The called after GS115-3EGF genetic engineering bacterial strain that uses among the present invention is deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) on August 25th, 1997, and its preserving number is 0320.

Brief Description Of Drawings:

Fig. 1: the design of graphics of recombinant plasmid pUC19-EGF51;

Fig. 2: the enzyme of recombinant plasmid pUC19-EGF51 is cut evaluation figure, i.e. recombinant plasmid pUC19-EGF51

The restriction enzyme digestion and electrophoresis collection of illustrative plates;

Fig. 3: the fluorescence sequencer map of recombinant plasmid pUC19-EGF51;

Fig. 4: the nucleotide sequence of the hEGF gene of synthetic and corresponding amino-acid sequence figure;

Fig. 5: recombinant clone pUC19-α EGF design of graphics;

The nucleotide sequence at Fig. 6: α-factor leading peptide and EGF coded sequence fusion gene and position of fusion place is measured

Figure;

Fig. 7: alpha factor leading peptide and EGF coded sequence position of fusion place nucleotide sequence;

Fig. 8: the design of graphics of recombinant plasmid pUC19-K α EGF51 and pA0815 EGF51;

Fig. 9: the plasmid pA0815 physical map (explanation of pA0815: 7709 Nucleotide; 5 ' A0X1 promoter fragment: base 1-940; 5 ' A0X1 primer sites: base 855-875; EcoR1 site: base 943-948; 3 ' A0X1 primer sites: base 1024-1044; 3 ' AOX1 transcription pausing (TT): base 950-1277; HIS4 ORF: base 4199-1665; 3 ' AOX1 fragment: base 4554-5310; Co1E1 is initial: base 6394-5740; Ampicillin resistance gene: base 7399-6539);

Figure 10: recombinant plasmid pAO815-EGF51 restriction enzyme mapping;

Figure 11: recombinant plasmid pAO815-3EGF51 design of graphics;

Figure 12: reorganization pAO815-3EGF51 enzyme is cut the evaluation collection of illustrative plates;

Figure 13: Mut ⁺And Mut ^sThe contrast of transformant;

Phase collection of illustrative plates (0～144 hour) when Figure 14: EGF expresses;

Figure 15: EGF EC50 detects figure;

Figure 16: the 50th generation engineering bacteria the GS115-3EGF chromosomal DNA in the pcr amplification electrophoresis of EGF gene

Figure;

Figure 17: the 50th generation engineering bacteria the SDS-PAGE collection of illustrative plates of GS115-3EGF secretion EGF.

Describe the present invention in detail below with reference to drawings and Examples.Embodiment 1: gene source

Natural, sophisticated human epidermal growth factor is made up of 53 amino acid, but human epidermal growth factor's the 53rd amino acids-arginine, behind human body and yeast expression in vivo, often removed from enzyme by egg, and the 52nd amino acids-leucine also often is removed, and whether the oxidation in yeast thalline fermenting process of the 21st methionine(Met) will cause 4 kinds of EGF compositions and deposit in addition.More than 40 amino acid of the known Urogastron aminoterminal of people has promptly had whole activity of this factor, the nucleotide coding order that intact bioactive variation EGF is still arranged after 51 amino acid whose genes of old friend worker's composite coding are promptly expressed can help the purifying behind this factor expression.

(1) with dna synthesizer and synthetic four the oligonucleotide chains of tris phosphite method, with the urea-denatured gel electrophoresis separation and purification of polyacrylamide-7M (upwards the marine life engineering research is ordered), it is respectively in proper order:

Primer 1 (60-mer): 5 '-GGA ATT CGT TAA CTC CGA CTC CGA ATG TCC ATT GTC CCA CGA CGGTTA CTG TTT GCA CGA-3 '

Primer 2 (61-mer): 5 '-AAG CTT TGG ACA AGT ACG CCT GTA ACT GTG TTG TTG GTT ACA TCGGTG AAA GAT GTC AAT A-3 '

Primer 3 (57-mer): 5 '-GGA ATT CTC ATT ATT CCC ACC ACT TCA AGT CTC TGT ATT GAC ATCTTT CAC CGA TGT-3 '

Primer 4 (60-mer): 5 '-GGC GTA CTT GTC CAA AGC TTC GAT GTA CAT ACA AAC ACC GTC GTGCAA ACA GTA ACC GTC-3 '

Primer

1 and 35 of EGF gene ' and the 3 ' end of encoding respectively wherein.Primer 1,4 has complementary order,

primer

2, and 3 have complementary order, and

primer

4 and 1,2 has complementary order.

It is all multifactor that the efficiently expressing of foreign gene relates to, because the degeneracy of codon is selected for use host system to have a liking for codon and played an important role to improving to express, forms so this synthetic gene is all had a liking for codon by yeast.Except that not containing phenylalanine and Threonine, the relevant situation of the frequency of occurrences of 18 seed amino acid codons is as follows: amino acid code and frequency of occurrences amino acid code and frequency of occurrences Ala GCT, 1 GCC, 1 Arg AGA, 2Asn AAC, 2 Asp CAC, 5Cys TGT, 6 Gln CAA, 1Glu GAA, 4 Gly GGT, 4His CAC, 2 Ile ATC, 2Leu TTG, 4 Lys AAG, 2Met ATG, 1 Pro CCA, 1Ser TCC, 3 Trp TGG, 2Tyr TAC, 5 Val GTT, 3 embodiment 2: the structure of recombinant plasmid pUC19-EGF51

Through the oligonucleotide of the foregoing description one gained acid chain 5 ' terminal through phosphorylation, four oligonucleotide interchain renaturation, chain extension, binding, EcoR I endonuclease digestion and be cloned into the EcoR I site of pUC19 and the evaluation of recombinant clone with reference to " molecular cloning ", determined dna sequence is used two deoxidations end cessation method of fluorescent primer and is carried out on the American AB I 373DNA of company sequenator.Obtain recombinant plasmid called after pUC19-EGF51.

The structure of recombinant plasmid pUC19-EGF51 is seen accompanying drawing 1.Embodiment 3: recombinant plasmid pUC19-EGF51 enzyme cut evaluation

Authentication method: 5 μ g recombinant plasmid pUC19-EGF51 are with EcoR I enzyme 1.5% agarose gel electrophoresis after 37 ℃ of enzymes are cut 2h, EB dye visible carrier segments and coding EGF51 amino acid, 2 terminators and contain the dna clone fragment of about 174bp in EcoR I site.

The enzyme of this plasmid is cut evaluation and is seen accompanying drawing 2, i.e. recombinant plasmid pUC19-EGF51 restriction enzyme digestion and electrophoresis collection of illustrative plates.Among the figure as seen: swimming lane 1:pBR322/BstN1 molecular weight standard, fragment is from large to small: 1857bp, 1060bp, 929bp, 383bp, 121bp swimming lane 2:.pUC19-EGF51/EcoR I, fragment is from large to small: 2900bp, 174bp swimming lane 3:pUC19-EGF51

This plasmid sequencing result shows that really this synthetic gene order correctly and at 5 of gene ' end has added the EcoR I and the Hpa I restriction enzyme site of expecting, 3 ' end has added the EcoR I restriction enzyme site of TAA and two terminator orders of TGA and expection, referring to appended fluorescence sequencer map 3, and the nucleotide sequence of the hEGF gene of synthetic and corresponding amino-acid sequence figure, i.e. Fig. 4.The proof synthetic gene is as follows: G GAA TTC GTT C CTT AAG CAA

EcoRⅠ HpaⅠ1 2 3 4 5 6 7 8 9 10 11 12 13 14 15Asn Ser Asp Ser Glu Cys Pro Leu Ser His Asp Gly Tyr Cys LeuAAC TCC GAC TCC GAA TGT CCA TTG TCC CAC GAC GGT TAC TGT TTGTTG AGG CTG AGG CTT ACA GGT AAC AGG GTG CTG CCA ATG ACA AAC16 17 18 19 20 21 22 23 24 25 26 27 28 29 30His Asp Gly Val Cys Met Tyr Ile Glu Ala Leu Asp Lys Tyr AlaCAC GAC GGT GTT TGT ATG TAC ATC GAA GCT TTG GAC AAG TAC GCCGTG CTG CCA CAA ACA TAC ATG TAG CTT CGA AAC CTG TTC ATG CGG31 32 33 34 35 36 37 38 39 40 41 42 43 44 45Cys Asp Cys Val Val Gly Tyr Ile Gly Glu Arg Cys Glu Tyr ArgTGT AAC TGT GTT GTT GGT TAC ATC GGT GAA AGA TGT CAA TAC AGAACA TTG ACA CAA CAA CCA ATG TAG CCA CTT TCT ACA GTT ATG TCT46 47 48 49 50 51Asp Leu Lys Trp Trp Glu stop code 1-2, EcoRⅠGAC TTG AAG TGG TGG GAA TAA TGA GAATTCCTG AAC TTC ACC ACC ATT ATT ACT CTTAAG4：

Typical methylotrophic yeast expression vector comprises alcohol oxidase gene (5 ' AOX1 promotor, 3 ' AOX1 terminator sequence, 3 ' AOX1 order), contains cloning site therebetween and inserts for foreign gene; P.pastoris group ammonia alcohol dehydrogenase gene (HIS4gene) is complementary screening sign; Breed the shuttle plasmid that increases as an energy in intestinal bacteria, it also has the sequence of part pBR322 plasmid.No yeast replication orgin in the expression vector, it is to be integrated in the yeast chromosomal genomic dna by homologous recombination, and goes down to posterity stable existence with the zymic reproduction.

Expression vector is cut (as the Bgl II .Not I or Sal I, Stu I etc.) back linearizing with different enzymes, make it to be integrated in the position of the AOX1 or the HIS4 gene of yeast genes group.The mode of integrating can be that single intersection is inserted, but also double cross is replaced, the in general preceding easier generation of a kind of mode.When zymic AOX1 gene is replaced and after losing, has just produced Muts phenotype (methanol utilization slow), they will utilize the synthetic AOX of weak AOX2 gene promoter, poor growth in containing the cultivation level base of methyl alcohol.And the yeast of wild-type is grown in containing the substratum of methyl alcohol normally, is called as Mut ⁺Phenotype.

For the hEGF gene is expressed, carried out following a series of external DNA recombination in an above-mentioned methylotrophic yeast expression vector.

Obtain human epidermal growth factor gene and α-factor leading peptide gene Fusion and fusion gene cloning as follows.

With the plasmid pSKSB that contains α-factor promotor and α-factor leading peptide and cytochrome C terminator that makes up with Hind III enzyme cut, the S1 enzyme scabbles, again with Sal I enzyme cut as carrier with from pUC19-EGF51 through Hpa I and Sal I enzyme cut institute's external binding of the dna fragmentation that obtained, conversion obtains recombinant clone pUC19-α EGF, (see figure 5).

The nucleotide sequence at α-factor leading peptide and EGF coded sequence fusion gene and position of fusion place is measured as shown in Figure 6.

Order-checking shows 85 amino acid whose alpha factor leading peptide orders of coding before the EGF gene, this can secrete EGF for yeast expression and create condition.Because in the processing and secretion process behind transcription and translation of alpha factor leading peptide and EGF gene, just be the KEX2 gene product behind 84 and the 85 amino acids Lys-Arg, a kind of cleavage site of endogenous protease is seen Fig. 7.Alpha factor leading peptide hEGF1 23 82 83 84 85 123 4ATG AGA TTT...* TTG GAT AAA AGA-AAC TCC GAC AGGTAC TCT AAA** AAC CTA TTT TCT-TTG AGG CTG TCC embodiment 5: the adding of Kozak order before α-factor leading peptide and the EGF coded sequence fusion gene

(wherein ACC ATG is the conservative order of Kozak to contain Kozak oligonucleotide primer GGAATTCACCATGAGATTTCCTTCAATT in proper order with 5 of design and synthetic ' end, it is initial that its existence will help translating) and corresponding to the Oligonucleolide primers of EGF3 ' end, with pUC19-α EGF is 85 amino acid and the EGF coded sequence that dna fragmentation that template amplification goes out will contain Kozak order, alpha factor leading peptide, and two ends are EcoR I recognition site.This fragment is connected into pUC19 order-checking (or being connected into the pAO815 expression) after EcoR I enzyme is cut, institute's DCRP is pUC19-K α EGF51 (or pA0815EGF), sees Fig. 8.

Show have completely from initial 85 the amino acid whose alpha factor leading peptides orders of coding of ATG through sequencing result before the EGF gene, and it is as follows to have added the Kozak order before the leading peptide order:

Kozak-alpha factor leading peptide hEGF

123 82 83 84 85 123 4G GAATTC ACC ATG AGA TTT.**TTG GAT AAA AGA*AAC TCC GAC AGGC CTTAAG TGG TAC TCT AAA.**AAC CTA TTT TCT*TTG AGG CTG TCC embodiment 6: the structure of expression vector pAO815-3EGF51

Plasmid pAO815 is available from Invitrogen company, and it can clone the multiple copied foreign gene, and can be integrated into methylotrophic yeast chromogene group, is used for expressing the expression vector of non-secretory intracellular protein, total length 7709bp.Its Co1E1 replication orgin order reaches ammonia benzyl resistant gene and derives from pBR322, and plasmid can be duplicated in intestinal bacteria and screen.But be not contained in the nucleotide sequence of self-replacation in the yeast but the HIS4 gene that derives from the yeast chromosomal dna is arranged, be saccharomycetic screening sign and integration site.Its 5 ' AOX1 and 3 ' AOX1 order also can make plasmid be integrated into methylotrophic yeast chromogene group through homologous recombination.EcoR I site between AOX1 promotor downstream and AOX1 terminator upstream is a cloning site, can make the foreign gene that contains the Kozak order insert the back in this site and obtain to express in born of the same parents, the present invention has added the alpha factor leading peptide and has made the secretion of exogenous gene expression product become possibility before the EGF gene.The pAO815 plasmid is seen Fig. 9.

To contain Kozak order, 85 amino acid of a-factor leading peptide and EGF coded sequence, and two ends are that the dna fragmentation of EcoR I recognition site is connected into the pAO815 expression vector after EcoR I enzyme is cut, the restriction enzyme mapping of recombinant clone is seen Figure 10, cuts evaluation and screening through enzyme and goes out forward clone and be pAO815-EGF51.

PAO851-EGF51 is after EcoR I enzyme is cut, and enzyme is cut and can be obtained two fragments.One is carrier-pellet segment length 7.7kb.Another is rock sign indicating number α-85 amino acid of factor leader sequence and EGF51 amino acid, 2 terminators and the dna clone fragment that contains about 430bp in EcoR I site.

Among Figure 10 as seen: swimming lane 1:pAO815-EGF51/EcoR I fragment by size is: 7.7Kb, (carrier) and 430bp (insertion fragment); Swimming lane 2:pAO815-EGF51; Swimming lane 3: λ DNA/Hind III: fragment is 31230bp from large to small, 9416bp, 6557bp, 4361bp, 2322bp, 2027bp, 564bp, 125bp.

PAO815-EGF51 is cut out the fragment that contains AOX1 promotor, α-factor leading peptide and EGF coded sequence and AOX1 terminator with Bgl II and BamH I, make it external and after connecting, cut with Bgl II and BamH I again, will obtain the dimer fragment that two ends are respectively Bgl II and BamH I end.Be connected into the BamH I site of the pA0815-EGF51 that alkaline phosphatase treatment crosses behind the low melting-point agarose gel-purified dimer fragment, transform TOP10F ' recipient bacterium, recon DNA enzyme can obtain to contain the unitary reorganization pAO815-3EGF51 of equidirectional three copy EGF expression after cutting Screening and Identification, and plasmid construction figure sees Figure 11.Plasmid enzyme restriction evaluation collection of illustrative plates is seen Figure 12.

PAO815 will produce 4028bp from large to small after cutting with BamH I and Bg III enzyme, 2405bp, three fragments of 1279bp.

PAO815-EGF51 will produce 4028bp from large to small after cutting with BamH I and Bg III enzyme, 2405bp, and three fragments of 1708bp, last fragment system inserts the 1279bp fragment because of the 430bp fragment and comes.PA0815-3EGF51 will produce 5124bp from large to small after cutting with BamH I and Bg III enzyme, 4028bp, and three fragments of 2405bp, 5124bp fragment are 1708bp fragment triploid.

In the accompanying drawing 12 as seen: swimming lane 1: λ DNA/Hind III: fragment is from large to small

31230bp,9416bp,6557bp,4361bp,2322bp,2027bp,564bp,125bp。Swimming lane 2:pAO815/BamH I+Bg III, 4028bp from large to small, 2405bp, three fragments of 1279bp.Swimming lane 3:pAO815-EGF51/BamH I+Bg III, 4028bp from large to small, 2405bp, three of 1708bp

Fragment.Swimming lane 4:pAO815-3EGF51/BamH I+Bg III, 5124bp from large to small, 4028bp, three of 2405bp

Fragment.

Plasmid pAO815-3EGF sequencing result proof EGF is under the regulation and control of AOX gene promoter and correct expression framework arranged.Show that through nucleotide sequence order-checking the α-factor leading peptide that contains the Kozak order and the fusion gene fragment of EGF correctly are connected into AOX promotor downstream.Prove also that in addition the EGF gene is present in insertion segmental α-factor leading peptide downstream.Embodiment 7: the screening of the preparation of host bacterium, conversion and engineering bacteria

Adopt methylotrophic yeast (P.pastoris) as expressive host among the present invention.

Methylotrophic yeast comprises pichia pastoris (P.pastoris) and many property debaryomyces hansenii, and it has many advantages: (1). contain distinctive AOX1 (alcohol oxidase) promotor, use methyl alcohol regulating and expressing strictly.(2) complete fermentation process is arranged, can the high-density cultured continuously, dry cell weight reaches more than the 100g/l, protein expression output height.(3) the methylotrophic yeast viability is strong, is easy to handle, and can grow in the non-selective substratum of cheapness, replenishes salt, and VITAMIN gets final product.(4) expression product both can be secreted again in born of the same parents' inner accumulated; The excretory heterologous protein accounts for more than 30% of all secretory proteins, is beneficial to the processing of plant-scale separation and downstream.

Methylotrophic yeast contains two AOX genes, is respectively AOX1, the AOX2 gene.They the two albumen coded sequence is similar, and 92% homology is arranged, and its protein product then has 97% homology.The protein product of AOX1 gene plays a major role in oxidising process, Northern blot shows, A0X1 gene transcription level is much higher than AOX2, and the AOX1 gene is subjected to strict dual regulation and control on transcriptional level: methanol induction AOX is synthetic, and general carbon katabolic product suppresses AOX and produces.Tschopp, people such as J.F. find only to remove and suppress to be not enough to abduction delivering AOX, under the carbon starvation; After must methanol induction being arranged, could start the signal transcription of AOX1, translation.

For this reason, the multiple copied EGF expression vector pAO815-3EGF51 that obtains through embodiment six that the present invention adopts, its conversion, screening and expression process are as follows:

The material of the material that uses in following examples 7 to 9 is: 1.10 * YNB:1349 sulfur acid ammonium but do not contain amino acid whose yeast base and be dissolved in 1000ml water, and standby after the sterile filtration.2.500 * vitamin H (0.02% vitamin H): 20mg VitH is dissolved in 100ml water, after the sterile filtration, 4 ℃ store for future use.3.100 * Histidine (0.4% Histidine): 400mg L-Histidine is dissolved in 100ml water, after the sterile filtration, 4 ℃ store for future use.4.10 * D (20% glucose): 200g glucose is dissolved in 1000ml water, after the sterile filtration, 4 ℃ store for future use.5.10 * M (5% methyl alcohol): 5ml methyl alcohol is dissolved in 95ml water, after the sterile filtration, 4 ℃ store for future use.6.10 * GY (10% glycerine): 100ml glycerine is dissolved in 900ml water, autoclaving, and room temperature preservation is standby.7.1M phosphate buffered saline buffer, pH6.0: mix 132ml 1M K ₂HPO4,868ml 1M KH ₂PO ₄8.YEPD or YPD substratum: 1% yeast extract, 26 peptones, 2% glucose.9.MGY reach MGYH:1.34%YNB, 1% glycerine, 0.00004% vitamin H, 0.004% Histidine ±.10.MD reach MDH:1.34%YNB, 0.5% methyl alcohol, 0.00004% vitamin H, 0.004% Histidine ±.11.BMG reach BMM:100mM phosphoric acid buffer pH6.0,1.34%YNB, 1% glycerine or 0.5% methyl alcohol, 0.00004% vitamin H.

The preparation of host's bacteria plasmid pAO815-3EGF51 and linearizing concrete steps:

The preparation of moderate plasmid DNA: after 50ml LB inoculation of medium contained the plasmid bacterial strain, 37 ℃ of shaking tables were cultured to the OD value and are about 0.4, and it is 170 μ g/ml that adding paraxin makes final concentration, continued to cultivate 12-16 hour.Behind the centrifugal collection thalline, extract plasmid with the SDS cracking process.Again with polyoxyethylene glycol method plasmid DNA purification.

Get 10 μ g pA0815-3EGF51 with Bgl II complete degestion after, phenol-chloroform-primary isoamyl alcohol extracting, ethanol sedimentation, lyophilize are standby.Embodiment 8: host's bacteria plasmid pAO815-3EGF51 transforms

Methylotrophic yeast GS115 (his4-) is inoculated in it on YPD plate available from Invitrogen company, cultivates 2 days, and isolates mono-clonal for 30 ℃.Mono-clonal is inoculated in 5ml YPD liquid nutrient medium, and 30 ℃ are cultured to OD and are about 0.5, and centrifugal collection thalline, is suspended in 1ml 10mM Tris-HCl, lmM EDTA, 0.1M LiCl solution after centrifugal at the rinsing of TE damping fluid.30 ℃ vibrated 60 minutes.Get 100 these suspensions of μ l and 5 μ l, 10 μ g linearization plasmids and mix, 30 ℃ are incubated 30 minutes.Add 0.7ml 70% polyglycol solution, 30 ℃ are incubated 30 minutes once more, and 37 ℃ of heat-shockeds 5 minutes.After centrifugal thalline is suspended in the 0.1ml sterilized water, is laid on 30 ℃ of cultivations on the MD culture plate.As electricity consumption punching instrument then host bacterium mono-clonal be inoculated in 5ml YPD liquid nutrient medium, be inoculated in 50ml YEPD substratum after 30 ℃ of overnight incubation and be about 1.5 to OD.Centrifugal collection thalline, is suspended in the ice-cold 1M Sorbitol Solution USP of 1ml after centrifugal at sterilization water coolant rinsing.Get 80 μ l and be woven in the electricity punching cup, 0 ℃ of precooling 5 minutes through host bacterium that embodiment seven prepares and the linearizing pAO815-3EGF51 of 5 μ l, 10 μ g.Bio-Rad gene perforating instrument (Gene-pluser II) program is set, makes to produce 7500V/cm, the electricimpulse of 10ms is to finish conversion.Add the ice-cold 1M sorbyl alcohol of 1ml immediately in electricity punching cup, get 200 μ l shop MD culture plate, 30 ℃ are cultured to recon and occur.Replace plasmid DNA with water in the conversion process, shop MD plate should not have the clone and occurs, and full plate clone will appear in shop MDH plate.Embodiment 9: screening Mut ⁺And Mut ^sTransformant

Be ready to MD-agarose plate and MM-agarose plate.With GS115-Albumin (His ⁺Mut ^s) and GS115-Gal (His ⁺Mut ⁺) under two bacterial strain situations in contrast, with aseptic toothpick the embodiment eight transformant symmetry that obtains is inoculated on above-mentioned two kinds of flat boards, the growing state of transformant is observed in 30 ℃ of cultivations.These His ⁺In the transformant, if zymic AOX1 gene is replaced and after losing, has just produced Mut ^sPhenotype, they can only utilize the synthetic AOX of weak AOX2 gene promoter, and Yin Er is poor growth in containing the substratum of methyl alcohol.And that the yeast of integrating at His gene place is containing in the substratum of methyl alcohol growth is normal, then is called as Mut ⁺Phenotype is seen Figure 13.Get His ⁺Mut ^sTransformant as genetic engineering bacterial strain GS115-3EGF, observe the EGF expression.

This shows methylotrophic yeast GS115, its conversion uses the gene perforating instrument of intact cell method or Bio-Rad with His ^-Culture dish filters out His ⁺After this transformant inoculates His simultaneously ⁺Transformant is in containing methyl alcohol or do not contain on the substratum of methyl alcohol, is integrated in AOX1 enzyme site and replaced AOX1 by observing the recon growing state, distinguishing, thereby can not utilize the Mut of methyl alcohol in a large number ^sAnd be integrated in the His site and can utilize the Mut of methyl alcohol ⁺Recon.The former called after GS115-3EGF, it is as the genetic engineering bacterial strain that uses in the inventive method.The expression of embodiment 10:EGF

Use 2L and shake bottle and 20L in-situ sterilization fermentor tank (the Bio Flo of U.S. NBS company IV 20L) cultivation genetic engineering bacterial strain GS115-3EGF.With after the 10% incubated overnight base inoculation, 30 ℃ of cultivations continue to splash into ammoniacal liquor and keep pH6.0, oxygen saturation 60%, and stream glycerol adding to the wet bacterium of every L reaches behind the 100-300g stream and adds methyl alcohol to keep its concentration be 1% to carry out the abduction delivering of EGF.

The screening of phase when expressing, the expression amount of the inventive method according to the present invention determine 4-5 days be best induction time.Improved the glycerol content in the basestocks in order to make the thalline fast breeding among the present invention, make it by 1% to 3%, and in culturing process, flow glycerol adding, stream adds ammoniacal liquor and mends nitrogen and keep the suitableeest growth pH, thereby and keep oxygen solubility etc. and make the thalline ramp, and then make and express output and can reach 300-900mg/L.

Referring to accompanying drawing 14.

The protein standard molecular weight is from large to small in the accompanying drawing 14: 16949,14404,10700,6214,2512.

The purifying of expressing protein can adopt in the prior art method in common to carry out, for example, and the column chromatographic isolation and purification method.To cultivate among the present invention and the centrifugal collection supernatant of inductive recombinant clone bacterial strain, adding ammonium sulfate makes concentration become 0.5M, be splined on 20mM phosphoric acid buffer pH7.0, drainage column Phenyl ' sepharose 6 Fast Flow (high sub) post that 0.5M ammoniumsulphate soln balance is crossed with 5 times of column volume amounts.With 20mM phosphoric acid buffer pH7.0,0.5M ammonium sulfate is washed till baseline with the sample introduction peak.Go out the EGF peak with low salt buffer (20mM phosphoric acid buffer) wash-out.This sample peak is splined on Q-sepharose HighPerformance post after diluting 10 times with 20mM Tris-HCl pH7.6 damping fluid, (20mM Tris-HCl pH7.6,0.5MNaCL) gradient elution method is collected the EGF peak to B liquid with A liquid (20mM Tris-Hcl pH7.6).At last with molecular sieve Superdex 30 column purification reorganization hEGF albumen.Purity can reach 95-97% or higher.Embodiment 11: the determining of recombinant human epidermal growth factor molecular weight

The recombinant human epidermal growth factor that obtains through the foregoing description ten uses the SDS-PAGE protein electrophoresis, determines its molecular weight with reference to the Laemmli method.

The concrete steps of this method are as follows: 1. material (1) Pharmacia LKBPhastSystem, to form by electrophoretic separation unit and dyeing unit two portions, and the hEGF sample need be finished in this system's electrophoretic separation and dyeing in 1 hour.(2) PhastGel Separation Media: select the gradient glue of prefabricated 8-25% for use, or common 15% glue.(3) Pharmacia polypeptide molecular weight standard merchandise 80-1129-83: each molecular weight is 16949,14404,10700,6214,2512.2. after method (1) the input SDS-PAGE program, the sample electrophoresis is gone up in 100 ℃ of sex change of embodiment sample after 5 minutes.Electrophoresis to bromjophenol blue to the end, stop electrophoresis, take out gel strips and put into stainer, dye after input dyeing and the decolouring program.(2) retaining is stayed in photograph.3. result

Standard molecular weight albumen and embodiment ten obtain recombinating and are splined on SDS-PAGE with determining molecular weight after hEGF reduces denaturation.Be single band after the dyeing of hEGF sample electrophoresis, the mapping analysis molecular weight is about 6000, meets the molecular weight of the EGF of 51 amino acid compositions.The bioactive mensuration of embodiment 12:EGF

The bioactive mensuration of EGF is undertaken by Ministry of Health's biological products evaluation scheme that provides.Its concrete grammar is as follows: 1. material and reagent (1) DMEM nutrient solution (available from U.S. BRL company); (2) complete culture solution 1:DMEM nutrient solution adds 11%FBS; (3) complete culture solution 2:DMEM nutrient solution adds 0.4%FBS; (4) BalB/c-3T3 cell strain (available from U.S. ATCC 20864); (5) phosphate buffered saline buffer: (6) MTT solution: the 5mg/ml phosphate buffered saline buffer, with the degerming of 0.22u membrane filtration, 4 ℃ keep in Dark Place standby; (7) lysate: DMSO or 10%SDS, 50%DMSO; (8) EGF standard substance and the EGF sample that obtains through embodiment 10.2. method (1) is collected the BalB/c-3T3 cell of cultivating.With phosphate buffered saline buffer rinsing twice, be resuspended in the complete culture solution 1, making cell concn is 5.0-10 * 104/ml.(2) with cell suspension inoculation in 96 well culture plates, every hole 100 μ l, 37 ℃, 5%CO ₂Overnight incubation.(3) supernatant discarded adds complete culture solution 2, every hole 100 μ l, 37 ℃, 5%CO ₂Cultivated 4-24 hour.(4) WHO standard product that biopsy provided and band test sample product are dissolved to designated volume with complete culture solution 2.Be diluted to following gradient by protein content with complete culture solution 2: 40,10,2.5,0.625,0.156,0.039, the every hole of 0.0ng/ml (5) adds the good sample 100 μ l of dilution successively.37 ℃, 5%CO ₂Cultivated 48-72 hour.(6) every hole adds MTT solution 20-25 μ l behind the microscopy.37 ℃, 5%CO ₂Cultivated 5 hours.(7) supernatant discarded, every hole adds lysate 100 μ l.37 ℃, place after 1 hour.Experiment wavelength 570nm, reference wavelength 630nm.(8) experimental result is calculated: with OD570 extension rate or concentration are mapped on graph paper, find the extent of dilution or the EC50 of median effective dose.

EGF activity (IU/ml)=standard substance are tired * A * B

A=standard substance median effective dose extent of dilution/sample is equivalent to standard substance median effective dose extent of dilution

Pre-extension rate 3. results of the pre-extension rate/standard substance of B=sample

70 pairs of EGF concentration mappings of OD5 (accompanying drawing 15) can calculate the proteic EC50＜0.88ng of EGF.The experiment of embodiment 13:DNA genetic stability

(1). the preparation of yeast chromosomal dna:

The foregoing description nine is obtained engineering bacteria GS115-3EGF and host bacterium GS115 is inoculated in BMG substratum 5ml, 30 ℃ are cultured to the period of saturation.0.1ml nutrient solution is inoculated in 1ml BMG culture medium culturing and gets the 0.1ml nutrient solution after 12 hours again and be inoculated in 1ml BMG culture medium culturing.So circulation is 50 times.With last nutrient solution bed board, 5 cultivations of picking mono-clonal bacterium at random.

Extract DNA with the yeast chromosomal dna rapid extracting method.

Method is as follows: with 1.5ml Eppendorf centrifuge tube centrifugation thalline, add 200 μ l lysis buffer (2%Triton X-100 behind the water rinse, 1%SDS, 10mM Tris-Cl pH8.0,1mM EDTA), 0.3g micro glass beads, the concussion of high speed vortex is 3 minutes behind 0.2ml phenol-chloroform-primary isoamyl alcohol.Add 200 μ l TE damping fluids and shake the back high speed centrifugation once more, centrifugation DNA behind the adding 1ml 100% ethanol mixing in the supernatant of taking-up.Contain behind the RNase enzyme TE dissolving DNA 37 ℃ of digestion 1 hour, add Ammoniom-Acetate and make into 0.4M, and add 2.5 times of volume 100% ethanol, deposit D NA.It is standby that 70% ethanol rinsing, post precipitation are dissolved in 100 μ lTE damping fluids.

(2) .PCR amplification EGF gene

Get host DNA 10ng and be template through the DNA10ng that embodiment nine makes 5 engineering bacterias, add

oligonucleotide segment

1 and 3 each 0.5 μ g that synthetic EGF gene is used, dNTP, contain magnesium damping fluid, water to 100 μ l, boil sex change ice bath after 5 minutes, add TAQ enzyme 5 μ, paraffin oil 100 μ l.Last 94 degrees centigrade in PCR instrument (U.S. PE company provides) 1 minute, 70 degrees centigrade 2 minutes, 30 circulations.

(3) the .2%Agarose electrophoresis is identified, shown in accompanying drawing 16, and 50 times 5 clones of having gone down to posterity, 100% amplifies the dna segment of 150bp.Proof the present invention's engineering bacteria is stable in heredity.Embodiment 14: the protein expression stability experiment

With 5 GS115-3EGF mono-clonal bacterium of the extraction DNA that uses among the embodiment 13 30 degrees centigrade of abduction deliverings 96 hours in the BMM substratum, get 15 μ l supernatants and add 5 μ l4 times SDS-PAGE sample-loading buffer, thermally denature, the 15%SDS-PAGE electrophoresis, examining the blue dyeing of Ma Shi, takes a picture and stays shelves in the decolouring back.Shown in accompanying drawing 17, prove the genetic engineering bacterial strain go down to posterity still can be stable after 50 times the EGF that gives expression to.

Claims

1, a kind of methylotrophic yeast cell, it contains 51 the amino acid whose human epidermal growth factors' that can encode of at least one copy gene order, it is characterized in that in a-factor leading peptide of 5 ' end connection of described human epidermal growth factor's gene order, before this a-factor leading peptide dna sequence dna, merge a Kozak sequence, and then be cloned into alcohol oxidase promotor downstream to be built into the integrated sequence that can express single copy human epidermal growth factor.

2, methylotrophic yeast cell as claimed in claim 1 is characterized in that containing the gene order that can express 51 amino acid whose human epidermal growth factors of coding of three copies.

3, methylotrophic yeast cell as claimed in claim, 1 or 2; 51：1 2 3 4 5 6 7 8 9 10 11 12 13 14 15Asn Ser Asp Ser Glu Cys Pro Leu Ser His Asp Gly Tyr Cys LeuAAC TCC GAC TCC GAA TGT CCA TTG TCC CAC GAC GGT TAC TGT TTGTTG AGG CTG AGG CTT ACA GGT AAC AGG GTG CTG CCA ATG ACA AAC16 17 18 19 20 21 22 23 24 25 26 27 28 29 30His Asp Gly Val Cys Met Tyr Ile Glu Ala Leu Asp Lys Tyr AlaCAC GAC GGT GTT TGT ATG TAC ATC GAA GCT TTG GAC AAG TAC GCCGTG CTG CCA CAA ACA TAC ATG TAG CTT CGA AAC CTG TTC ATG CGG31 32 33 34 35 36 37 38 39 40 41 42 43 44 45Cys Asp Cys Val Val Gly Tyr Ile Gly Glu Arg Cys Glu Tyr ArgTGT AAC TGT GTT GTT GGT TAC ATC GGT GAA AGA TGT CAA TAC AGAACA TTG ACA CAA CAA CCA ATG TAG CCA CTT TCT ACA GTT ATG TGT46 47 48 49 50 51Asp Leu Lys Trp Trp Glu stop code 1-2, EcoRⅠGAC TTG AAG TGG TGG GAA TAA TGA GAATTCCTG AAC TTC ACC ACC ATT ATT ACT CTTAAG。

4, methylotrophic yeast cell as claimed in claim 3 is characterized in that being connected with two terminator TAA and TGA at the 51st amino acid whose end of described gene order.

5, a kind of genetic engineering methylotrophic yeast cell, this cell is deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) on August 25th, 1997, and its preserving number is 0320.

6, a kind of recombinant plasmid, it contains the gene order that can express 51 amino acid whose human epidermal growth factors of coding of at least one copy, it is characterized in that before this a-factor leading peptide dna sequence dna, merging a Kozak sequence in a-factor leading peptide of 5 ' end connection of described human epidermal growth factor's gene order.

7, recombinant plasmid as claimed in claim 6 is characterized in that containing the gene order that can express 51 amino acid whose human epidermal growth factors of coding of three copies.

8, such as claim, 6 or, 7 described recombinant plasmids; 51：1 2 3 4 5 6 7 8 9 10 11 12 13 14 15Asn Ser Asp Ser Glu Cys Pro Leu Ser His Asp Gly Tyr Cys LeuAAC TCC GAC TCC GAA TGT CCA TTG TCC CAC GAC GGT TAC TGT TTGTTG AGG CTG AGG CTT ACA GGT AAC AGG GTG CTG CCA ATG ACA AAC16 17 18 19 20 21 22 23 24 25 26 27 28 29 30His Asp Gly Val Cys Met Tyr Ile Glu Ala Leu Asp Lys Tyr AlaCAC GAC GGT GTT TGT ATG TAC ATC GAA GCT TTG GAC AAG TAC GCCGTG CTG CCA CAA ACA TAC ATG TAG CTT CGA AAC CTG TTC ATG CGG31 32 33 34 35 36 37 38 39 40 41 42 43 44 45Cys Asp Cys Val Val Gly Tyr Ile Gly Glu Arg Cys Glu Tyr ArgTGT AAC TGT GTT GTT GGT TAC ATC GGT GAA AGA TGT CAA TAC AGAACA TTG ACA CAA CAA CCA ATG TAG CCA CTT TCT ACA GTT ATG TCT46 47 48 49 50 51Asp Leu Lys Trp Trp Glu stop code 1-2, EcoRⅠGAC TTG AAG TGG TGG GAA TAA TGA GAATTCCTG AAC TTC ACC ACC ATT ATT ACT CTTAAG。

9, recombinant plasmid as claimed in claim 6 is characterized in that being connected with two terminator TAA and TGA in described gene order at the 51st amino acid whose end.

10, recombinant plasmid as claimed in claim 6 is characterized in that described plasmid is plasmid pA0815EGF51.

11, a kind of expression vector that contains at least one copy expression alien gene, it is characterized in that comprising at least one expressing human epidermal growth factor gene sequence of prolonging the transcriptional orientation arrangement, it is the A0X1 promotor of methylotrophic yeast, the Kozak order, coding yeast α-85 amino acid whose nucleotide sequences of factor leading peptide, encode 51 amino acid whose EGF gene orders and transfection terminating sequence.

12, expression vector as claimed in claim 11 is characterized in that containing the gene order that can express 51 amino acid whose human epidermal growth factors of coding of three copies.

13, expression vector as claimed in claim 11; 51：1 2 3 4 5 6 7 8 9 10 11 12 13 14 15Asn Ser Asp Ser Glu Cys Pro Leu Ser His Asp Gly Tyr Cys LeuAAC TCC GAC TCC GAA TGT CCA TTG TCC CAC GAC GGT TAC TGT TTGTTG AGG CTG AGG CTT ACA GGT AAC AGG GTG CTG CCA ATG ACA AAC16 17 18 19 20 21 22 23 24 25 26 27 28 29 30His Asp Gly Val Cys Met Tyr Ile Glu Ala Leu Asp Lys Tyr AlaCAC GAC GGT GTT TGT ATG TAC ATC GAA GCT TTG GAC AAG TAC GCCGTG CTG CCA CAA ACA TAC ATG TAG CTT CGA AAC CTG TTC ATG CGG31 32 33 34 35 36 37 38 39 40 41 42 43 44 45Cys Asp Cys Val Val Gly Tyr Ile Gly Glu Arg Cys Glu Tyr ArgTGT AAC TGT GTT GTT GGT TAC ATC GGT GAA AGA TGT CAA TAC AGAACA TTG ACA CAA CAA CCA ATG TAG CCA CTT TCT ACA GTT ATG TCT46 47 48 49 50 51Asp Leu Lys Trp Trp Glu stop code 1-2, EcoRⅠGAC TTG AAG TGG TGG GAA TAA TGA GAATTCCTG AAC TTC ACC ACC ATT ATT ACT CTTAAG。

14, expression vector as claimed in claim 11 is characterized in that being connected with two terminator TAA and TGA in described gene order at the 51st amino acid whose end.

15,, it is characterized in that described expression vector is recombinant plasmid pA08153EGF51 as claim 11 or 12 described expression vectors.

16, a kind of method of utilizing methylotrophic yeast cell preparation human epidermal growth factor comprises

Synthetic coding 51 amino acid whose human epidermal growth factors (hEGF) gene;

The dna fragmentation of described human epidermal growth factor gene with coding yeast α-factor leading peptide merged,, be cloned into alcohol oxidase promotor downstream again to be built into the EGF expression vector through before the alpha factor leading peptide, adding the Kozak order;

With this carrier is the expression vector of the integrated three copy EGF of fundamental construction;

To filter out integrated Mut behind this expression vector conversion methylotrophic yeast strain GS115 ^sGenotype strain GS115-3EGF;

High-density culture and induce described bacterial strain make its secretion human epidermal growth factor.

17, method as claimed in claim 16 is characterized in that containing the gene order that can express 51 amino acid whose human epidermal growth factors of coding of three copies.

18, such as claim, 16 or, 17 described methods; 51：1 2 3 4 5 6 7 8 9 10 11 12 13 14 15Asn Ser Asp Ser Glu Cys Pro Leu Ser His Asp Gly Tyr Cys LeuAAC TCC GAC TCC GAA TGT CCA TTG TCC CAC GAC GGT TAC TGT TTGTTG AGG CTG AGG CTT ACA GGT AAC AGG GTG CTG CCA ATG ACA AAC16 17 18 19 20 21 22 23 24 25 26 27 28 29 30His Asp Gly Val Cys Met Tyr Ile Glu Ala Leu Asp Lys Tyr AlaCAC GAC GGT GTT TGT ATG TAC ATC GAA GCT TTG GAC AAG TAC GCCGTG CTG CCA CAA ACA TAC ATG TAG CTT CGA AAC CTG TTC ATG CGG31 32 33 34 35 36 37 38 39 40 41 42 43 44 45Cys Asp Cys Val Val Gly Tyr Ile Gly Glu Arg Cys Glu Tyr ArgTGT AAC TGT GTT GTT GGT TAC ATC GGT GAA AGA TGT CAA TAC AGAACA TTG ACA CAA CAA CCA ATG TAG CCA CTT TCT ACA GTT ATG TCT46 47 48 49 50 51Asp Leu Lys Trp Trp Glu stop code 1-2, EcoRⅠGAC TTG AAG TGG TGG GAA TAA TGA GAATTCCTG AAC TTC ACC ACC ATT ATT ACT CTTAAG。

19, methylotrophic yeast cell as claimed in claim 18 is characterized in that being connected with two terminator TAA and TGA at the 51st amino acid whose end of described gene order.

20, method as claimed in claim 16, it is characterized in that described bacterial strain GS115-3EGF is a kind of genetic engineering methylotrophic yeast cell, this cell is deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) on August 25th, 1997, and its preserving number is 0320.