CN1204142C

CN1204142C - Antigene V-erb B oligonucleotide and its use

Info

Publication number: CN1204142C
Application number: CNB001090232A
Authority: CN
Inventors: 冯宝章
Original assignee: Individual
Current assignee: Individual
Priority date: 2000-06-01
Filing date: 2000-06-01
Publication date: 2005-06-01
Anticipated expiration: 2020-06-01
Also published as: WO2002020782A1; CN1326938A

Abstract

The present invention relates to anti-gene V-erbB oligonucleotide, polypeptide products thereof, medicine compositions containing the oligonucleotide and an application of the oligonucleotide in diagnosing and curing myeloproliferative disorder syndrome, leucocythemia and other tumors.

Description

Antigene V-erb B oligonucleotide and application thereof

The present invention relates to Antigene V-erb B oligonucleotide, its polypeptide product comprises its pharmaceutical composition and the application in diagnosis and treatment myelodysplastic syndrome, leukemia and other kinds of tumors thereof.

Gene therapy is the disease treatment new technology that closely grows up during the last ten years, and it is to reach the purpose for the treatment of disease by the unusual of correction Disease-causing gene or with the way that new gene is replaced.In view of the limitation and the no thoroughness of present oncotherapy means, so behind the most tumors patient treatment several years just recur and dead, people entertain very high expectation to genetic treatment of tumor.Yet with virus vector normal gene is imported intravital method in the prior art,, face a series of difficult problems though some curative effect is arranged.Do gene therapy with the antisense oligonucleotide thiophosphatephosphorothioate and then avoided a series of problems because of using virus vector to bring.Some toxicity that thiophosphoric acid brought is that human body can be accepted and can overcome, thereby fool proof.Yet owing to antisense oligonucleotide is that mRNA at the cancer cells target gene designs, and cancer cells can continuously produce mRNA in nucleus, thereby the curative effect of consolidation can not be arranged.The anti-gene oligonucleotide that grows up on this basis is then at the specific sudden change position of oncogene and design, make it to enter and in nucleus, to form the DNA triple strand structure of consolidating behind the cell and suppress this expression of gene and amplification, thereby bring new hope for therapy of tumor.

Myelodysplastic syndrome (myelodysplastic syndrome, MDS) preleukemia of being commonly called as (preleukemia), it is one group of virulent marrow hemopoietic stem cells disease, most patient's myelosises excessively but the differentiation and maturation obstacle, thereby formed elements reduces in its peripheral blood, anaemia, hemorrhage, hemocytopenia and dizziness, symptom such as weak occur.Most patients diagnose some months of back or several years to develop into acute leukemia, and do not have effective methods of treatment.

Known V-erbB and V-erbA are chicken pronormoblast increase disease (AvianErythroblastosis) viral oncogene.The former has the function that transforms CFU-E with coming from EGF-R ELISA (EGFR) gene; The latter has the effect of the above-mentioned CFU-E differentiation and maturation of blocking-up.The two synergy causes chicken pronormoblast increase disease or claims erythroleukemia.

Myelodysplastic syndrome (MDS) has five different subtypes, and wherein (Refractory Anemia RA) is its basic model to refractory anemia.It can be converted into myeloblast increase RA (being RAEB) and transform in RAEB (being RAEBT) and acute leukemia (Acute Leukemia, AL).Originally in RAEBT patient's marrow erythroleukemia can also be diagnosed as again when increasing and identical with above-mentioned chicken erythroleukemia with basophilic normoblast.Also diagnosable during the single red system of RA patient's marrow hyperplasia is erythremic myelosis.And erythremic myelosis can develop into erythroleukemia.Illustrate that erythremic myelosis-erythroleukemia and MDS-RA and RAEB, RAEBT etc. there is no essential distinction.The hemocyte copy C-erbB of prompting V-erbB and V-erbA and C-erbA may play an important role in people MDS, leukemia morbidity unusually.

Research in the past proved already, human peripheral lymphocyte chromosomal fragile site (Fragile Site, FS) high expression level prompting tumor susceptibility.Tumour patient FS is often identical or close with tumour cell karyomit(e) breakpoint and oncogene position.Patient's periphery lymphocyte is expressed Fra (7) (P the preleukemia that the inventor finding an example ¹¹) and Fra (3) (P ¹⁴) etc.Fra (7) (P ¹¹) adjoin mutually with C-erbB, patient's marrow is red to be that DH (Myelodysplasia) is obvious, thereby suspects that highly C-erbB gets involved.So the inventor selects for use V-erbB and V-erbA to carry out the Southetn blot hybridization as probe, prove that MDS is relevant with C-erbA disappearance/inactivation with C-erbB rearrangement/amplification, results of hybridization has diagnosis and treatment meaning.On this basis, the inventor uses V-erbB PCR and orthogene oligonucleotide in-situ hybridization method, and then definite C-erbB rearrangement position, and its PCR product and in situ hybridization result all have diagnosis and pathogenesis meaning.Finish the present invention thus.

Therefore, first purpose of the present invention is to provide the anti-gene engineering principle of application to be used for the treatment of the anti-gene oligonucleotide of MDS, leukemia and other kinds of tumors and short copy thereof.Described anti-gene oligonucleotide is to be used orthogene oligonucleotide and design the anti-gene oligonucleotide of synthetic in the in situ hybridization at rearrangement position suspicious in the V-erbB dna sequence dna.

Second purpose of the present invention is to provide a kind of pharmaceutical composition, and it comprises oligonucleotide of the present invention and a kind of pharmacology acceptable carrier, is used for the treatment of MDS, leukemia and other kinds of tumors.

The 3rd purpose of the present invention is to provide a kind of anti-gene oligonucleotide combination (prescription), it comprise oligonucleotide of the present invention and with the anti-gene oligonucleotide of pathogenesis of cancer genes involved.

The 4th purpose of the present invention is to provide and the corresponding orthogene oligonucleotide of described anti-gene oligonucleotide, and it can be used to diagnose MDS, leukemia and other kinds of tumors.

The 5th purpose of the present invention is to transcribe the mRNA that obtains by anti-gene of the present invention or orthogene oligonucleotide, and described mRNA polypeptide expressed, comprises the vaccine of this polypeptide.

The 6th purpose of the present invention is to provide a kind of diagnostic kit, and it contains the oligonucleotide described in the 4th purpose of the present invention.

Specifically, at first the present invention relates to Antigene V-erb B oligonucleotide, it can be used for the treatment of MDS, leukemia and other kinds of tumors.Described oligonucleotide has following nucleotide sequence:

5′ATGGCAGAGCTGGCAAAC(SEQ?ID?NO：1)

5′AATTCTCAGGTGGGCCTG(SEQ?ID?NO：2)

Antigene V-erb B oligonucleotide of the present invention is to design synthetic towards the rearrangement position of C-erbB, reset the position base complementrity because of it with orthogene C-erbB and can combine target and suppress the unconventionality expression of orthogene C-erbB or transcribe, perhaps block it and be translated as carinogenicity albumen with orthogene C-erbB mRNA combination.Therefore, the known anti-gene engineering of utilization those skilled in the art, oligonucleotide of the present invention can be used for treating the C-erbB rearrangement/amplification MDS relevant with C-erbA disappearance/inactivation, leukemia and other kinds of tumors.In a preferred embodiment of the invention, oligonucleotide of the present invention is modified through thiophosphoric acid, and the product after this modification has the effect that suppresses nuclease and makes it reach intracellular target position.

Therefore, another aspect of the present invention relates to the oligonucleotide that comprises SEQ ID NO:1 and/or SEQ IDNO:2 and the pharmaceutical composition of pharmacology acceptable carrier, described pharmaceutical composition can give MDS, leukemia and other kinds of tumors patient, and the carrier that comprises in the pharmaceutical composition can be carrier well known in the art or vehicle.A kind of anti-gene oligonucleotide combination (prescription), it comprise oligonucleotide of the present invention and with the anti-gene oligonucleotide of pathogenesis of cancer genes involved.

The increase of known marrow Central Plains beginning and promyelocyte ratio is not only MDS and is changeed leukemia, also is the concentrated expression of acute transformation of chronic myelocytic leukemia sex reversal, also is simultaneously the concentrated expression of former of leukemia and recurrence.Use Antigene V-erb B oligonucleotide of the present invention can make fast and effectively that original and promyelocyte is reduced to normal level (≤5%) the MDS rat model marrow as can be known from following examples, thereby provide a kind of approach for malignancy diseases such as gene therapy MDS.

According to a further aspect in the invention, the invention still further relates to and the corresponding orthogene oligonucleotide of described anti-gene oligonucleotide, described orthogene oligonucleotide for example can be used as diagnostic probe behind mark, carry out in situ hybridization to judge whether individuality suffers from malignant tumours such as MDS with the medullary cell sample.Perhaps use the primer of inventor invention, the C-erbB gene unconventionality that detects patient's marrow through the V-erbBPCR method whether, thereby malignant tumours such as diagnosis MDS.Described orthogene oligonucleotide can carry out mark with any method known in the art, as vitamin H, digoxin etc.

Compare with virus-mediated gene therapy, do gene therapy many advantages are arranged with anti-gene oligonucleotide of the present invention.Except acting on fast, easy and simple to handle outside, are not biggest advantage because of the transfered cell of carrier (as retroviral or adenovirus) DNA or RNA brings a series of adverse consequencess that are difficult to assess.The effect characteristics of oligonucleotide of the present invention are the original position reparations of oncogene rearrangement position, but not import foreign gene, thereby it is different from general Antisense gene therapy.The latter designs synthesising antisense scant nucleotide at oncogene mRNA, and because cancer cells can continuously produce mRNA in nucleus, so that the therapeutic action of limited antisense oligonucleotide is a finite sum is of short duration.

Describe the present invention in detail hereinafter with reference to drawings and Examples.

Fig. 1 shows the effect for the treatment of back rat MDS among the embodiment 2 with Antigene V-erb B oligonucleotide of the present invention.

Fig. 2 shows among the embodiment 2 that it is normal that rat MDS blood picture recovers with after the Antigene V-erb B oligonucleotide treatment of the present invention.

Fig. 3 shows among the embodiment 2 with rat MDS weight increase in the Antigene V-erb B oligonucleotide therapeutic process of the present invention.

Synthesizing of embodiment 1 anti-gene and orthogene V-erbB oligonucleotide

Dna synthesizer (model: 394 types, source: go up automatically synthetic following oligonucleotide PE company):

5′ATGGCAGAGCTGGCAAAC(SEQ?ID?NO：1)

5′AATTCTCAGGTGGGCCTG(SEQ?ID?NO：2)

The effect of embodiment 2 Antigene V-erb B oligonucleotides treatment MDS

Select each 10 of Tianjin rat childhood (TR is from animal housing of Medical University Of Tianjin) and Wistar rats (WR is from animal housing of nutrition institute of Military Medical Science Institute), be divided into 4 groups, 5 every group.By in the past method (Feng Baozhang etc., Chinese experimental hematology magazine, 1996,4 (3): 309), through tail vein injection DMBA (DMBA).One group is blank among two groups of the TR, and another group is experimental group, and every animal is injected weekly 1 time, injects continuously 4 times.Inject respectively 1 time and 3 times for first group and second group among two groups of the WR.Then observe each treated animal incidence.

According to work in the past, the rat of 3 injection DMBA has 9/14 MDS takes place.Inject morbidity in back 2 months, and 3-4 month MDS phase arranged.Select the Wistar rat of 3 injection DMBA to make gene therapy model.

With 2 Antigene V-erb B oligonucleotides of embodiment 1 synthetic, through the phosphoric acid thio-modification.Using physiological saline solution, concentration before using is 10.0OD/ml, and MDS rat tail vein injection every day 1 time was injected 3 days continuously.Dosage is the 0.56mg/kg body weight.

3 administration groups (5) are being carried out in the observation process, finding that 2 WR almost fall ill simultaneously and are diagnosed as MDS-RA (being refractory anemia).When they develop into RAEB (initiating cell increases type RA) during the stage from RA, wherein 1 (WR1) is elected to be the gene therapy experimental mouse, and another (WR2) is mouse in contrast.Experimental mouse is a course of treatment through the anti-gene oligonucleotide of tail vein injection V-erbB every day 1 time for three days on end.Then observe.Injected behind the anti-gene oligonucleotide about 1 month, and found that contrast mouse spirit is withered to rub depressedly, and see the tumor (pathologic finding is confirmed as sarcoma) of the growth 3-4 of root of the tail portion centimetre size.Bone marrow examination is diagnosed as erythroleukemia, and dies from urinary tract to be subjected to sarcoma compressing and the uroschesis that causes.And experimental mouse is not only in high spirits, and the bone marrow examination original and promyelocyte of finding experimental mouse 13.0% drops to 3.0% before the anti-gene oligonucleotide treatment of V-erbB.Blood picture and bone marrow smear obviously improve.Find that the two is all normal when remaking bone marrow smear and hemogram checking in 3 months after the anti-gene therapy.See Fig. 1,2 for details.The PRELIMINARY RESULTS explanation, anti-gene oligonucleotide of the present invention has good curative effect to rat MDS, and the body weight check result illustrates this anti-gene oligonucleotide toxicity not obvious (Fig. 3) before and after the treatment.After 48 days, female mouse gives birth to 14 active young babies of health of a tire with the brood nursing of the female Wistar rats of this male experimental mouse and 1 unpregnancy, though further specify anti-gene oligonucleotide of the present invention through sulfo-toxicity do not show and safety performance good.

Antigene V-erb B oligonucleotide different dosing number of times of the present invention and scheme see Table 1 to the influence of rat MDS marrow.As seen from Table 1,16 rats treating are original all to have obvious decline with promyelocyte, and wherein the bone marrow smear of 15 rats recovers normal.And two kinds of oligonucleotide of the present invention are individually dosed or Combined Preparation is all effective in cure.And the contrast mouse (0-0, B-7) marrow is original rises with promyelocyte per-cent, and the prompting disease is in progress.Use identical dosage subsequently, carry out oral administration to 8 MDS-RAEB rats 1-3 the course of treatment, obtains result same as described above.The 3 routine esophageal carcinoma are treated by local application and the early stage patient of 2 routine cervical cancers is all effective, and the severe hyperplasia is reversed to normal.

16 rat MDS of table 1 inject the observation that anti-gene oligonucleotide of the present invention (B1 and B2) back marrow changes

Original+promyelocyte % medication that MDS MDS injects back marrow

Treatment back (variable) before rat hypotype observing time (moon) treatment

WR 0-0 RAEB 3.0 10.0 21.0(-11.0) 0

B-0 RAEB 3.0 13.5 3.0(10.5) B1，B2×3

B-1 ^*RAEB 2.5 15.0 no malignant cell B1, B2 * 3

B-4 RAEB 2.5 11.0 6.0(5.0) B1，B2×2

B-7 RAEB 2.5 11.5 16.0(-5.5) 0

A-4 RAEB 3.0 17.0 12.0(5.0) B1，B2×2

C-2 RAEB 3.5 9.0 5.0(4.0) B1，B2×3

C-8 RAEB 3.5 8.5 4.5(4.0) B1，B2×3

D-3 RAEB 3.0 13.0 6.0(7.0) B1，B2×1

D-5 RAEB 3.0 9.5 2.5(7.0) B1，B2×1

E-2 RAEB 3.0 7.0 4.5(2.5) B2×3

E-5 RAEB 3.0 6.5 3.0(3.5) B2×1

D-4 RAEB 2.5 6.5 2.5(4.0) B1，B2×1

D-1 RAEB 2.5 9.5 2.0(7.5) B1×3

D-2 RAEB 2.5 11.5 3.0(8.5) B1×3

F-5 RA 2.5 5.0 1.0(4.0) ^** B1，B2×1

F-1 RAEB 2.5 7.5 1.5(6.0) B1，B2×1

TR G-2 RAEB 1.0 10.0 5.0(5.0) B1，B2×3

^*This mouse viewing duration is died from inflammation

^*This mouse is transferred to marrow in afterbody generation sarcoma

As mentioned above, the rat MDS model of our foundation also is simultaneously other tumor models such as sarcoma.V-erbB of the present invention is anti-, and the gene oligonucleotide has good efficacy to MDS, other tumours be it seems also effective in cure.In view of cerebral glioma has C-erbB gene amplification, using anti-its early lesion of gene oligonucleotide treatment of V-erbB of the present invention may also have similar curative effect.The early lesion of the common cancer such as the esophageal carcinoma, cancer of the stomach, lung cancer and cervical cancer etc. be it seems also effective in cure, because they all have the C-erbB rearrangement/amplification identical with MDS.

The effect of embodiment 3 usefulness V-erbB orthogene oligonucleotide diagnosis MDS

1. in situ hybridization method detects:

As synthetic V-erbB orthogene oligonucleotide as described in the embodiment 1 corresponding to SEQ ID NO:1, and with this oligonucleotide of digoxin (DIG) mark, the oligonucleotide that adopts this mark is as probe, detected the amplification situation of the C-erbB gene of 33 routine MDS and 19 example contrasts and 3 routine suspicious MDS through in-situ hybridization method, the result shows that the in situ hybridization of whole 33 routine MDS all is positive, have 1 example to be positive in the 19 routine control groups, 3 routine suspicious MDS are all positive.

2.PCR method

A. extract the medullary cell template DNA according to a conventional method.

B. be primer with 5 ' CACTGTGTGAAGGCCTGC (P1) and 5 ' CTTATAAATAGTGCCAAAAGC (P2), 97 ℃ were carried out the template sex change in 7 minutes, carry out 32 circulations then, in each circulation the sex change condition be 94 ℃ 0.5 minute, annealing conditions be 52 ℃ of 1 minute and extension conditions be 72 ℃ 2 minutes.Last circulation was extended 5 minutes for back 72 ℃.The PCR product is electrophoresis detection on 1.8% sepharose.Do gene diagnosis according to the electrophoresis banding pattern.

Detect the rearrangement situation of the C-erbB gene of 23 routine MDS and 25 example contrasts and 3 routine suspicious MDS according to aforesaid method, had 18 routine PCR results to be positive as a result among the 23 routine MDS, had 1 example positive in the 25 example contrasts, had 2 examples positive among the 3 routine suspicious MDS.

Claims

1, a kind of anti-gene oligonucleotide has following nucleotide sequence:

5 ' ATGGCAGAGCTGGCAAAC; Or

5′AATTCTCAGGTGGGCCTG。

2, transcribe the mRNA that obtains by the described anti-gene oligonucleotide of claim 1.

3, the described anti-gene oligonucleotide complementary orthogene oligonucleotide of a kind of and claim 1.

4, a kind of pharmaceutical composition, it contains acceptable carrier on described anti-gene oligonucleotide of claim 1 and the pharmacology.

5, a kind of diagnostic kit, it contains the oligonucleotide described in the claim 3.

6, the application of the anti-gene oligonucleotide described in the claim 1 in preparation treatment myelodysplastic syndrome, leukemia and other kinds of tumors medicines.

7, the oligonucleotide described in the claim 3 is used for diagnosing the application of myelodysplastic syndrome gene diagnosis reagent in preparation.