CN1202265C - Molecular label closely linked with wheat gibberellin resistance main effect QTL and its application - Google Patents
Molecular label closely linked with wheat gibberellin resistance main effect QTL and its application Download PDFInfo
- Publication number
- CN1202265C CN1202265C CN 03112778 CN03112778A CN1202265C CN 1202265 C CN1202265 C CN 1202265C CN 03112778 CN03112778 CN 03112778 CN 03112778 A CN03112778 A CN 03112778A CN 1202265 C CN1202265 C CN 1202265C
- Authority
- CN
- China
- Prior art keywords
- wheat
- wangshuibai
- molecule marker
- scab
- resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a molecular marker which is tightly linked with the main effect QTL of the resistance to wheat scab and the application of the Molecular marker, and belongs to the field of wheat breeding and molecular biology. QTL and genetic linkage analysis are carried out to the gene types and the phenotype data of the resistance to the scab in each line of recombined selfing lines obtained through the hybridization of 'wangshuibai' (female) which is a disease resistant variety and an affected variety (male) to obtain molecular markers Xgwm161, BARC147 and Xgwm493 which are tightly linked with main effect QTL of the resistance to the scab of 'wangshuibai'. By detecting whether the 'wangshuibai' and the DNA of the derived varieties (series) thereof contain the molecular markers or not, the level of the resistance to the gibberellic disease can be predicted, and thus, the selection progress of wheat resisting the scab is accelerated.
Description
Technical field
The present invention relates to wheat breeding and biology field, especially select to utilize the molecule marker of wheat anti gibberellic disease resistance main effect QTL compact linkage to carry out assistant breeding, to improve the efficient of wheat anti gibberellic disease breeding.
Background technology
Wheat scab is an important disease warm, moist Mai Qu, is mainly caused by Fusarium graminearum (Fusariumgraminearum).Wheat scab not only causes serious production loss, and the residual deoxynivalenol (deoxynivalenol of sick wheat, mycotoxins such as DON), serious threat people and animals' health, cultivating disease-resistant variety is the most economical and effective means of this disease of control.A large amount of previous work (Bai Guihua, Shanghai Agricultural journal, 1989,5 (4): 17～23; Sinijders CHA, Euphytica, 1990,50:11～18; SinghRP, Plant Disease, 1995,79:238～240; Van Ginkel M, Plant Disease, 1996,80:863～867; Bai G-H, Theor.Appl.Genet., 2000,100:1～8.) show that the scab resistance of wheat is that genetic mechanism is comparatively complicated by the quantitative character of 2-3 to the common modification of minor gene that major gene is controlled and quantity is not quite clear.The resistance of wheat scab identifies and is subjected to such environmental effects bigger, identifies very difficultly, not only needs certain temperature control, the control measure of wetting, and can only carry out at flowering stage of wheat, waste time and energy, and also be the major reason that causes the wheat anti gibberellic disease breeding to be made slow progress.
The molecular mark technology that grew up in recent years, solved this problem effectively, by genetic map and quantitative trait locus (the Quantitative Trait Loci that makes up important anti-source, QTL) analyze, can find molecule marker with wheat scab resistance main effect QTL compact linkage (or be divided into from).Use molecule marker with the anti-red property main effect QTL compact linkage in a certain specific anti-source, can carry out the morning of screening from generation to generation in seedling stage to the offspring and the derived varieties (being) thereof in this specific anti-source, eliminate not disease-resistant plant, save production cost, improve breeding and efficiency of selection.
By this method, with the linked molecule marker of scab resistance main effect QTL of important anti-source Soviet Union wheat No. 3 and derived varieties (being) thereof, existing many pieces of articles report is being used for producing actual.And (the wheat scab research of Liyang Wangshuibai, chief editors such as Lu Weizhong, Science Press, Beijing, 2001) be the distinctive local variety of China, having higher and stable scab resistance, also is the wheat breed of finding till now the strongest to wheat scab resistance, and the molecule marker report linked with its main effect QTL do not arranged at present as yet.
Summary of the invention
The present invention seeks to: a kind of method is provided, in order to define the scab resistance main effect QTL compact linkage of which molecule marker and Wangshuibai, and can predict the scab resistance of wheat plant by detecting these molecule markers, accelerate the selection progress of wheat-resistance to scab.
The molecule marker of provided by the invention and wheat scab resistance main effect QTL compact linkage obtains by the following method:
A) wheat scab disease-resistant variety Wangshuibai (♀) and wheat scab susceptible variety (♂) hybridization obtains hybrid F1;
B) by hybrid F
1Self-pollination obtains filial generation, passes (SSD) method by the filial generation simple grain and obtains F
7The RIL in generation;
C) separate the DNA of each RIL family wheat leaf blade, adopt simple repeated sequence mark (SSR) primer or amplification fragment length polymorphism mark (AFLP) primer to carry out pcr amplification, amplified production after the electrophoretic separation, obtains the molecule marker data on 6% (containing 5.7 gram acrylamides and 0.3 gram methylene diacrylamide in the 100ml polyacrylamide sol solution) polyacrylamide gel;
D), the molecular marker analysis data is made up the wheat genetic linkage map based on the genetic linkage commutative law;
E) inoculation head blight pathogenic bacteria is measured the scab resistance of each family of RIL, and sick small ear rate is " resisting " 10% below, and sick small ear rate 10.1-25% is " in resist ", and sick small ear rate is " sense " more than 25.1%.
F) scab resistance of each family of RIL and the molecule marker in the wheat genetic linkage map are carried out chain and qtl analysis, with 2.5 is the LOD threshold value, there is a QTL site greater than 2.5 explanations, determine molecule marker with anti-source Wangshuibai scab resistance main effect QTL linkage, final obtain 3 molecule marker Xgwm161, BARC147 and Xgwm493 with anti-source Wangshuibai scab resistance main effect QTL linkage, their size is respectively 171bp, 107bp and 210bp.
Use with the molecule marker of wheat scab resistance main effect QTL compact linkage and to comprise: whether the genotype detection with molecule marker Xgwm161, BARC147 and Xgwm493 are used for wheat breed or strain has scab resistance to judge this kind or strain:
A) be male parent or maternal and other wheat hybridizings with Wangshuibai and derived varieties thereof or product and multiply to F
2More than generation;
B) the single plant of wheat to obtaining by step a), separate blade DNA detects in the separated DNA whether have the molecule marker linked with the head blight main effect QTL; Occur if any 2-3 molecule marker, predict the level that the resistance of the head blight of this wheat reaches " resisting ".
Used Wangshuibai derived varieties or strain, be meant with the Wangshuibai to be the parent, by conventional hybridization or adopt tissue culture or adopt anther culture or adopt corn and wheat hybridizing to induce monoploid, wheat breed or the strain that doubles to obtain double haploid or adopt the genetic transforming method acquisition with colchicine again.
The present invention can overcome in the conventional breeding wheat scab resistance and identify easily affected by environment, and can only be in the shortcoming of evaluation and screening in flowering period, just can predict the scab resistance of wheat plant and screen in seedling stage by the detection molecules mark, eliminate disease plant, reduce the waste of manpower and materials, improve breeding efficiency.
Description of drawings
Accompanying drawing 1 Wangshuibai 3B karyomit(e) and qtl analysis LOD value distribution plan.
The left side is a 3B chromosomal inheritance linkage map, and the map distance between mark marks with data;
The graphic representation on the right is the LOD value distribution plan of QTL, and dotted line is 2.5 threshold values.
Embodiment
Embodiment 1:
Acquisition with the molecule marker of wheat scab resistance main effect QTL compact linkage:
(1) structure of Wangshuibai recombinant inbred lines and anti-red property evaluation:
Adopt the sick kind Alon of Wangshuibai and wheat sense head blight to reach (Alondra) hybridization and produce F
1Hybrid, F
1Selfing produces F
2The offspring, F
2The plantation of seed of 104 individual plant picked at random, the method that adopts simple grain to pass is bred F
7In generation, produce 104 familys.
Scab resistance inoculation is identified respectively in the greenhouse or carry out in the field, chooses the small ear of just having bloomed in wheat head middle part, conidial suspension 10 microlitres (50000 spore/milliliters) of inoculation Fusarium graminearum bacterial strain F34, and atomizing was preserved moisture 3 days, 21 days " Invest, Then Investigate " disease small ear rates.
Sick small ear rate=(morbidity spikelet number/total spikelet number) * 100%.
(2) molecular marker analysis, genetic map construction and qtl analysis:
Be chosen at the SSR primer and the AFLP combination of primers that have amplification polymorphism between two parents 104 familys bases are had method (Marion S.R der, Genetics 149:2007-2023,1998; Guihua Bai, Phytopathology 89:343-348,1999) analyze, the DNA that separates each RIL family wheat leaf blade, adopt simple repeated sequence mark (SSR) primer or amplification fragment length polymorphism mark (AFLP) primer to carry out pcr amplification, on amplified production (contains 5.7 gram acrylamides and 0.3 gram methylene diacrylamide) 6% in 100ml polyacrylamide sol solution polyacrylamide gel after the electrophoretic separation, obtain the molecule marker polymorphism data, the polymorphism data that obtains is adopted JoinMap 3.0 softwares, the LOD value is carried out the linkage group grouping at 3.0-7.0, the Kosambi method is converted into genetic distance with recombination value, make up the genetic linkage maps of Wangshuibai, the integrated genetic linkage diagram data and the resistance materials of identification, qtl analysis adopts MapQTL4.0 to carry out, carry out Kruskal-Wallis (K-W) test earlier, P＜0.005 shows this mark and scab resistance close linkage, may have the Q hole.Then interval mapping (Interval Mapping) is carried out in the interval that may have QTL and many QTL mapping (MQM Mapping) is analyzed,, QTL site of existence is described greater than 2.5 2.5 be the LOD threshold value.
The Kruskal-Wallis test shows Xgwm161, BARC147 and Xgwm493 and BARC102a and the anti-red property close linkage (seeing attached list 1) that is positioned at the 3B the short arm of a chromosome; Interval mapping analysis (IntervalMapping) finds to truly have an anti-red QTL site between BARC147 and BAR102a, its LOD value is 2.93, soluble 14.5% anti-red property variation, many QTL mappings (MQM Mapping) find that this QTL site (sees attached list 2 in the interval of the 14.2cM of BARC147 and Xgwm493, accompanying drawing 1), the main scab resistance QTL of imitating that shows Xgwm161, BARC147 and Xgwm493 mark and Wangshuibai is linked, and can be used for the Wangshuibai is that the kind in the anti-source of head blight or the scab resistance of strain are predicted.
Subordinate list 1 Kruskal-Wallis test result
| Map distance | Molecule marker | The K value | The P value |
| 29.7 36.2 43.9 51.1 | BARC147 Xgwm161 Xgwm493 BARC102a | 8.265 15.794 10.812 7.985 | ＜0.005 ＜0.0001 ＜0.005 ＜0.005 |
The K value: Kruskal-Wallis test Analysis value, value is big more show relevant more with scab resistance.
The P value: represent the significance degree relevant with scab resistance, P＜0.005 shows this mark and scab resistance close linkage.
Subordinate list 2 Wangshuibais/Alondra resists red qtl analysis
Between the analytical procedure mark zone
Field/greenhouse, greenhouse, field
LOD VE LOD VE LOD VE
BARC147
Interval mapping 2.82 12.9 2.93 15.1 2.93 14.5
-BARC102a
BARC147
Many QTL map 2.83 13.0 2.82 13.7 2.82 13.7
-Xgwm493
LOD=logarithm probability value (probability of reflection QTL)
VE=% is changed by the phenotype that QTL caused
Adopt primer 5 ' GATCGAGTGATGGCAGATGG3 ' and 5 ' TGTGAATTACTTGGACGTGG3 ' with molecule marker Xgwm161, BARC147 and the Xgwm493 of anti-source Wangshuibai scab resistance main effect QTL linkage with the wheat leaf blade separated DNA; 5 ' GCGCCATTTATTCATGTTCCTCAT3 ' and 5 ' CCGCTTCACATGCAATCCGTTGAT3 '; 5 ' TTCCCATAACTAAAACCGCG3 ' and 5 ' GGAACATCATTTCTGGACTTTG3 ' carry out pcr amplification, amplified production obtains after the electrophoretic separation on 6% (containing 5.7 gram acrylamides and 0.3 gram methylene diacrylamide in the 100ml polyacrylamide sol solution) polyacrylamide gel, and their size is respectively 171bp, 107bp and 210bp.
Embodiment 2:
Verify in for genetic group at height with the molecule marker of wheat scab resistance main effect QTL compact linkage:
That obtain and the molecule marker wheat scab resistance main effect QTL compact linkage, also the part plant the F9 offspring of Wangshuibai and Alondra hybridization has carried out the scab resistance prediction, elder generation's DNA isolation from their blade, primer with SSR mark Xgwm493, BARC147 and Xgwm161 carries out polymerase chain reaction (PCR) to these DNA then, and determine whether to exist corresponding mark by passing judgment on collection of illustrative plates, there be 2-3 mark, illustrate that this kind or strain scab resistance reach the level of " resisting ", it then is susceptible not existing.Based on these decision criterias the scab resistance of each wheat plant is predicted then.Utilize the method for inoculation head blight pathogenic bacteria to measure the actual resistance of head blight of tested sample and compare with predicting the outcome subsequently.The results are shown in subordinate list 3, it is very identical with measured result to predict the outcome.
The scab resistance of the filial generation (F9) of subordinate list 3 usefulness and Wangshuibai main effect QTL compact linkage molecule mark prediction Wangshuibai/Alondra
| Family name | Predict the outcome | Actual result | ||||
| Xgwm493 | Xgwm161 | BARC147 | Scab resistance | Sick small ear rate (%) | Scab resistance | |
| WA003 | + | - | + | Anti- | 6.99 | Anti- |
| WA004 | + | + | + | Anti- | 8.14 | Anti- |
| WA013 | - | - | Sense | 40.14 | Sense | |
| WA017 | + | + | - | Anti- | 6.64 | Anti- |
| WA022 | + | + | + | Anti- | 7.80 | Anti- |
| WA030 | - | - | - | Sense | 26.12 | Sense |
| WA032 | - | - | - | Sense | 27.45 | Sense |
| WA034 | + | + | + | Anti- | 9.97 | Anti- |
| WA036 | - | - | - | Sense | 91.46 | Sense |
| WA038 | - | - | - | Sense | 72.20 | Sense |
| WA039 | - | - | - | Sense | 54.80 | Sense |
| WA041 | + | + | + | Anti- | 9.23 | Anti- |
| WA043 | + | + | + | Anti- | 6.37 | Anti- |
| WA044 | + | + | + | Anti- | 9.95 | Anti- |
| WA047 | + | - | + | Anti- | 8.38 | Anti- |
| WA053 | - | - | - | Sense | 40.37 | Sense |
| WA056 | - | + | + | Anti- | 9.13 | Anti- |
| WA057 | - | - | - | Sense | 48.13 | Sense |
| WA058 | - | - | - | Sense | 52.60 | Sense |
| WA064 | - | - | - | Sense | 50.12 | Sense |
| WA070 | - | - | - | Sense | 45.78 | Sense |
| WA075 | - | - | - | Sense | 45.03 | Sense |
| WA084 | + | + | - | Anti- | 6.61 | Anti- |
| WA086 | + | + | + | Anti- | 4.79 | Anti- |
| WA088 | + | + | + | Anti- | 6.85 | Anti- |
| WA102 | - | - | - | Sense | 64.74 | Sense |
+ expression has the band of SSR mark (Xgwm493, Xgwm161 and BARC147);
-expression does not have the band of SSR mark (Xgwm493, Xgwm161 and BARC147).
Embodiment 3:
With the linked molecule marker of the anti-red property main effect QTL of Wangshuibai to the breeding height for the material resistance prediction:
What utilization screened carries out tentative experiment to the breeding height for material with the linked molecule marker of Wangshuibai scab resistance main effect QTL, to show that this method is in the practical value of passing judgment on fast in the wheat scab resistance.Choosing 8 is that parent's height is for breeding material or wheat breed with Wangshuibai and derived varieties (being) thereof, elder generation's DNA isolation from their blade, analyze with the primer of SSR mark Xgwm493, BARC147 and Xgwm161 then, and determine whether to exist corresponding mark by passing judgment on collection of illustrative plates, there be 2-3 mark, illustrate that this kind or strain scab resistance reach the level of " resisting ", it then is susceptible not existing.Utilize the method for inoculation head blight pathogenic bacteria to measure the actual resistance of head blight of tested sample and compare with predicting the outcome subsequently.
Subordinate list 4 provides is predicting the outcome and the actual detected result behind the inoculation pathogenic bacteria of high DNA tests for strain or kind, as can be seen, adopt with the molecule marker prediction of main effect QTL compact linkage be very accurately with Wangshuibai and derived varieties (being) thereof for the scab resistance of the wheat in anti-source.
Subordinate list 4 usefulness are the scab resistance of the wheat line in anti-source with Wangshuibai and derived varieties (being) thereof with the prediction of Wangshuibai main effect QTL compact linkage molecule mark
| Family name | Cross combination | Predict the outcome | Actual result | ||||
| Xgwm493 | Xgwm161 | BARC147 | Scab resistance | Sick small ear rate (%) | Scab resistance | ||
| Wangshuibai | + | + | + | Anti- | 4.0 | Anti- | |
| E010 | Peaceful 6/ Wangshuibai // Wangshuibai/raise 158 | + | + | + | Anti- | 7.2 | Anti- |
| E024 | Peaceful 6/ Wangshuibai // raise 158 | + | + | + | Anti- | 9.1 | Anti- |
| E075 | Peaceful 8/3/ peaceful 6/ Wangshuibai // raise 158 | + | + | + | Anti- | 7.7 | Anti- |
| E038 | Pacify agricultural 8455/ Wangshuibai | + | + | - | Anti- | 7.9 | Anti- |
| E067 | Peace farming 8455/3/ peaceful 6/ Wangshuibai // raise 158 | + | + | - | Anti- | 6.9 | Anti- |
| E079 | V8360-1//raise 158/ Wangshuibai | + | + | - | Anti- | 9.8 | Anti- |
| E039 | Pacify agricultural 8455/ Wangshuibai | - | + | + | Anti- | 8.0 | Anti- |
| Peace farming 8455 | - | - | - | Sense | 38.1 | Sense | |
+ expression has the band of SSR mark (Xgwm493, Xgwm161 and BARC147);
-expression does not have the band of SSR mark (Xgwm493, Xgwm161 and BARC147).
Claims (4)
1, a kind of molecule marker of and Wangshuibai kind or strain wheat scab resistance main effect QTL compact linkage, it is characterized in that: they are molecule marker Xgwm161, BARC147 and Xgwm493 that size is respectively 171bp, 107bp and 210bp, and described molecule marker obtains by the following method:
A) wheat scab disease-resistant variety Wangshuibai ♀ and wheat scab susceptible variety ♂ hybridization obtains hybrid F1;
B) by hybrid F
1Self-pollination obtains filial generation, passes (SSD) method by the filial generation simple grain and obtains F
7The RIL in generation;
C) separate the DNA of each RIL family wheat leaf blade, adopt simple repeated sequence mark (SSR) primer or amplification fragment length polymorphism mark (AFLP) primer to carry out pcr amplification, amplified production obtains the molecule marker data after electrophoretic separation on the 6g/100ml polyacrylamide gel;
D), the molecular marker analysis data is made up the wheat genetic linkage map based on the genetic linkage commutative law;
E) inoculation head blight pathogenic bacteria is measured the scab resistance of each family of RIL, and sick small ear rate is " resisting " 10% below, and sick small ear rate 10.1-25% is " in resist ", and sick small ear rate is " sense " more than 25.1%;
F) scab resistance of each family of RIL and the molecule marker in the wheat genetic linkage map are carried out chain and qtl analysis, with 2.5 is the LOD threshold value, there is a QTL site greater than 2.5 explanations, determines molecule marker Xgwm161, BARC147 and Xgwm493 with anti-source Wangshuibai scab resistance main effect QTL linkage.
2., the molecule marker of according to claim 1 and Wangshuibai kind or strain wheat scab resistance main effect QTL compact linkage, it is characterized in that, use the wheat leaf blade separated DNA, adopt primer 5 ' GATCGAGTGATGGCAGATGG3 ' and 5 ' TGTGAATTACTTGGACGTGG3 '; 5 ' GCGCCATTTATTCATGTTCCTCAT3 ' and 5 ' CCGCTTCACATGCAATCCGTTGAT3 '; 5 ' TTCCCATAACTAAAACCGCG3 ' and 5 ' GGAACATCATTTCTGGACTTTG3 ' carry out pcr amplification, amplified production is electrophoretic separation on 6% polyacrylamide gel, described polyacrylamide gel is to contain 5.7 gram acrylamides and 0.3 gram methylene diacrylamide in the 100ml polyacrylamide sol solution, after the electrophoretic separation, obtain their size of molecule marker Xgwm161, BARC147 and Xgwm493 respectively and be respectively 171bp, 107bp and 210bp.
3, a kind of application of molecule marker as claimed in claim 1 or 2 is characterized in that:
A) with Wangshuibai and derived varieties thereof or product be male parent or maternal and other wheat hybridizings and multiply to F2 for more than;
B) the single plant of wheat to obtaining by step a), separate blade DNA detects in the separated DNA whether have molecule marker Xgwm161, BARC147 and Xgwm493; Occur if any 2-3 molecule marker, predict the level that the resistance of the head blight of this wheat reaches " resisting ".
4, the application of molecule marker according to claim 3, it is characterized in that: used Wangshuibai and derived varieties thereof or strain, be meant with the Wangshuibai to be the parent, by conventional hybridization or adopt tissue culture or adopt anther culture or adopt corn and wheat hybridizing to induce monoploid, wheat breed or the strain that doubles to obtain double haploid or adopt the genetic transforming method acquisition with colchicine again.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03112778 CN1202265C (en) | 2003-01-28 | 2003-01-28 | Molecular label closely linked with wheat gibberellin resistance main effect QTL and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03112778 CN1202265C (en) | 2003-01-28 | 2003-01-28 | Molecular label closely linked with wheat gibberellin resistance main effect QTL and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1442039A CN1442039A (en) | 2003-09-17 |
| CN1202265C true CN1202265C (en) | 2005-05-18 |
Family
ID=27796923
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 03112778 Expired - Fee Related CN1202265C (en) | 2003-01-28 | 2003-01-28 | Molecular label closely linked with wheat gibberellin resistance main effect QTL and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1202265C (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108243943A (en) * | 2017-12-29 | 2018-07-06 | 河南天民种业有限公司 | A kind of method of quick improvement the Yellow River and Huai He River area wheat scab resistance |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100336905C (en) * | 2004-05-08 | 2007-09-12 | 南京农业大学 | Wheat fertility recovery gene molecular mark and its obtaining method |
| CN100491541C (en) * | 2006-09-21 | 2009-05-27 | 江苏省农业科学院 | Molecular mark closely linked to Sumai No.3 head blight resistance main effect QTL and its application |
| CN100519763C (en) * | 2007-01-11 | 2009-07-29 | 江苏省农业科学院 | Molecule tag close linked to resistance QTL of wheat sharp eyespot, and application |
| CN101209024B (en) * | 2007-12-25 | 2011-03-30 | 南京大学 | Method for selectively breeding and identifying new resistance source of wheat scab |
| CN101429512B (en) * | 2008-12-17 | 2010-09-01 | 南京农业大学 | Wheat PDR type ABC transfer protein gene and encoded protein thereof |
| CN102586291B (en) * | 2011-12-20 | 2013-05-29 | 南京农业大学 | Receptor protein kinase gene and expression vector and application thereof |
| CN102626048B (en) * | 2012-05-02 | 2013-05-29 | 南京农业大学 | Method of molecular marker assisted backcross to improve scab invasion resistance of wheat |
| CN103632067B (en) * | 2013-11-07 | 2016-08-17 | 浙江大学 | A kind of seed amount character site localization method based on mixed linear model |
| CN105009951B (en) * | 2015-08-18 | 2017-06-30 | 大连民族大学 | A kind of molecular design method of shiny-leaved yellowhorn high yield forest culture and management |
| CN110093435B (en) * | 2015-09-28 | 2021-01-05 | 郑州大学 | Wheat SSR molecular marker primer and screening method thereof |
| CN107760767B (en) * | 2017-09-27 | 2021-04-20 | 山东省农业科学院生物技术研究中心 | Wheat scab-resistant multiple-fluorescence SSR (simple sequence repeat) marker detection method |
| CN109371159B (en) * | 2018-12-12 | 2020-09-04 | 江苏省农业科学院 | Molecular marker for identifying wheat scab resistance and application thereof |
| CN109468403A (en) * | 2018-12-17 | 2019-03-15 | 中国海洋大学 | The base portion form QTL and its Breeding Application of one kelp |
-
2003
- 2003-01-28 CN CN 03112778 patent/CN1202265C/en not_active Expired - Fee Related
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108243943A (en) * | 2017-12-29 | 2018-07-06 | 河南天民种业有限公司 | A kind of method of quick improvement the Yellow River and Huai He River area wheat scab resistance |
| CN108243943B (en) * | 2017-12-29 | 2021-05-28 | 河南天民种业有限公司 | Method for rapidly improving scab resistance of wheat in Huanghuai region |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1442039A (en) | 2003-09-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1202265C (en) | Molecular label closely linked with wheat gibberellin resistance main effect QTL and its application | |
| Kordrostami et al. | Molecular markers in plants: concepts and applications | |
| Dhingani et al. | Introduction to QTL mapping in plants | |
| CN110724758B (en) | Method for identifying purity of Jingnongke 728 corn hybrid based on SNP marker | |
| CN102140506B (en) | Molecular marker linked with gummy stem blight resistance gene Gsb-2 and application thereof | |
| Stępień et al. | Assessing genetic diversity of Polish wheat (Triticum aestivum) varieties using microsatellite markers | |
| CN110777216B (en) | Method for identifying purity of Jingke waxy 2000 corn hybrid based on SNP marker | |
| CN101240342B (en) | Cucumber powdery mildew resistance main effect QTL compact linkage molecule labeling method and applying method | |
| Jabłońska et al. | Molecular diversity of the Fusarium fujikuroi species complex from maize | |
| CN1459226A (en) | Wheat gibberella resistance major effect QTL linked molecular label and its application | |
| Demchik et al. | Genetic diversity of American hazelnut in the Upper Midwest, USA | |
| Abouzied | Assessment of genetic diversity among wheat somaclonal variants lines using morphological traits and molecular markers | |
| Mohammadzadeh et al. | Genetic variation among Iranian alfalfa (Medicago sativa L.) populations based on rapd markers. | |
| Bentley et al. | Genetic structure of Fusarium pseudograminearum populations from the Australian grain belt | |
| Talebi et al. | Quantitative evaluation of genetic diversity in Iranian modern cultivars of wheat (Triticum aestivum L.) using morphological and amplified fragment length polymorphism (AFLP) markers | |
| CN108416189B (en) | Crop variety heterosis mode identification method based on molecular marker technology | |
| CN101240343B (en) | Cucumber downy mildew resistance main effect QTL linkage molecule labeling method and applying method | |
| CN1955313A (en) | Molecular mark close linkage to Sumai No.3 head blight resistance main effect QTL and its application | |
| Tahir et al. | Grain micronutrient evaluation of wheat (Triticum aestivum) germplasm and molecular characterisation via genic and random SSR markers | |
| Zhou et al. | Genetic diversity and virulence variation of Sporisorium destruens isolates and evaluation of broomcorn millet for resistance to head smut | |
| CN114231656A (en) | SSR core primer group for identifying purity of cauliflower hybrid and screening method and application thereof | |
| Naseri et al. | Molecular characterisation and similarity relationships among 48 native and commercial Iranian apple (Malus domestica Borkh.) genotypes using simple sequence repeat (SSR) markers | |
| Fatima et al. | Mapping QTLs for yield and yield components under drought stress in bread wheat (Triticum aestivum L.). | |
| Mangena et al. | Genetic interrelationship of sweet stem sorghum genotypes assessed with simple sequence repeat markers | |
| Haddou et al. | Molecular Characterization and Study of Genetic Relationships among local Cultivars of the Moroccan fig (Ficus carica L.) using Microsatellite and ISSR Markers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |