WO2002020782A1

WO2002020782A1 - A sense andantisnse oligonucleotides of v-erbb gene and uses thereof

Info

Publication number: WO2002020782A1
Application number: PCT/CN2001/000888
Authority: WO
Inventors: Baozhang Feng
Original assignee: Baozhang Feng
Priority date: 2000-06-01
Filing date: 2001-06-01
Publication date: 2002-03-14
Also published as: CN1326938A; CN1204142C

Abstract

The invention relates to a pair of PCR primers specific for V-erbB gene, the sequence of V-erbB gene specified by the pair of primers, the polypeptide transcribed by the sequence, vaccine comprising the V-erbB sequence or polypeptide thereof, and a sense and antisense oligonucleotides of V-erbB gene designed based on the sequence of V-erbB gene. The invention also relates to a kit comprising above primers or a sense oligonucleotides of V-erbB gene, pharmaceutical composition comprising antisense oligonucleotides of V-erbB gene, and uses thereof in the diagnosis and treatment of myelosis abnormality syndrome, leukosis, other multiple tumor and prophasing.

Description

Positive and negative genes V-erbB oligonucleotides and applications thereof

The present invention relates to a pair of PCR archers specific to the V-erbB gene, a V-erbB sequence defined by the pair of primers, a transcribed mRNA and a translated polypeptide of the V-erbB sequence, comprising the V-erbB sequence and Polypeptide vaccines, plus positive and negative gene oligonucleotides designed for this V-erbB sequence. The present invention also relates to a diagnostic kit containing the primer or positive gene oligonucleotide, a pharmaceutical composition containing the antigenic oligonucleotide, and the above-mentioned substances in the diagnosis and treatment of myelodysplastic syndrome, leukemia and Many other tumors and their early application.

Background of the invention

Gene therapy is a new disease treatment technology developed in the past ten years. It achieves the purpose of treating diseases by correcting the abnormality of the pathogenic gene or replacing it with a new gene. In view of the limitations and incompleteness of current tumor treatment methods, and even the recurrence and death of most tumor patients within a few years after treatment, people have high expectations for tumor gene therapy. However, the method of introducing a normal gene into a body using a viral vector in the prior art, although having some curative effects, faces a series of difficulties. The use of antisense oligonucleotide phosphorothioate as a gene therapy avoids a series of problems caused by the use of viral vectors. Phosphorothioate and some of the toxicity caused by the degradation of oligonucleotides are acceptable and surmountable by the human body and are therefore very safe. However, because antisense oligonucleotides are designed to target the mRNA of cancer cell target genes, and cancer cells are constantly generating m A from the nucleus, it is unlikely to have a solid curative effect. Antigene oligonucleotides developed on this basis are designed for specific mutation positions of oncogenes, so that after entering the cell, they can form a solid triple-stranded DNA structure in the nucleus and inhibit the expression and amplification of the gene This brings new hope for tumor gene therapy.

Myelodysplastic syndrome (MDS), also known as white Preleukemia is a group of malignant bone marrow hematopoietic stem cell diseases. Most patients have excessive bone marrow hyperplasia but have difficulty in differentiation and maturation. As a result, their peripheral blood has reduced formation, and anemia, bleeding, decreased blood cells, dizziness, and fatigue are present. symptom. Most patients develop acute leukemia months or years after diagnosis, and no effective treatment is available.

It is known that V-erbB and V-erbA are chicken oncogenes of Avian Erythroblastosis virus. The former is homologous to the epidermal growth factor receptor (EGFR) gene and has the function of transforming erythroid progenitor cells; the latter has the effect of blocking the differentiation and maturation of the aforementioned erythroid progenitor cells. The synergy between the two causes chicken erythrocytosis or chicken leukemia.

Myelodysplastic syndrome (MDS) has five different subtypes, of which Refractory Anemia ₅ RA is its basic type. It can be transformed into refractory anaemia (ie, RAEB) and transformed RAEB (ie, RAEBT) and acute leukemia (Acute Leukemia, AL). RAEBT patients with bone marrow in the primary and early erythrocytes can also be re-diagnosed as red leukemia, which is the same as the above chicken red leukemia. RA patients can also be diagnosed with red blood disease when the bone marrow has a single hypertrophy of the red system. And red blood disease can develop into red leukemia. It shows that there is no essential difference between erythrocyte disease and erythroleukemia and MDS-RA and RAEB. RAEBT. It is suggested that the abnormality of C-erbB and C-erbA in the blood cell copies of V-erbB and V-erbA may play an important role in the pathogenesis of human MDS and leukemia. It is known that both V-Src and V-erbA act synergistically to cause chicken sarcoma.

Previous studies have demonstrated that high expression of the Fragile Site (FS) of human peripheral blood lymphocytes indicates tumor susceptibility. Cancer patients with FS are often the same or similar to tumor cell chromosome breakpoints and oncogene locations. The present inventors have found that peripheral lymphocytes of a patient with pre-leukemia express Fra / XP ¹¹ ) and Fra (3) (P ¹⁴ ). Fra (7) (P ⁿ ) is adjacent to C-erbB. The patient's bone marrow erythropathic hematopoiesis (Myelodysplasia) is obvious, so C-erbB is highly suspected. Therefore, the inventor chose V-erbB Southern blot hybridization with V-erbA as a probe proved that MDS is associated with C-erbB rearrangement / amplification and C-erbA deletion / inactivation. The hybridization results have diagnostic and pathological significance. On this basis, the inventors applied the V-erbB PCR and positive gene oligonucleotide in situ hybridization method to determine the C-erbB rearrangement position. Surprisingly, both the PCR product and the in situ hybridization result were found. Diagnostic and pathological significance. On this basis, DNA sequencing was performed on the above PCR products. It was processed by Gene Runner software. The results showed that the above PCR products of bone marrow cells of leukemia and pre-white patients had high homology with the above V-erbB upstream and downstream primer intervals, but no homology with the above interval of normal human EGFR, suggesting that in cancer The source of the occurrence was a sequence variation in the above-mentioned interval of the C-erbB gene, causing the original sequence to be deleted and replaced with a new sequence.

Therefore, an object of the present invention is to provide a pair of PCR primers specific to the V-erbB gene and a V-erbB sequence defined by the primer, the mRNA transcribed from the sequence and the translated polypeptide, comprising the V-erbB sequence and Polypeptide vaccine. The V-erbB sequence can be used as a target sequence for designing drugs for treating MDS, leukemia, and many other tumors and their early stages.

A second object of the present invention is to provide anti-gene oligonucleotides and positive-gene oligonucleotides directed to the V-erbB sequence defined by the above primers, and a pharmaceutical composition comprising these oligonucleotides and the above-mentioned primers of the present invention or Diagnostic kit.

A third object of the present invention is the application of the above-mentioned substances of the present invention in the diagnosis and treatment of myelodysplastic syndromes, leukemias, and various other tumors and their early stages.

Summary of the Invention-According to one aspect of the present invention, a pair of PCR primers specific to the V-erbB gene is provided, which can be used for highly sensitive diagnosis related to C_erbB rearrangement / amplification and C-erbA deletion / inactivation A variety of cancers and their early stages, especially myelodysplastic syndrome (MDS), leukemia, etc. The nucleotide sequence of the primer pair is as follows: 5, ATG AAA TGT GCC CAT TTT ATA 3 '(SEQ ID NO. 1) and 5, CAA AAC TTT GAC CTT TTT 3' (SEQ ID NO. 2) ₀ The present invention also relates to the V-erbB sequence defined by the above primers The sequence can be used as a target sequence for designing drugs for treating MDS, leukemia and other various tumors and their early stages, and can be used for designing any oligonucleotide primers other than the above PCR primer pairs. The sequence is as follows:

5, ATGAAATGTGCCCATTTTATAGATGGTCCCCACTGTGTGAAG

GCCTGCCCCGCTGGGGTCCTGGGTGAGAATGATACCCTGGTCC

GGAAGTATGCAGATGCCAATGCTGTTTGCCAGCTCTGCCATCCA

AACTGTACACGAGGGTGCAAAGGACCAGGTCTTGAAGGATGTC

CAAATGGCTCCAAAACTCCATCTATCGTGGCTGGTGTTGTCGGA

GGACTCCTGTGCCTGGTTGTGGTTGGTCTAGGCATCGGTCTTTA

CCTGCGGCGACGTCATATCGTGCGGAAGCGCACCCTGCGCAGG

CTGCTGCAAGAGAGGGAGCTTGTCGAACCACTGACACCCAGT

GGGGAGGCACCAAACCAGGCCCACCTGAGAATTTTAAAGGAA

ACAGAATTTAAAAAGGTCAAAGTTTTG 3 '(SEQ ID N0.3) It is understood that the mRNA and translated polypeptide transcribed from the sequence of SEQ ID N0.3 are also included in the present invention. In addition, the V-erbB sequence or its polypeptide is used to prevent various cancers associated with C-erbB rearrangement / amplification and C-erbA deletion / inactivation and their early stages, especially myelodysplastic syndrome ( MDS), DNA vaccines or polypeptide vaccines such as leukemia are also part of the present invention.

According to a second aspect of the present invention, two anti-gene oligonucleotides are provided for the V-erbB sequence (SEQ ID N0.3) defined by the primers of the present invention, and the sequences of the anti-gene oligonucleotides are as follows:

5, ATG GCA GAG CTG GCA AAC 3 '(SEQ ID NO. 4) and 5, AAT TCT CAG GTG GGC CTG 3' (SEQ ID NO. 5). The antigenic oligonucleotide of the present invention can be used to treat and prevent various cancers associated with C-erbB rearrangement / amplification and C-erbA deletion / inactivation and their early stages, especially abnormal bone marrow hyperplasia, through anti-gene technology. Syndrome (MDS), leukemia, etc. Antigenic oligo Nucleotides can also be used in combination with antigenic oligonucleotides of genes related to cancer pathogenesis such as thymidine synthase (TS) and thymidine kinase (TK) genes to treat and prevent the above diseases.

The present invention also provides a positive gene oligonucleotide contained in the V-erbB sequence (SEQ ID N0.3) of the first aspect of the present invention, and the positive gene oligonucleotide can be used for diagnosis and C-erbB recombination. Exclusion / amplification and C-erbA deletion / inactivation are related to a variety of cancers and their early stages, especially myelodysplastic syndrome (MDS), leukemia, etc. The two preferred positive gene oligonucleotide sequences are:

5, GTT TGC CAG CTC TGC CAT 3 '(SEQ ID N0.6), and

5. CAG GCC CAC CTG AGA ATT 3 '(SEQ ID N0.7).

It should be understood that, in addition to the above two positive gene oligonucleotides, the positive gene oligonucleotides for diagnostic purposes of the present invention also include any oligonucleus of 10-30 bp in length derived from SEQ ID N0.3 Glycylic acid.

The present invention also relates to a diagnostic kit containing these positive gene oligonucleotides for diagnosing various cancers associated with C-erbB rearrangement / amplification and C-erbA deletion / inactivation and their early stages, particularly bone marrow Hyperplasia syndrome (MDS), leukemia, etc.

Detailed description of the invention

The anti-gene V-erbB oligonucleotide of the present invention is designed and synthesized toward the rearrangement site of C-erbB, and because it is complementary to the base of the positive gene C-erbB rearrangement site, it can specifically bind and inhibit the positive Abnormal expression and amplification of the gene C-erbB, or binding to the gene C-erbB mRNA to block its translation into oncogenic proteins. Therefore, using anti-gene technology known to those skilled in the art, the anti-gene oligonucleotide of the present invention can be used to treat and prevent C-erbB rearrangement / amplification and C-erbA deletion / inactivation-related MDS, leukemia, and many others. In a tumor, the anti-gene oligonucleotide SEQ ID No. 4 has an important therapeutic effect, and SEQ ID N0.5 has an adjuvant therapeutic effect (see the following examples). This It should be understood by those skilled in the art that anti-gene oligonucleotides designed for other sites of the V-erbB sequence of the PCR primer interval described above will have the same auxiliary effect.

In a preferred embodiment of the present invention, the antigenic oligonucleotide of the present invention is modified with phosphorothioate, and the modified product has the effect of inhibiting nuclease and bringing it to a target position in the cell.

It is known that the increase in the proportion of primordial and promyelocytic cells in the bone marrow is not only the conversion of MDS to leukemia, but also the central manifestation of the acute transformation of chronic myelogenous leukemia, as well as the central manifestation of the etiology and recurrence of leukemia. It can be seen from the following examples that the use of the anti-gene V-erbB oligonucleotide of the present invention can quickly and effectively reduce the primordial and promyelocytic cells in the bone marrow of MDS model rats to normal levels (5%). Preventing malignant tumor diseases such as MDS provides a way.

According to another aspect of the present invention, that is, the _V - _er B PCR primer interval sequence and the positive gene oligonucleotide are labeled, for example, they can be used as diagnostic probes and in situ hybridization with bone marrow cell samples to Determine whether an individual has MDS and precancerous lesions or malignancies. The ortho-oligonucleotide can be labeled by any method known in the art, such as biotin, digoxin, and the like. Using the PCR primers specific to the V-erbB gene of the present invention or other primers designed according to the sequence of SEQ ID N0.3 of the present invention, the C-erbB gene abnormality of the patient's bone marrow or precancerous tissue can also be detected by the V-erbB PCR method. Whether or not, to diagnose malignant tumors such as MDS.

Compared with virus-mediated gene therapy, the use of the antigenic oligonucleotide of the present invention for gene therapy and prevention has many advantages. In addition to its fast action and easy operation, the biggest advantage is that it does not introduce a series of adverse consequences that are difficult to evaluate due to the introduction of vector (such as retrovirus or adenovirus) DNA or RNA into the cell. The anti-gene oligonucleotide of the present invention is characterized by the in situ repair of oncogene rearrangement positions, rather than the introduction of foreign genes, so it is different from general antisense gene therapy. The latter is designed to synthesize anti-oncogene mRNA Sense oligonucleotide, and because cancer cells are constantly producing rnRNA from the nucleus, the therapeutic effect of limited antisense oligonucleotides is limited and transient.

According to another aspect of the present invention, after the V-erbB PCR primer interval sequence of the present invention and the positive gene oligonucleotide are labeled, they can be used, for example, as diagnostic probes and in situ hybridization with bone marrow cell samples. To determine whether an individual has MDS or pre-leukemia and precancerous lesions or malignancies. The ortho-oligonucleotide may be labeled by any method known in the art, such as biotin, digoxin, and the like. The V-erbB gene-specific PCR primer of the present invention or other primers designed according to the sequence of SEQ ID NO. 3 of the present invention can also be used to detect C-erbB gene abnormalities in patients' bone marrow or precancerous tissues by the V-erbB PCR method. Whether or not, to diagnose malignant tumors such as MDS.

The above and other features of the present invention will be made clearer by the following detailed description with reference to the accompanying drawings and embodiments.

Figure 1 shows the effect of rat MDS after treatment with the anti-gene V-erbB oligonucleotide of the present invention in Example 2.

Fig. 2 shows that after treatment with the anti-gene V-erbB oligonucleotide of the present invention in Example 2, the rat MDS hemogram returned to normal.

Figure 3 shows the increase in rat MDS weight during treatment with the anti-gene V-erbB oligonucleotide of the present invention in Example 2.

Example 1 Synthesis of anti-gene V-erbB oligonucleotide

The following oligonucleotides were automatically synthesized on a DNA synthesizer (model 394, source PE company)-

5 'ATG GCA GAG CTG GCA AAC (SEQ ID NO: 4)

5 'AAT TCT CAG GTG GGC CTG (SEQ ID NO: 5) Example 2 Effect of anti-gene V-erbB oligonucleotide on MDS

Select juvenile Tianjin rats (TR, from the Animal Lab of Tianjin Medical University) and Wistar Rats (WR, from the Animal Room of the Institute of Nutrition, Academy of Military Medical Sciences) were each divided into 4 groups of 5 rats each. According to the previous method (Feng Baozhang et al., Chinese Journal of Experimental Hematology, 1996, 4 (3): 309), dimethylbenzanthrene (DMBA) was injected through the tail vein. One of the two TR groups was a blank control and the other was an experimental group. Each animal was injected once a week for four consecutive injections. In the two groups of WR, the first and second groups were injected once and three times, respectively. Then observe the incidence of animals in each group.

According to previous work, MDS occurred in 9/14 of rats injected 3 times with DMBA. Symptoms occurred 2 months after the injection, and there was an MDS period of 3-4 months. Wistar rats injected 3 times with DMBA were selected as gene therapy models.

The two anti-gene V-erbB oligonucleotides synthesized in Example 1 were modified with phosphorothioate. Dissolve in normal saline at a concentration of 10.0 OD / ml before use. MDS rats are injected once a day by the tail vein for 3 consecutive days. The dose was 0.56 mg / kg of body weight.

During the observation of the three-dose group (five), two WRs were found to develop almost simultaneously and diagnosed as MDS-RA (ie, refractory anemia). When they progressed from RA to RAEB (primary cytoplasmic RA) stage, one of them (WR1) was selected as a gene therapy experimental rat and the other (WR2) was used as a control rat. The experimental mice were injected with V-erbB antigene oligonucleotide through the tail vein once a day for 3 consecutive days as a course of treatment. Then observe. About one month after the injection of the anti-gene oligonucleotides, it was found that the control rats were atrophic and that a tumor of 3-4 cm in size was grown at the root of the tail (pathological examination confirmed a sarcoma). Bone marrow examination confirmed erythroleukemia and died of urinary retention due to urinary tract compression by sarcoma. The experimental rats were not only in good spirits, but also bone marrow examination showed that the primary and promyelocytic cells decreased from 13.0% to 5.0% before treatment with the V-erbB antigene oligonucleotide. Blood and bone marrow signs improved significantly. Bone marrow and blood examinations were performed 3 months after the antigene therapy, and both were normal. See Figures 1 and 2 for details. Preliminary results indicate that the antigenic oligonucleotide of the present invention has a good curative effect on rat MDS, and the results of body weight examination before and after treatment indicate that the antigenic Because the oligonucleotide toxicity is not obvious (Figure 3). After feeding this male experimental rat with a non-pregnant female Wistar rat for 48 days, the female rat gave birth to 14 healthy and lively pups, further explaining that the antigenic oligonucleotide of the present invention is But the toxicity is not obvious and the safety performance is good.

The effect of different administration times and schedules of the anti-gene V-erbB oligonucleotide of the present invention on the bone marrow of rat MDS is shown in Table 1. It can be seen from Table 1 that the primordial and promyelocytic cells of the 16 rats treated were significantly decreased, and the bone marrow of 15 rats returned to normal. And the two oligonucleotides of the present invention have a curative effect when administered alone or in combination. Control mice (Table 2) showed an increase in the percentage of bone marrow primitive and promyelocytic cells, suggesting that the disease was progressing. Subsequently, 8 MDS-RAEB rats were orally treated with the same dose and 1-3 courses of treatment, and the same results as above were obtained.

In addition, the inventors also used local medication to treat 27 patients with esophageal cancer and 2 patients with early cervical cancer, with an effective rate of 74.1%, which reversed the severe or moderate hyperplasia of the esophagus to normal.

Observation of bone marrow changes in 15 MDS rats after injection of antigene oligonucleotides

MDS MDS injection of B * and B ₂ ** after injection of bone marrow primitive + promyelocytic rat subtypes observation time (months) cell% decline

B-0 RAEB 3 B, B ₂ 3.0 10.5 (13.5-3.0) * * RAEB 3 2.5 15.0 (15.0-no malignant cells)

Β-4 RAEB 2 2.5 5.0 (11.0-6.0)

Α-4 RAEB 2 3.0 5.0 (17.0-12.0)

C-2 RAEB 3.5 4.0 (9.0-5.0)

C-8 RAEB 3 B | B ₂ 3.5 4.0 (8.0-4.5)

D-3 RAEB 1 B, B ₂ 3.0 7.0 (13.0-6.0)

D-5 RAEB 1 B, B ₂ 3.0 7.0 (9.5-2.5)

Β-2 RAEB B ₂ 3.0 2.5 (7.0-4.5)

Ε-5 RAEB 1 B ₂ 3.0 3.5 (6.5-3.0)

D-4 RAEB 1 2.5 4.0 (6.5-2.5)

D-1 RAEB 1 2.5 7.5 (9.5-2.0)

D-2 RAEB B, 2.5 8.5 (11.5-3.0)

Β-5 RA 1 2.5 4.0 (5.0-1.0) ****

B-1 RAEB ¹ 2.5 6.0 (7.5-1.5)

* B1 = SEQ ID N0.4

** B2 = SEQ ID N0.5

*** This mouse died of inflammation during observation

**** This mouse has a sarcoma in the tail and metastasized to the bone marrow

Observation of bone marrow changes in 9 rats without MDS diagnosis

MDS diagnosis Original follow-up time (months) at diagnosis

Female trouble.

T-2 RAEB 17.0 2 AEL, RAEBT (death)

T-3 RAEB 9.0 2 Sarcoma death after 3 months

T-7 RAEB 7.5 2 died after 1 month

0-0 RAEB 10.0 3 RAEBT, AEL

(Primitive + Promyelocytic 21%)

0-1 RA 5.0 2 RAEB

(Primitive + promyelocytic 16%)

0-2 RA 5.0 2 RAEB

(Primitive + promyelocytic cells 3%)

0-3 RA 8.0 2 RAEB

(Primitive + promyelocytic 10%)

0-4 RAEB 9.0 2 death, internal bleeding

B-7 RAEB 11.0 2.5 RAEB

(Primitive + Promyelocytic cells 16%) Results: Within 2 to 3 months, 9 MDS rats were converted to RAEB or RAEBT or died, and the percentage of bone marrow primitive + promyelocytic cells increased. No reversion was normal. As mentioned above, our rat MDS model is also a tumor model such as sarcoma. The V-erbB anti-gene oligonucleotide of the present invention has good curative effect on MDS and curative effect on other tumors. In view of the C-erbB gene amplification of gliomas, the application of the V-erbB anti-gene oligonucleotide of the present invention in treating early lesions may have similar curative effects. In addition to esophageal and cervical cancers, other common malignancies such as breast cancer, nasopharyngeal cancer, gastric cancer, liver cancer, bowel cancer, and lung cancer appear to be effective because they all have the same C-erbB amplification as MDS.

Example 3 Effect of Diagnosing MDS Using V-erbB Positive Gene Oligonucleotides

1. Detection in situ hybridization:

The V-erbB positive gene oligonucleotide SEQ ID N0.6 corresponding to the antigenic oligonucleotide SEQ ID NO: 4 was synthesized as described in Example 1, and the oligonucleotide was labeled with digoxin (DIG), Using the labeled oligonucleotide as a probe, the amplification of the C-erbB gene in 33 cases of MDS and 19 other hematological diseases and 3 suspected MDS was detected by in situ hybridization. The results showed that all 33 cases of MDS In situ hybridization was positive, 1 of 19 other hematological diseases was positive, and 3 suspected MDS were positive.

2. PCR method

Bone marrow cell DNA was extracted as a template according to a conventional method, and the specific PCR primer pairs 5, ATG AAA TGT GCC CAT TTT ATA (SEQ ID NO. 1) and 5, CAA AAC TTT GAC CTT TTT (SEQ ID NO. 2) of the present invention were used as a template. The primers were used for PCR amplification. The amplification conditions were 94Ό 2 minutes for template denaturation, and then 35 cycles. Each cycle was 94 ° C for 0.5 minutes, annealing conditions were 56 ° C for 1 minute, and extension conditions were 72. ° C for 1.5 minutes. After 5 minutes at 72 ° C after the last cycle. The PCR products were detected by electrophoresis on a 1.8% agarose gel. Genetic diagnosis based on electrophoretic band pattern. '' Samples of 32 cases of MDS, 12 cases of suspected MDS, 53 cases of other blood diseases, and 8 cases of normal bone marrow were tested according to the method described above, using the DNA of the sample as a template PCR, the results of 24 cases of MDS PCR were positive, the positive rate accounted for 75%. Eleven suspected MDS PCR were positive, with a positive rate of 91.6%.

Claims

Rights request

1. A pair of PCR primers specific for the V-erbB gene, having the following nucleotide sequences: 5, ATG AAA TGT GCC CAT TTT ATA 3 '(SEQ ID NO. 1) and 5, CAA AAC TTT GAC CTT TTT 3' (SEQ ID N0.2) o

1. The DNA sequence of the V-erbB gene defined by the PCR primer pair of claim 1:

5, ATGAAATGTGCCCATTTTATAGATGGTCCCCACTGTGTGAAG

GCCTGCCCCGCTGGGGTCCTGGGTGAGAATGATACCCTGGTCC

GGAAGTATGCAGATGCCAATGCTGTTTGCCAGCTCTGCCATCCA

AACTGTACACGAGGGTGCAAAGGACCAGGTCTTGAAGGATGTC

CAAATGGCTCCAAAACTCCATCTATCGTGGCTGGTGTTGTCGGA

GGACTCCTGTGCCTGGTTGTGGTTGGTCTAGGCATCGGTCTTTA

CCTGCGGCGACGTCATATCGTGCGGAAGCGCACCCTGCGCAGG

CTGCTGCAAGAGAGGGAGCTTGTCGAACCACTGACACCCAGT

GGGGAGGCACCAAACCAGGCCCACCTGAGAATTTTAAAGGAA

ACAGAATTTAAAAAGGTCAAAGTTTTG 3 '(SEQ ID N0.3).

3. The positive gene oligonucleotide sequence contained in the DNA sequence of claim 2, selected from the group consisting of:

(a) 5, GTT TGC CAG CTC TGC CAT 3, (SEQ ID N0.6),

(b) 5, CAG GCC CAC CTG AG A ATT 3 '(SEQ ID NO.7), and

(c) Any oligonucleotide other than (a) and (b) that is 10-30 bp in length.

4. The anti-gene oligonucleotide of the V-erbB gene is selected from:

(a) 5, ATG GCA GAG CTG GCA AAC 3 '(SEQ ID NO. 4) and

(b) 5, AAT TCT CAG GTG GGC CTG 3 '(SEQ ID NO.5)

5. The antigenic oligonucleotide according to claim 4, which is a phosphorothioate modification.

6. The niR A transcribed from the DNA sequence of claim 2.

7. A vaccine comprising the m NA translated polypeptide according to claim 6 or the DNA according to claim 2. 8. A pharmaceutical composition comprising the antigenic oligonucleotide according to claim 4 or 5 and a pharmaceutically acceptable carrier.

9. The pharmaceutical composition according to claim 8, further comprising an anti-gene oligonucleotide of genes other than the V-erbB gene, which are related to the onset of cancer.

10. A diagnostic kit comprising the oligonucleotide primer according to claim 1 or any pair of oligonucleotide primers designed for the sequence according to claim 2.

11. A diagnostic kit comprising the positive gene oligonucleotide according to claim 3.

12. The DNA sequence according to claim 2, the vaccine according to claim 6 or the anti-gene oligonucleotide according to claim 4 or 5 in the preparation and treatment of myelodysplastic syndrome, leukemia and many other cancers And its early applications.

13. Use of the diagnostic kit according to claim 10 or 11 in the diagnosis of myelodysplastic syndrome, leukemia, and various other cancers and their early stages.