CN1184319C - Chemosynthesized SARS virus S gene segement, its expression and application - Google Patents

Chemosynthesized SARS virus S gene segement, its expression and application Download PDF

Info

Publication number
CN1184319C
CN1184319C CNB031318797A CN03131879A CN1184319C CN 1184319 C CN1184319 C CN 1184319C CN B031318797 A CNB031318797 A CN B031318797A CN 03131879 A CN03131879 A CN 03131879A CN 1184319 C CN1184319 C CN 1184319C
Authority
CN
China
Prior art keywords
phe
val
ser
gly
lys
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CNB031318797A
Other languages
Chinese (zh)
Other versions
CN1472321A (en
Inventor
李越希
陶开华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CNB031318797A priority Critical patent/CN1184319C/en
Publication of CN1472321A publication Critical patent/CN1472321A/en
Application granted granted Critical
Publication of CN1184319C publication Critical patent/CN1184319C/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention relates to a chemosynthetic SARS virus S gene fragment, and expression and application thereof, which belongs to the fields of the gene engineering technology, vaccines and diagnostic reagents. In the present invention, strong antigen epitopes, total 299 amino acids from the 162nd amino acid to the 460th amino acid, in S protein of SARS virus are screened out through computer analysis; codons preferred by both eukaryon and prokaryotic organisms are selected; the fire-new gene sequences of the antigen epitopes are chemically synthesized. By the gene engineering technology, the gene fragment is expressed, and the strong antigen epitope fragments of the SARS virus S protein are prepared. The strong antigen epitope fragments of the expressed SARS virus S protein can be used for detecting vaccines, SARS virtue antibodies or antigens and can also be used for preparing single antibodies, multiple antibodies, etc. for resisting SARS virus in an immune mode.

Description

The SARS virus S gene fragment of chemosynthesis and expression thereof, application
Technical field
The present invention is the proteic brand-new gene fragment of the SARS virus S of chemosynthesis, utilizes genetic engineering technique, preparation reorganization SARS virus S albumen.By Computer Analysis, filter out the S protein fragments of the SARS virus that contains the strong antigen epi-position, the codon of selecting eucaryon and prokaryotic organism all to have a preference for, the gene order that chemosynthesis is brand-new, utilize genetic engineering technique to express, expressed proteins can be used for vaccine and SARS virus antibody or detection of antigens etc., the present invention relates to genetic engineering technique, vaccine and diagnostic reagent field.
Background technology
The first routine SARS (Severe Acute RespiratorySyndrome) patient has appearred on November 16th, 2003 in China Guangzhou, SARS is a kind of potent virus sexually transmitted disease, involves more than 30 countries in the world in the some months, especially in China domestic popular attaching most importance to.Up to about 15%, the elderly's mortality ratio that infects this disease can reach 40% to 50% according to the mortality ratio of WHO (World Health Organization) statistics SARS.The people has 10 to 14 days latent period after infecting SARS virus, occur high heat, cough, general malaise and headache, diarrhoea during morbidity, and respiratory distress syndrome can take place severe person in the week of one after the morbidity, so that the forfeiture respiratory function.
SARS virus is a kind of novel coronavirus, because this virus had not infected human in the past, so the crowd is to the general susceptible of this virus, SARS virus is a kind of sub-thread positive chain RNA virus, at present after measured to its complete genome sequence, announced about 10 total length virus gene sequence in the Genebank, laid a good foundation for utilizing genetic engineering technique research diagnostic reagent, vaccine and screening antiviral.
SARS virus can vitro culture with Vero-E6, set up immunofluorescence method and the enzyme linked immunosorbent detection method that detects SARS virus antibody so utilize the SARS virus of cultivating, but make Detection of antigen antibody with the SARS virus of cultivating, be difficult to mass production, also can produce false positive, developing special gene recombinant antigens is to set up the developing direction of SARS virus specific antibody detection reagent.The most desirable approach that prevention SARS infects is a vaccinate, but does not prevent the vaccine of SARS at present, both at home and abroad all actively developing the development of vaccine, especially Inactivated Vaccine is made fast progress, and recombinant vaccine is final developing direction.
The outermost S albumen of SARS virus is mediation virus and host cell bonded major protein, seals this proteic binding site and can stop virus infected cell, so the S albumen of SARS virus is the first-selected albumen that develops vaccine.By Computer Analysis, we filter out the S protein fragments of the SARS virus that contains the strong antigen epi-position, the codon of selecting eucaryon and prokaryotic organism all to have a preference for, the gene order that chemosynthesis is brand-new, utilize genetic engineering technique to express, expressed proteins can be used for vaccine and SARS virus antibody or detection of antigens etc.
Summary of the invention
The present invention is the proteic brand-new gene fragment of the SARS virus S of chemosynthesis, utilizes genetic engineering technique, preparation reorganization SARS virus S protein fragments.By Computer Analysis, filter out the S protein fragments of the SARS virus that contains the strong antigen epi-position, the 162nd amino acid-the 460th amino acid, totally 299 amino acid, the codon of selecting eucaryon and prokaryotic organism all to have a preference for, the gene order that chemosynthesis is brand-new utilizes genetic engineering technique to express this gene.Expressed proteins can be used for vaccine, SARS virus antibody or detection of antigens and is used for immunity preparation anti-SARS virus monoclonal antibody and how anti-etc.
The SARS virus S gene fragment of chemosynthesis and expression thereof, application take following steps to implement:
1.SARS the screening of virus S protein epitope and the chemosynthesis of gene fragment thereof:
Utilize softwares such as ANTHEWIN,, find that the proteic N end of S (the 162nd amino acid-the 460th amino acid) contains stronger antigenic determinant by the proteic aminoacid sequence of Computer Analysis SARS virus S.The codon of selecting eucaryon and prokaryotic organism all to have a preference for; the gene order that chemosynthesis is brand-new; and BamHI restriction enzyme site (following setting-out part) and two protection bases (GT) have been increased at 5 ' end; increased terminator codon (TAA) and EcoRI restriction enzyme site (following setting-out part) and two protection bases (AC) at 3 ' end, made this gene fragment be easy to be cloned in plasmid pET28a (+) the interior BamHI and EcoRI restriction enzyme site.
Epitope aminoacid sequence (the 460th aa of the 162nd aa-) in the SARS virus S albumen of screening:
Glu?Tyr?Ile?Ser?Asp?Ala?Phe?Ser?Leu?Asp?Val?Ser?Glu?Lys?Ser?Gly?Asn?Phe?Lys
His?Leu?Arg?Glu?Phe?Val?Phe?Lys?Asn?Lys?Asp?Gly?Phe?Leu?Tyr?Val?Tyr?Lys?Gly
Tyr?Gln?Pro?Ile?Asp?Val?Val?Arg?Asp?Leu?Pro?Ser?Gly?Phe?Asn?Thr?Leu?Lys?Pro
Ile?Phe?Lys?Leu?Pro?Leu?Gly?Ile?Asn?Ile?Thr?Asn?Phe?Arg?Ala?Ile?Leu?Thr?Ala
Phe?Ser?Pro?Ala?Gln?Asp?Thr?Trp?Gly?Thr?Ser?Ala?Ala?Ala?Tyr?Phe?Val?Gly?Tyr
Leu?Lys?Pro?Thr?Thr?Phe?Met?Leu?Lys?Tyr?Asp?Glu?Asn?Gly?Thr?Ile?Thr?Asp?Ala
Val?Asp?Cys?Ser?Gln?Asn?Pro?Leu?Ala?Glu?Leu?Lys?Cys?Ser?Val?Lys?Ser?Phe?Glu
Ile?Asp?Lys?Gly?Ile?Tyr?Gln?Thr?Ser?Asn?Phe?Arg?Val?Val?Pro?Ser?Gly?Asp?Val
Val?Arg?Phe?Pro?Asn?Ile?Thr?Asn?Leu?Cys?Pro?Phe?Gly?Glu?Val?Phe?Asn?Ala?Thr
Lys?Phe?Pro?Ser?Val?Tyr?Ala?Trp?Glu?Arg?Lys?Lys?Ile?Ser?Asn?Cys?Val?Ala?Asp
Tyr?Ser?Val?Leu?Tyr?Asn?Ser?Thr?Phe?Phe?Ser?Thr?Phe?Lys?Cys?Tyr?Gly?Val?Ser
Ala?Thr?Lys?Leu?Asn?Asp?Leu?Cys?Phe?Ser?Asn?Val?Tyr?Ala?Asp?Ser?Phe?Val?Val
Lys?Gly?Asp?Asp?Val?Arg?Gln?Ile?Ala?Pro?Gly?Gln?Thr?Gly?Val?Ile?Ala?Asp?Tyr
Asn?Tyr?Lys?Leu?Pro?Asp?Asp?Phe?Met?Gly?Cys?Val?Leu?Ala?Trp?Asn?Thr?Arg?Asn
Ile?Asp?Ala?Thr?Ser?Thr?Gly?Asn?Tyr?Asn?Tyr?Lys?Tyr?Arg?Tyr?Leu?Arg?His?Gly
Lys?Leu?Arg?Pro?Phe?Glu?Arg?Asp?Ile?Ser?Asn?Val?Pro?Phe
The dna sequence dna (916bp) that contains SARS virus S proteantigen epitope gene of chemosynthesis:
GT GGATCC?GAA?TAC?ATC?TCT?GAC?GCA?TTC?TCT?CTG?GAC?GTT?TCC?GAA?AAG?TCT?GGT?AAC
TTC?AAA?CAC?CTG?CGC?GAG?TTC?GTG?TTT?AAA?AAC?AAA?GAC?GGT?TTC?CTG?TAC?GTT?TAC
AAG?GGC?TAC?CAG?CCG?ATC?GAC?GTA?GTT?CGT?GAC?CTG?CCG?TCT?GGT?TTT?AAC?ACT?CTG
AAA?CCG?ATC?TTC?AAG?CTG?CCG?CTG?GGT?ATT?AAC?ATC?ACT?AAC?TTC?CGC?GCT?ATC?CTG
ACT?GCT?TTC?TCT?CCG?GCT?CAG?GAC?ACT?TGG?GGC?ACT?TCT?GCT?GCA?GCC?TAC?TTC?GTT
GGC?TAC?CTG?AAG?CCA?ACT?ACC?TTT?ATG?CTG?AAG?TAC?GAC?GAA?AAC?GGT?ACT?ATC?ACT
GAT?GCT?GTT?GAC?TGC?TCT?CAG?AAC?CCA?CTG?GCT?GAA?CTG?AAA?TGC?TCT?GTT?AAG?AGC
TTT?GAG?ATC?GAC?AAA?GGT?ATT?TAC?CAG?ACC?TCT?AAC?TTC?CGT?GTT?GTT?CCG?TCT?GGT
GAC?GTT?GTG?CGT?TTC?CCT?AAC?ATC?ACT?AAC?CTG?TGC?CCG?TTT?GGT?GAA?GTT?TTC?AAC
GCT?ACT?AAA?TTC?CCT?TCT?GTC?TAC?GCA?TGG?GAG?CGT?AAA?AAA?ATT?TCT?AAC?TGC?GTT
GCT?GAT?TAC?TCT?GTG?CTG?TAC?AAC?TCT?ACC?TTT?TTC?TCT?ACC?TTC?AAG?TGC?TAC?GGC
GTT?TCT?GCT?ACT?AAG?CTG?AAC?GAC?CTG?TGC?TTC?TCC?AAC?GTT?TAC?GCA?GAT?TCT?TTC
GTA?GTT?AAG?GGT?GAT?GAC?GTA?CGT?CAG?ATC?GCT?CCA?GGT?CAG?ACT?GGT?GTT?ATC?GCT
GAC?TAC?AAC?TAT?AAA?CTG?CCG?GAC?GAT?TTC?ATG?GGT?TGC?GTT?CTG?GCT?TGG?AAC?ACT
CGT?AAC?ATT?GAC?GCT?ACT?TCT?ACT?GGT?AAC?TAC?AAC?TAC?AAA?TAT?CGT?TAC?CTG?CGT
CAC?GGC?AAA?CTG?CGT?CCG?TTC?GAA?CGT?GAC?ATC?TCT?AAC?GTG?CCG?TTC?TAA? GAATTCAC
2. express SARS virus S protein fragments construction of recombinant plasmid:
Extract plasmid pET28a (+),, reclaim the big fragment of plasmid that enzyme is cut behind the electrophoresis, be dissolved in the deionized water with BamH I and EcoR I double digestion.Same SARS virus S protein gene fragment with BamH I and the chemosynthesis of EcoR I double digestion, electrophoresis is dissolved in the deionized water after reclaiming.
Above-mentioned two kinds of enzymes of volumetric molar concentration such as get and cut the back dna fragmentation, in same centrifuge tube, connect with the T4 dna ligase, SARS virus S protein gene fragment is inserted between carrier pET28a (+) interior the BamH I and EcoR I site, consistent with the initiator codon translation framework on the carrier, express a fusion rotein.
3. the screening of recombinant plasmid and evaluation:
With recombinant plasmid transformed e. coli bl21 (DE3), coating contains kantlex (60 μ g/ml) LB flat board, puts 37 ℃ and spends the night.Next day, picking transformed a bacterium colony and a contrast bacterium (plasmid pET28a transformed bacteria) at random, extracting plasmid respectively, is template with the plasmid that extracts, pcr amplification SARS virus S protein gene fragment, contain the segmental positive recombinant plasmid of SARS virus S protein gene, should amplify the gene fragment that is about 916bp.The plasmid that will contain foreign gene carries out dna sequence analysis, and sequential analysis confirms that recombinant plasmid contains synthetic SARS virus S protein gene fragment, and sequence is entirely true:
GAA?TAC?ATC?TCT?GAC?GCA?TTC?TCT?CTG?GAC?GTT?TCC?GAA?AAG?TCT?GGT?AAC?TTC?AAA
CAC?CTG?CGC?GAG?TTC?GTG?TTT?AAA?AAC?AAA?GAC?GGT?TTC?CTG?TAC?GTT?TAC?AAG?GGC
TAC?CAG?CCG?ATC?GAC?GTA?GTT?CGT?GAC?CTG?CCG?TCT?GGT?TTT?AAC?ACT?CTG?AAA?CCG
ATC?TTC?AAG?CTG?CCG?CTG?GGT?ATT?AAC?ATC?ACT?AAC?TTC?CGC?GCT?ATC?CTG?ACT?GCT
TTC?TCT?CCG?GCT?CAG?GAC?ACT?TGG?GGC?ACT?TCT?GCT?GCA?GCC?TAC?TTC?GTT?GGC?TAC
CTG?AAG?CCA?ACT?ACC?TTT?ATG?CTG?AAG?TAC?GAC?GAA?AAC?GGT?ACT?ATC?ACT?GAT?GCT
GTT?GAC?TGC?TCT?CAG?AAC?CCA?CTG?GCT?GAA?CTG?AAA?TGC?TCT?GTT?AAG?AGC?TTT?GAG
ATC?GAC?AAA?GGT?ATT?TAC?CAG?ACC?TCT?AAC?TTC?CGT?GTT?GTT?CCG?TCT?GGT?GAC?GTT
GTG?CGT?TTC?CCT?AAC?ATC?ACT?AAC?CTG?TGC?CCG?TTT?GGT?GAA?GTT?TTC?AAC?GCT?ACT
AAA?TTC?CCT?TCT?GTC?TAC?GCA?TGG?GAG?CGT?AAA?AAA?ATT?TCT?AAC?TGC?GTT?GCT?GAT
TAC?TCT?GTG?CTG?TAC?AAC?TCT?ACC?TTT?TTC?TCT?ACC?TTC?AAG?TGC?TAC?GGC?GTT?TCT
GCT?ACT?AAG?CTG?AAC?GAC?CTG?TGC?TTC?TCC?AAC?GTT?TAC?GCA?GAT?TCT?TTC?GTA?GTT
AAG?GGT?GAT?GAC?GTA?CGT?CAG?ATC?GCT?CCA?GGT?CAG?ACT?GGT?GTT?ATC?GCT?GAC?TAC
AAC?TAT?AAA?CTG?CCG?GAC?GAT?TTC?ATG?GGT?TGC?GTT?CTG?GCT?TGG?AAC?ACT?CGT?AAC
ATT?GAC?GCT?ACT?TCT?ACT?GGT?AAC?TAC?AAC?TAC?AAA?TAT?CGT?TAC?CTG?CGT?CAC?GGC
AAA?CTG?CGT?CCG?TTC?GAA?CGT?GAC?ATC?TCT?AAC?GTG?CCG?TTC?TAA
The virus S protein fragment (299 amino acid) of the expression of recombinant plasmid SARS that makes up has merged 34 amino acid on the carrier at its N end, 333 amino acid of total length, and its aminoacid sequence is as follows:
Met?Gly?Ser?Ser?His?His?His?His?His?His?Ser?Ser?Gly?Lys?Val?Pro?Arg?Gly?Ser
His?Met?Ala?Ser?Met?Thr?Gly?Gly?Gln?Gln?Met?Gly?Arg?Gly?Ser?Glu?Tyr?Ile?Ser
Asp?Ala?Phe?Ser?Leu?Asp?Val?Ser?Glu?Lys?Ser?Gly?Asn?Phe?Lys?His?Leu?Arg?Glu
Phe?Val?Phe?Lys?Asn?Lys?Asp?Gly?Phe?Leu?Tyr?Val?Tyr?Lys?Gly?Tyr?Gln?Pro?Ile
Asp?Val?Val?Arg?Asp?Leu?Pro?Ser?Gly?Phe?Asn?Thr?Leu?Lys?Pro?Ile?Phe?Lys?Leu
Pro?Leu?Gly?Ile?Asn?Ile?Thr?Asn?Phe?Arg?Ala?Ile?Leu?Thr?Ala?Phe?Ser?Pro?Ala
Gln?Asp?Thr?Trp?Gly?Thr?Ser?Ala?Ala?Ala?Tyr?Phe?Val?Gly?Tyr?Leu?Lys?Pro?Thr
Thr?Phe?Met?Leu?Lys?Tyr?Asp?Glu?Asn?Gly?Thr?Ile?Thr?Asp?Ala?Val?Asp?Cys?Ser
Gln?Asn?Pro?Leu?Ala?Glu?Leu?Lys?Cys?Ser?Val?Lys?Ser?Phe?Glu?Ile?Asp?Lys?Gly
Ile?Tyr?Gln?Thr?Ser?Asn?Phe?Arg?Val?Val?Pro?Ser?Gly?Asp?Val?Val?Arg?Phe?Pro
Asn?Ile?Thr?Asn?Leu?Cys?Pro?Phe?Gly?Glu?Val?Phe?Asn?Ala?Thr?Lys?Phe?Pro?Ser
Val?Tyr?Ala?Trp?Glu?Arg?Lys?Lys?Ile?Ser?Asn?Cys?Val?Ala?Asp?Tyr?Ser?Val?Leu
Tyr?Asn?Ser?Thr?Phe?Phe?Ser?Thr?Phe?Lys?Cys?Tyr?Gly?Val?Ser?Ala?Thr?Lys?Leu
Asn?Asp?Leu?Cys?Phe?Ser?Asn?Val?Tyr?Ala?Asp?Ser?Phe?Val?Val?Lys?Gly?Asp?Asp
Val?Arg?Gln?Ile?Ala?Pro?Gly?Gln?Thr?Gly?Val?Ile?Ala?Asp?Tyr?Asn?Tyr?Lys?Leu
Pro?Asp?Asp?Phe?Met?Gly?Cys?Val?Leu?Ala?Trp?Asn?Thr?Arg?Asn?Ile?Asp?Ala?Thr
Ser?Thr?Gly?Asn?Tyr?Asn?Tyr?Lys?Tyr?Arg?Tyr?Leu?Arg?His?Gly?Lys?Leu?Arg?Pro
Phe?Glu?Arg?Asp?Ile?Ser?Asn?Val?Pro?Phe
4. the Screening and Identification of expressed fusion protein engineering bacteria:
The positive transformant that will contain recombinant plasmid, be seeded to and contain 3ml LB substratum (containing kanamycin 60 μ g/ml) in vitro, 37 ℃ of shaking culture 3h, add IPTG to final concentration 0.5mmol/L, continue shaking culture and induce 6h, centrifugal collection thalline carries out SDS-PAGE and detects, and recon is expressed the SARS virus S albumen that relative molecular weight is about 37kD, expression amount is about 30%, and contrast bacterium BL21 (DE3) does not have this protein band.
5. express the proteic purifying of SARS virus S:
1) ultrasonic degradation of expression SARS virus S protein engineering bacterium
Centrifugal (8000rpm, 10min, 4 ℃) receives bacterium with the engineering bacteria of abduction delivering fusion rotein, thalline is resuspended in the lysate (50mmol/L Tris-HCl pH8.0,10mmol/L EDTA, 10mmol/LDTT) of original fluid 1/10 volume, ice-bath ultrasonic is broken bacterium 10min, centrifugal (12000rpm, 20min, 4 ℃) collects supernatant, abandons precipitation.The supernatant of collecting is used for next step ion-exchange purification.
2) DEAE-Sepharose FF anion column purifying
DEAE-Sepharose FF anion column is connected to the normal pressure chromatographic system, earlier with balance liquid (50mmol/LTris-HCl pH8.0,1mmol/L EDTA, 0.1mmol/L DTT) flushing balance, to go up the cracking supernatant of step acquisition then and directly go up sample, last sample flow velocity is 1.5ml/min, collects and passes the peak.
3) S-Sepearse FF cation seperation column purifying
To go up step DEAE-Sepharose FF negatively charged ion and pass the peak, in the dialysis tubing of packing into, dialyzate (20mmol/LPB (pH7.4), 1mmol/L EDTA, 0.1mmol/L DTT) be stirred dialysis 4h.With above-mentioned dialyzate flushing balance S-Sepharose FF cation seperation column, sample is directly gone up at the peak that passes after will dialysing then, last sample flow velocity 1.5ml/min.Fully wash post with dialyzate behind the end of the sample, more successively with contain 50,100, the dialyzate eluted protein of 1000mmol/L NaCl, collect 100mmol/L NaCl elution peak albumen, be the SARS virus S albumen of purifying.
6. the SARS virus S albumen of purifying is used as Detection of antigen SARS antibody:
Wrap by elisa plate behind SARS virus S albumen usefulness carbonate (pH9.6) doubling dilution of 50mmol/L with purifying, the indirect enzyme-linked immunosorbent method detects known anti-SARS virus positive serum and normal human serum, SARS virus S albumen can react with the anti-SARS virus positive serum,, do not illustrate that the SARS virus S albumen of virus has better antigenicity and specificity with the normal human serum reaction.
Same horseradish peroxidase (HRP) the mark SARS virus S albumen of using detects anti-SARS virus IgM or IgG antibody with pouncing on the method that obtains, and higher susceptibility and specificity are arranged.SARS virus S albumen detects anti-SARS virus antibody as antigen with golden mark method, and higher susceptibility and specificity are also arranged.
7. with the SARS virus S protein fragments of expressing, be used for vaccine, SARS virus antibody or detection of antigens and be used for immunity preparation anti-SARS virus monoclonal antibody and how anti-etc.
8. synthetic SARS virus S protein gene fragment is connected with other gene fragment, expresses, prepare with the form of fusion rotein.
The advantage that the present invention compared with prior art has
The S protein fragments of the SARS virus that we express has more advantage:
1. the enzyme-linked immunologic detecting kit of the SARS virus antibody of using at present, the antigen of its use is totivirus antigen, produce dangerous, cost is high, with other coronavirus shortcomings such as cross reaction are arranged.The S protein fragments of the SARS virus of expressing can overcome above-mentioned shortcoming as antigen.
2. lack the SARS virus vaccine at present.Inactivated Vaccine has obtained the exhibition of throwing into, but production cost height, dangerous big.The outermost S albumen of SARS virus, be mediation virus and host cell bonded major protein, seal this proteic binding site and can stop virus infected cell, so the S albumen of SARS virus is the first-selected albumen that develops vaccine, we have selected its strong antigen epi-position, utilize genetic engineering technique to express preparation, for the development recombinant vaccine lays the foundation.Recombinant vaccine safety, cost are low.
3. according to the S protein fragments aminoacid sequence of the SARS virus that filters out, the codon of selecting eucaryon and prokaryotic organism all to have a preference for, the gene order that chemosynthesis is brand-new, this gene high expression level in eucaryon and prokaryotic cell prokaryocyte that suits.
4. the proteic engineering bacteria of S of the expression SARS virus that makes up of this paper, expression amount can reach 30% of tropina, is easy to purifying, but large-scale purification prepares this albumen.Do not see Table at present and reach the proteic report of this section.
Description of drawings
The invention will be further described below with reference to accompanying drawing:
Fig. 1 is that molecular biology software carries out analytical results to the proteic epitope of SARS virus S.The result shows, from 460 amino acid of the 162nd amino acid to the, contains strong wetting ability epitope at the S of SARS virus albumen n end, i.e. the position that arrow indicates in the figure.
Fig. 2 is the proteic construction of recombinant plasmid schema of S of expressing SARS virus.
Fig. 3 is the pcr amplification product with 5 recons of Agarose gel detection of 1.2%.M: the low-molecular-weight dna standard (TaKaRa, DL2000); C: the contrast bacterium that contains plasmid pET28a (+); 1～5: 5 transformants all amplify the target gene fragment of 916bp, i.e. the position that arrow indicates in the figure.
Fig. 4 is the SDS-PAGE analytical results of expressing the S albumen reorganization bacterium of SARS virus.M: low molecular weight protein (LMWP) standard (Pharmacia); C: contrast bacterium E.coli BL21 (DE3); 1～5: 1～No. 5 reorganization bacterium, 5 recons are all expressed relative molecular weight and are about 37000 fusion rotein, i.e. the position that arrow indicates in the figure.
Fig. 5 is the SDS-PAGE analytical results of expressing the S protein purification front and back of SARS virus.M: low molecular weight protein (LMWP) standard (Pharmacia); 1: contrast bacterium BL21 (DE3); 2: the proteic engineering bacteria of S of expressing PSARS virus; Behind the 3:S-Sepharose FF cation seperation column purifying the S albumen of SARS virus.
Embodiment
The detailed description of embodiment of the present invention:
The analysis of the S proteantigen epi-position of SARS virus, synthetic the reaching of gene are expressed
By the proteic whole aminoacid sequences of the S of Computer Analysis SARS virus, filter out the interior strong antigen epi-position of S albumen of SARS virus, select the codon of bacterium preference for use, the brand-new gene fragment of the S albumen strong antigen epi-position of chemosynthesis SARS virus.With the BamHI/EcoRI site of gene fragment clone to the plasmid pET28a (+), consistent with the translation framework of initiator codon on the carrier, can express a fusion rotein.With recombinant plasmid transformed e. coli bl21 (DE3), screening has obtained the proteic engineering bacteria of S of highly effectively expressing SARS virus, and the S albumen of the SARS virus of expression accounts for about 30% of tropina total amount.
Materials and methods
1. bacterial classification and plasmid: host bacterium BL21 (DE3) and expression vector pET28a (+) are U.S. Novagen company product.
2. molecular biology reagent: restriction enzyme BamHI, EcoRI, and the T4 dna ligase be TaKaRa company product.Plasmid purification test kit and the test kit that reclaims dna fragmentation in the sepharose are German QIAGEN company product.DTT and IPTG are Promega company product.Other reagent is import or homemade analytical reagent.
3. gene fragment is synthetic: helped synthetic by Dalian TaKaRa company.
The enzyme of gene clone method: DNA cut, connection, electrophoresis; The extraction of plasmid, conversion; General molecular cloning methods such as proteic SDS-PAGE analysis carry out according to a conventional method.Other test kit by specification is operated.
5.DNA sequential analysis: with QIAGEN company plasmid purification test kit plasmid purification, with the full-automatic sequenator order-checking of DNA.
The result
1.SARS screening of the S proteantigen epi-position of virus and gene fragment is synthetic:
Utilize softwares such as ANTHEWIN, by the proteic whole aminoacid sequence (GeneBank of the S of Computer Analysis SARS virus, closing number: AY278488), filter out the interior strong antigen epi-position (Fig. 1) of S albumen of SARS virus, promptly from 460 amino acid of the 162nd amino acid to the, its aminoacid sequence is as follows:
Glu?Tyr?Ile?Ser?Asp?Ala?Phe?Ser?Leu?Asp?Val?Ser?Glu?Lys?Ser?Gly?Asn?Phe?Lys
His?Leu?Arg?Glu?Phe?Val?Phe?Lys?Asn?Lys?Asp?Gly?Phe?Leu?Tyr?Val?Tyr?Lys?Gly
Tyr?Gln?Pro?Ile?Asp?Val?Val?Arg?Asp?Leu?Pro?Ser?Gly?Phe?Asn?Thr?Leu?Lys?Pro
Ile?Phe?Lys?Leu?Pro?Leu?Gly?Ile?Asn?Ile?Thr?Asn?Phe?Arg?Ala?Ile?Leu?Thr?Ala
Phe?Ser?Pro?Ala?Gln?Asp?Thr?Trp?Gly?Thr?Ser?Ala?Ala?Ala?Tyr?Phe?Val?Gly?Tyr
Leu?Lys?Pro?Thr?Thr?Phe?Met?Leu?Lys?Tyr?Asp?Glu?Asn?Gly?Thr?Ile?Thr?Asp?Ala
Val?Asp?Cys?Ser?Gln?Asn?Pro?Leu?Ala?Glu?Leu?Lys?Cys?Ser?Val?Lys?Ser?Phe?Glu
Ile?Asp?Lys?Gly?Ile?Tyr?Gln?Thr?Ser?Asn?Phe?Arg?Val?Val?Pro?Ser?Gly?Asp?Val
Val?Arg?Phe?Pro?Asn?Ile?Thr?Asn?Leu?Cys?Pro?Phe?Gly?Glu?Val?Phe?Asn?Ala?Thr
Lys?Phe?Pro?Ser?Val?Tyr?Ala?Trp?Glu?Arg?Lys?Lys?Ile?Ser?Asn?Cys?Val?Ala?Asp
Tyr?Ser?Val?Leu?Tyr?Asn?Ser?Thr?Phe?Phe?Ser?Thr?Phe?Lys?Cys?Tyr?Gly?Val?Ser
Ala?Thr?Lys?Leu?Asn?Asp?Leu?Cys?Phe?Ser?Asn?Val?Tyr?Ala?Asp?Ser?Phe?Val?Val
Lys?Gly?Asp?Asp?Val?Arg?Gln?Ile?Ala?Pro?Gly?Gln?Thr?Gly?Val?Ile?Ala?Asp?Tyr
Asn?Tyr?Lys?Leu?Pro?Asp?Asp?Phe?Met?Gly?Cys?Val?Leu?Ala?Trp?Asn?Thr?Arg?Asn
Ile?Asp?Ala?Thr?Ser?Thr?Gly?Asn?Tyr?Asn?Tyr?Lys?Tyr?Arg?Tyr?Leu?Arg?His?Gly
Lys?Leu?Arg?Pro?Phe?Glu?Arg?Asp?Ile?Ser?Asn?Val?Pro?Phe
According to the epitope aminoacid sequence in the SARS virus S albumen of screening; the codon of selecting eucaryon and prokaryotic organism all to have a preference for; the gene order that chemosynthesis is brand-new; and BamHI restriction enzyme site (following setting-out part) and two protection bases (GT) have been increased at 5 ' end; increased terminator codon (TAA) and EcoRI restriction enzyme site (following setting-out part) and two protection bases (AC) at 3 ' end, made this gene fragment be easy to be cloned in plasmid pET28a (+) the interior BamHI and EcoRI restriction enzyme site.The dna sequence dna that contains SARS virus S proteantigen epitope gene (916 bp) of chemosynthesis is as follows:
GT GGATCC?GAA?TAC?ATC?TCT?GAC?GCA?TTC?TCT?CTG?GAC?GTT?TCC?GAA?AAG?TCT?GGT?AAC
TTC?AAA?CAC?CTG?CGC?GAG?TTC?GTG?TTT?AAA?AAC?AAA?GAC?GGT?TTC?CTG?TAC?GTT?TAC
AAG?GGC?TAC?CAG?CCG?ATC?GAC?GTA?GTT?CGT?GAC?CTG?CCG?TCT?GGT?TTT?AAC?ACT?CTG
AAA?CCG?ATC?TTC?AAG?CTG?CCG?CTG?GGT?ATT?AAC?ATC?ACT?AAC?TTC?CGC?GCT?ATC?CTG
ACT?GCT?TTC?TCT?CCG?GCT?CAG?GAC?ACT?TGG?GGC?ACT?TCT?GCT?GCA?GCC?TAC?TTC?GTT
GGC?TAC?CTG?AAG?CCA?ACT?ACC?TTT?ATG?CTG?AAG?TAC?GAC?GAA?AAC?GGT?ACT?ATC?ACT
GAT?GCT?GTT?GAC?TGC?TCT?CAG?AAC?CCA?CTG?GCT?GAA?CTG?AAA?TGC?TCT?GTT?AAG?AGC
TTT?GAG?ATC?GAC?AAA?GGT?ATT?TAC?CAG?ACC?TCT?AAC?TTC?CGT?GTT?GTT?CCG?TCT?GGT
GAC?GTT?GTG?CGT?TTC?CCT?AAC?ATC?ACT?AAC?CTG?TGC?CCG?TTT?GGT?GAA?GTT?TTC?AAC
GCT?ACT?AAA?TTC?CCT?TCT?GTC?TAC?GCA?TGG?GAG?CGT?AAA?AAA?ATT?TCT?AAC?TGC?GTT
GCT?GAT?TAC?TCT?GTG?CTG?TAC?AAC?TCT?ACC?TTT?TTC?TCT?ACC?TTC?AAG?TGC?TAC?GGC
GTT?TCT?GCT?ACT?AAG?CTG?AAC?GAC?CTG?TGC?TTC?TCC?AAC?GTT?TAC?GCA?GAT?TCT?TTC
GTA?GTT?AAG?GGT?GAT?GAC?GTA?CGT?CAG?ATC?GCT?CCA?GGT?CAG?ACT?GGT?GTT?ATC?GCT
GAC?TAC?AAC?TAT?AAA?CTG?CCG?GAC?GAT?TTC?ATG?GGT?TGC?GTT?CTG?GCT?TGG?AAC?ACT
CGT?AAC?ATT?GAC?GCT?ACT?TCT?ACT?GGT?AAC?TAC?AAC?TAC?AAA?TAT?CGT?TAC?CTG?CGT
CAC?GGC?AAA?CTG?CGT?CCG?TTC?GAA?CGT?GAC?ATC?TCT?AAC?GTG?CCG?TTC?TAA? GAATTCAC
2. express SARS virus S protein fragments construction of recombinant plasmid:
Extract plasmid pET28a (+) (U.S. Novagen company product),, reclaim the big fragment of plasmid that enzyme is cut behind the electrophoresis, be dissolved in the deionized water with BamH I and EcoR I double digestion.Same SARS virus S protein gene fragment with BamH I and the chemosynthesis of EcoR I double digestion, electrophoresis is dissolved in the deionized water after reclaiming.
Above-mentioned two kinds of enzymes of volumetric molar concentration such as get and cut the back dna fragmentation, in same centrifuge tube, connect with the T4 dna ligase, SARS virus S protein gene fragment is inserted between carrier pET28a (+) interior the BamH I and EcoR I site, consistent with the initiator codon translation framework on the carrier, express a fusion rotein (make up flow process and see Fig. 2).
3. the screening of recombinant plasmid and evaluation:
The recombinant plasmid transformed that the last step was connected arrives e. coli bl21 (DE3), and the converted product coating is contained on the solid LB substratum of kantlex (60 μ g/ml), puts 37 ℃ of overnight incubation.5 transformant bacterium colonies of random choose next day (being labeled as respectively 1-5 number) and 1 contrast bacterium (plasmid pET28a transformed bacteria), be inoculated into respectively and contain 4ml liquid LB substratum (containing kantlex 60 μ g/ml) in vitro, put 37 ℃ of shaking culture 6h, get bacterium liquid 1ml, centrifugal receipts bacterium.Use 50 μ l deionized water suspension thalline respectively, boiling water boils 5min, centrifugal (4 ℃, 12000rpm) 5min, get supernatant (in plasmid is arranged) 2 μ l as pcr template, pcr amplification inserts and carries intravital SARS virus S protein gene fragment, the PCR reaction density is: plasmid template 2 μ l, each 1 μ l of segmental normal chain P1 of SARS virus S protein gene (GAATACATCTCTGACGCATTC) and minus strand primer P2 (TTAGAACGGCACGTTAGAGAT), 10xBuffer 5.0 μ l, 2.5mmol/L dNTP4.0 μ l, Taq archaeal dna polymerase 0.5 μ l (2.5U), deionized water 36.5 μ l, cumulative volume 50 μ l.Amplification condition is: 94 ℃ 30 seconds, 65 ℃ 30 seconds, 72 ℃ 60 seconds, 35 circulations; Last 72 ℃ were extended 7 minutes.Get pcr amplification product 5 μ l, the Agarose gel detection with 1.2%, the result, 5 transformants all amplify the target gene fragment (see figure 3) of 900bp, and the contrast bacterium that contains plasmid pET28a (+) does not amplify this gene fragment.Tentative confirmation, these 5 transformants all contain SARS virus S protein gene fragment.
Extract the plasmid of No. 1 recon, measure the SARS virus S protein gene sequence in the plasmid, dna sequence analysis confirms that recombinant plasmid contains synthetic SARS virus S protein gene fragment, and sequence is entirely true:
GAA?TAC?ATC?TCT?GAC?GCA?TTC?TCT?CTG?GAC?GTT?TCC?GAA?AAG?TCT?GGT?AAC?TTC?AAA
CAC?CTG?CGC?GAG?TTC?GTG?TTT?AAA?AAC?AAA?GAC?GGT?TTC?CTG?TAC?GTT?TAC?AAG?GGC
TAC?CAG?CCG?ATC?GAC?GTA?GTT?CGT?GAC?CTG?CCG?TCT?GGT?TTT?AAC?ACT?CTG?AAA?CCG
ATC?TTC?AAG?CTG?CCG?CTG?GGT?ATT?AAC?ATC?ACT?AAC?TTC?CGC?GCT?ATC?CTG?ACT?GCT
TTC?TCT?CCG?GCT?CAG?GAC?ACT?TGG?GGC?ACT?TCT?GCT?GCA?GCC?TAC?TTC?GTT?GGC?TAC
CTG?AAG?CCA?ACT?ACC?TTT?ATG?CTG?AAG?TAC?GAC?GAA?AAC?GGT?ACT?ATC?ACT?GAT?GCT
GTT?GAC?TGC?TCT?CAG?AAC?CCA?CTG?GCT?GAA?CTG?AAA?TGC?TCT?GTT?AAG?AGC?TTT?GAG
ATC?GAC?AAA?GGT?ATT?TAC?CAG?ACC?TCT?AAC?TTC?CGT?GTT?GTT?CCG?TCT?GGT?GAC?GTT
GTG?CGT?TTC?CCT?AAC?ATC?ACT?AAC?CTG?TGC?CCG?TTT?GGT?GAA?GTT?TTC?AAC?GCT?ACT
AAA?TTC?CCT?TCT?GTC?TAC?GCA?TGG?GAG?CGT?AAA?AAA?ATT?TCT?AAC?TGC?GTT?GCT?GAT
TAC?TCT?GTG?CTG?TAC?AAC?TCT?ACC?TTT?TTC?TCT?ACC?TTC?AAG?TGC?TAC?GGC?GTT?TCT
GCT?ACT?AAG?CTG?AAC?GAC?CTG?TGC?TTC?TCC?AAC?GTT?TAC?GCA?GAT?TCT?TTC?GTA?GTT
AAG?GGT?GAT?GAC?GTA?CGT?CAG?ATC?GCT?CCA?GGT?CAG?ACT?GGT?GTT?ATC?GCT?GAC?TAC
AAC?TAT?AAA?CTG?CCG?GAC?GAT?TTC?ATG?GGT?TGC?GTT?CTG?GCT?TGG?AAC?ACT?CGT?AAC
ATT?GAC?GCT?ACT?TCT?ACT?GGT?AAC?TAC?AAC?TAC?AAA?TAT?CGT?TAC?CTG?CGT?CAC?GGC
AAA?CTG?CGT?CCG?TTC?GAA?CGT?GAC?ATC?TCT?AAC?GTG?CCG?TTC?TAA
The virus S protein fragment (299 amino acid) of the expression of recombinant plasmid SARS that makes up has merged 34 amino acid on the carrier at its N end, 333 amino acid of total length, and its aminoacid sequence is as follows:
Met?Gly?Ser?Ser?His?His?His?His?His?His?Ser?Ser?Gly?Lys?Val?Pro?Arg?Gly?Ser
His?Met?Ala?Ser?Met?Thr?Gly?Gly?Gln?Gln?Met?Gly?Arg?Gly?Ser?Glu?Tyr?Ile?Ser
Asp?Ala?Phe?Ser?Leu?Asp?Val?Ser?Glu?Lys?Ser?Gly?Asn?Phe?Lys?His?Leu?Arg?Glu
Phe?Val?Phe?Lys?Asn?Lys?Asp?Gly?Phe?Leu?Tyr?Val?Tyr?Lys?Gly?Tyr?Gln?Pro?Ile
Asp?Val?Val?Arg?Asp?Leu?Pro?Ser?Gly?Phe?Asn?Thr?Leu?Lys?Pro?Ile?Phe?Lys?Leu
Pro?Leu?Gly?Ile?Asn?Ile?Thr?Asn?Phe?Arg?Ala?Ile?Leu?Thr?Ala?Phe?Ser?Pro?Ala
Gln?Asp?Thr?Trp?Gly?Thr?Ser?Ala?Ala?Ala?Tyr?Phe?Val?Gly?Tyr?Leu?Lys?Pro?Thr
Thr?Phe?Met?Leu?Lys?Tyr?Asp?Glu?Asn?Gly?Thr?Ile?Thr?Asp?Ala?Val?Asp?Cys?Ser
Gln?Asn?Pro?Leu?Ala?Glu?Leu?Lys?Cys?Ser?Val?Lys?Ser?Phe?Glu?Ile?Asp?Lys?Gly
Ile?Tyr?Gln?Thr?Ser?Asn?Phe?Arg?Val?Val?Pro?Ser?Gly?Asp?Val?Val?Arg?Phe?Pro
Asn?Ile?Thr?Asn?Leu?Cys?Pro?Phe?Gly?Glu?Val?Phe?Asn?Ala?Thr?Lys?Phe?Pro?Ser
Val?Tyr?Ala?Trp?Glu?Arg?Lys?Lys?Ile?Ser?Asn?Cys?Val?Ala?Asp?Tyr?Ser?Val?Leu
Tyr?Asn?Ser?Thr?Phe?Phe?Ser?Thr?Phe?Lys?Cys?Tyr?Gly?Val?Ser?Ala?Thr?Lys?Leu
Asn?Asp?Leu?Cys?Phe?Ser?Asn?Val?Tyr?Ala?Asp?Ser?Phe?Val?Val?Lys?Gly?Asp?Asp
Val?Arg?Gln?Ile?Ala?Pro?Gly?Gln?Thr?Gly?Val?Ile?Ala?Asp?Tyr?Asn?Tyr?Lys?Leu
Pro?Asp?Asp?Phe?Met?Gly?Cys?Val?Leu?Ala?Trp?Asn?Thr?Arg?Asn?Ile?Asp?Ala?Thr
Ser?Thr?Gly?Asn?Tyr?Asn?Tyr?Lys?Tyr?Arg?Tyr?Leu?Arg?His?Gly?Lys?Leu?Arg?Pro
Phe?Glu?Arg?Asp?Ile?Ser?Asn?Val?Pro?Phe
4. express the Screening and Identification of SARS virus S protein engineering bacterium:
5 positive transformants and 1 contrast bacterium (plasmid pET28a transformed bacteria) that will contain recombinant plasmid, be seeded to and contain 3ml LB substratum (containing kanamycin 60 μ g/ml) in vitro, 37 ℃ of shaking culture 3h, add IPTG to final concentration 0.5mmol/L, continue shaking culture and induce 6h, centrifugal collection thalline carries out SDS-PAGE and detects, and recon is expressed the SARS virus S albumen that relative molecular weight is about 37kD, expression amount is about 30%, and contrast bacterium BL21 (DE3) does not have this protein band (Fig. 4).
Express the proteic purifying of SARS virus S
According to expressing the proteic aminoacid sequence of SARS virus S, analyze its physicochemical property, determine suitable purification process.Machine analysis as calculated, expressing the proteic iso-electric point of SARS virus S is pH8.5, so our decision with DEAE-SepharoseFF negatively charged ion purifying, is collected and worn the slide peak in pH is the damping fluid of 8.0 Tris-HCl.And then in pH is 7.4 phosphate buffered saline buffer, with S-SepharoseFF positively charged ion purifying.Concrete steps are as follows:
Material and method
1. main agents:
DEAE-SepharoseFF negatively charged ion and S-SepharoseFF positively charged ion gel are Pharmacia company product, and IPTG, DTT are Promega company product.Other reagent is homemade or the import analytical reagent.
2. express the proteic ultrasonic degradation of S of SARS virus:
Centrifugal (the 8000rpm of the proteic engineering bacteria of S with the expression SARS virus of cultivating, 10mins, 4 ℃), abandon supernatant, thalline is resuspended in the lysate (50mmol/L Tris-HCl pH8.0,10mmol/L EDTA, 10mmol/L DTT) of original fluid 1/10 volume, and ice-bath ultrasonic is broken bacterium 10mins, centrifugal (12000rpm, 20mins, 4 ℃) collect supernatant, abandon precipitation.The supernatant of collecting is used for next step ion-exchange purification.
3.DEAE-Sepharoe FF anion column purifying:
With DEAE-Sepharose FF anion column (the high 20cm of glue, diameter 1.2cm) is connected to Bio-Rad normal pressure chromatographic system, earlier with balance liquid (50mmol/L Tris-HCl pH8.0,1mmol/L EDTA, 0.1mMmol/L DTT) flushing balance, to go up the cracking supernatant of step acquisition then and directly go up sample, last sample flow velocity is 1.5ml/min.The peak is passed in collection.。
4.S～Sepharose FF cation seperation column purifying:
To go up step DEAE-Sepharose FF negatively charged ion and pass the peak, in the dialysis tubing of packing into, phosphoric acid salt dialyzate (20mmol/L PB, 1mmol/L EDTA, 0.1mmol/L DTT) the stirring dialysis 4h of pH7.4.With above-mentioned dialyzate flushing balance S-Sepharose FF cation seperation column, sample is directly gone up at the peak that passes after will dialysing then, last sample flow velocity 1.5ml/min.Fully wash post with dialyzate behind the end of the sample, make stylus be back to baseline, more successively with contain 50,100, the dialyzate eluted protein of 1000mmol/L NaCl, collect each elution peak albumen and carry out SDS-PAGE and detect.
The result
Different concns NaCl albumen of wash-out from the S-Sepharose FF post is carried out SDS-PAGE to be analyzed, the result shows (see figure 5), the S albumen of SARS virus exists only in the 100mmol/L NaCl elution peak, the S protein band (37kD place) of a dense SARS virus of colour developing, the S protein band of no obvious SARS virus in other elution peak.
Proteic evaluation of the S of purifying SARS virus and application
The reorganization SARS virus S albumen of purifying is used as antigen,, detects anti-SARS virus antibody (IgM or IgG) positive and negative serum, to identify proteic antigenicity of SARS virus S and the specificity of expressing by the indirect ELISA test method.Experimental result shows that this recombinant protein has good antigenicity and specificity, can be used as the Detection of antigen anti-SARS virus antibody.
Material and method
1. anti-SARS virus antibody positive serum and normal human serum: the positive control in the anti-SARS virus antibody ELISA test kit that GBI company produces, and the anti-SARS virus antibody positive serum of 2 parts of deactivations.Normal human serum is preserved by this laboratory.
2. integrated enzyme reaction material: elisa plate is that 96 orifice plates are produced in Shenzhen, and the mouse-anti people μ chain monoclonal antibody of horseradish peroxidase (HRP) mark is available from Sigama company.Other material is the conventional material of integrated enzyme reaction.
3.ELISA test: adopt the anti-SARS virus antibody (IgG or IgM) in the indirect ELISA detection serum.Basic step is: usefulness 50mmol/L carbonate solution (pH9.6) dilutes the S albumen bag of SARS virus by elisa plate, every hole 100 μ l, and 4 ℃ are spent the night.Inferior daily confining liquid (10mmol/L phosphate buffered saline buffer, pH7.4,10% lowlenthal serum, 20% calf serum, 0.5%casein, 0.05% sulphur sulphur mercury, 5% sucrose) sealing, every hole 130 μ l, 37 ℃ of 1h (or 4 ℃ spend the night).With anti-SARS virus antibody to be measured (IgG or IgM) the moon, positive serum, with sample diluent (10mmol/L phosphate buffered saline buffer, pH7.4,10% lowlenthal serum, 20% calf serum, 0.5%casein, 0.05% sulphur sulphur mercury, 0.5mmol/L NaCl) dilution back (IgG dilution in 1: 20, IgM 1: 100 dilution), add in the enzyme linked plate holes after the sealing every hole 100 μ l respectively, each sample adds 2 holes, 37 ℃ of reaction 30min are with PBST liquid (10mmol/L phosphate buffered saline buffer, pH7.4,0.5% tween 20) wash 5 times after, the anti-human IgG or the anti-people μ chain monoclonal antibody that add the horseradish peroxidase-labeled of dilution in 1: 5000, every hole 100 μ l, 37 ℃ of reaction 30min, PBST washes 5 times, add substrate TMB solution 100 μ l, 37 ℃ of lucifuge colour developing 10min add 50 μ l 4N sulfuric acid mixing termination reactions, measure the A450 value with enzyme connection instrument.
The result
1. indirect ELISA detects anti-SARS virus antibody (IgG or IgM) in the serum
With bovine serum albumin (the 5th part) co-electrophoresis of the S albumen of the SARS virus of purifying and known different concns, colour developing back relatively, determine that the S protein concentration of the SARS virus of purifying is about 1.5mg/ml.By elisa plate, detect known 2 parts of anti-SARS virus antibody (IgG) positive serums and 1 part of anti-SARS virus antibody (IgM) positive serum with 1: 1000 dilution back of 50mmol/L carbonate solution (pH9.6) bag.The result shows that color reaction all appears in 2 parts of anti-SARS virus antibody positive serums, and the A450 value is respectively 0.857 and 0.731.Color reaction also appears in 1 part of anti-SARS virus antibody (IgM) positive serum, and the A450 value is 0.557.Detected 180 portions of normal human serums simultaneously, their A450 value illustrates that all less than 0.05 the S albumen of SARS virus has antigenicity and specificity preferably.
The SARS virus S gene fragment order table of chemosynthesis
＜110〉Li Yue Xi Taokaihua
＜120〉the SARS virus S gene fragment of chemosynthesis and expression thereof, application
<160>2
<210>1
<211>299
<212>PRT
＜213〉the S protein fragments of SARS virus
<220>
＜223〉contain the S protein fragments of the SARS virus of strong antigen epi-position, the 162nd amino acid-the 460th amino acid, totally 299 amino acid.
<400>1
Glu?Tyr?Ile?Ser?Asp?Ala?Phe?Ser?Leu?Asp?Val?Ser?Glu?Lys?Ser?Gly
1 5 10 15
Asn?Phe?Lys?His?Leu?Arg?Glu?Phe?Val?Phe?Lys?Asn?Lys?Asp?Gly?Phe
20 25 30
Leu?Tyr?Val?Tyr?Lys?Gly?Tyr?Gln?Pro?Ile?Asp?Val?Val?Arg?Asp?Leu
35 40 45
Pro?Ser?Gly?Phe?Asn?Thr?Leu?Lys?Pro?Ile?Phe?Lys?Leu?Pro?Leu?Gly
50 55 60
Ile?Asn?Ile?Thr?Asn?Phe?Arg?Ala?Ile?Leu?Thr?Ala?Phe?Ser?Pro?Ala
65 70 75 80
Gln?Asp?Thr?Trp?Gly?Thr?Ser?Ala?Ala?Ala?Tyr?Phe?Val?Gly?Tyr?Leu
85 90 95
Lys?Pro?Thr?Thr?Phe?Met?Leu?Lys?Tyr?Asp?Glu?Asn?Gly?Thr?Ile?Thr
100 105 110
Asp?Ala?Val?Asp?Cys?Ser?Gln?Asn?Pro?Leu?Ala?Glu?Leu?Lys?Cys?Ser
115 120 125
Val?Lys?Ser?Phe?Glu?Ile?Asp?Lys?Gly?Ile?Tyr?Gln?Thr?Ser?Asn?Phe
130 135 140
Arg?Val?Val?Pro?Ser?Gly?Asp?Val?Val?Arg?Phe?Pro?Asn?Ile?Thr?Asn
145 150 155 160
Leu?Cys?Pro?Phe?Gly?Glu?Val?Phe?Asn?Ala?Thr?Lys?Phe?Pro?Ser?Val
165 170 175
Tyr?Ala?Trp?Glu?Arg?Lys?Lys?Ile?Ser?Asn?Cys?Val?Ala?Asp?Tyr?Ser
180 185 190
Val?Leu?Tyr?Asn?Ser?Thr?Phe?Phe?Ser?Thr?Phe?Lys?Cys?Tyr?Gly?Val
195 200 205
Ser?Ala?Thr?Lys?Leu?Asn?Asp?Leu?Cys?Phe?Ser?Asn?Val?Tyr?Ala?Asp
210 215 220
Ser?Phe?Val?Val?Lys?Gly?Asp?Asp?Val?Arg?Gln?Ile?Ala?Pro?Gly?Gln
225 230 235 240
Thr?Gly?Val?Ile?Ala?Asp?Tyr?Asn?Tyr?Lys?Leu?Pro?Asp?Asp?Phe?Met
245 250 255
Gly?Cys?Val?Leu?Ala?Trp?Asn?Thr?Arg?Asn?Ile?Asp?Ala?Thr?Ser?Thr
260 265 270
Gly?Asn?Tyr?Asn?Tyr?Lys?Tyr?Arg?Tyr?Leu?Arg?His?Gly?Lys?Leu?Arg
275 280 285
Pro?Phe?Glu?Arg?Asp?Ile?Ser?Asn?Val?Pro?Phe
290 295
<210>2
<211>900
<212>DNA
＜213〉artificial sequence
<220>
<221>CDS
<222>(1)...(897)
＜223〉the brand-new gene fragment of synthetic, encoding SARS virus S protein fragment.
<220>
<221>mis-feature
<222>(898)...(900)
＜223〉terminator codon that increases during synthetic gene.
<400>2
GAA?TAC?ATC?TCT?GAC?GCA?TTC?TCT?CTG?GAC?GTT?TCC?GAA?AAG?TCT?GGT?AAC?TTC?AAA?CAC 60
Glu?Tyr?Ile?Ser?Asp?Ala?Phe?Ser?Leu?Asp?Val?Ser?Glu?Lys?Ser?Gly?Asn?Phe?Lys?His
1 5 10 15 20
CTG?CGC?GAG?TTC?GTG?TTT?AAA?AAC?AAA?GAC?GGT?TTC?CTG?TAC?GTT?TAC?AAG?GGC?TAC?CAG 120
Leu?Arg?Glu?Phe?Val?Phe?Lys?Asn?Lys?Asp?Gly?Phe?Leu?Tyr?Val?Tyr?Lys?Gly?Tyr?Gln
25 30 35 40
CCG?ATC?GAC?GTA?GTT?CGT?GAC?CTG?CCG?TCT?GGT?TTT?AAC?ACT?CTG?AAA?CCG?ATC?TTC?AAG 180
Pro?Ile?Asp?Val?Val?Arg?Asp?Leu?Pro?Ser?Gly?Phe?Asn?Thr?Leu?Lys?Pro?Ile?Phe?Lys
45 50 55 60
CTG?CCG?CTG?GGT?ATT?AAC?ATC?ACT?AAC?TTC?CGC?GCT?ATC?CTG?ACT?GCT?TTC?TCT?CCG?GCT 240
Leu?Pro?Leu?Gly?Ile?Asn?Ile?Thr?Asn?Phe?Arg?Ala?Ile?Leu?Thr?Ala?Phe?Ser?Pro?Ala
65 70 75 80
CAG?GAC?ACT?TGG?GGC?ACT?TCT?GCT?GCA?GCC?TAC?TTC?GTT?GGC?TAC?CTG?AAG?CCA?ACT?ACC 300
Gln?Asp?Thr?Trp?Gly?Thr?Ser?Ala?Ala?Ala?Tyr?Phe?Val?Gly?Tyr?Leu?Lys?Pro?Thr?Thr
85 90 95 100
TTT?ATG?CTG?AAG?TAC?GAC?GAA?AAC?GGT?ACT?ATC?ACT?GAT?GCT?GTT?GAC?TGC?TCT?CAG?AAC 360
Phe?Met?Leu?Lys?Tyr?Asp?Glu?Asn?Gly?Thr?Ile?Thr?Asp?Ala?Val?Asp?Cys?Ser?Gln?Asn
105 110 115 120
CCA?CTG?GCT?GAA?CTG?AAA?TGC?TCT?GTT?AAG?AGC?TTT?GAG?ATC?GAC?AAA?GGT?ATT?TAC?CAG 420
Pro?Leu?Ala?Glu?Leu?Lys?Cys?Ser?Val?Lys?Ser?Phe?Glu?Ile?Asp?Lys?Gly?Ile?Tyr?Gln
125 130 135 140
ACC?TCT?AAC?TTC?CGT?GTT?GTT?CCG?TCT?GGT?GAC?GTT?GTG?CGT?TTC?CCT?AAC?ATC?ACT?AAC 480
Thr?Ser?Asn?Phe?Arg?Val?Val?Pro?Ser?Gly?Asp?Val?Val?Arg?Phe?Pro?Asn?Ile?Thr?Asn
145 150 155 160
CTG?TGC?CCG?TTT?GGT?GAA?GTT?TTC?AAC?GCT?ACT?AAA?TTC?CCT?TCT?GTC?TAC?GCA?TGG?GAG 540
Leu?Cys?Pro?Phe?Gly?Glu?Val?Phe?Asn?Ala?Thr?Lys?Phe?Pro?Ser?Val?Tyr?Ala?Trp?Glu
165 170 175 180
CGT?AAA?AAA?ATT?TCT?AAC?TGC?GTT?GCT?GAT?TAC?TCT?GTG?CTG?TAC?AAC?TCT?ACC?TTT?TTC 600
Arg?Lys?Lys?Ile?Ser?Asn?Cys?Val?Ala?Asp?Tyr?Ser?Val?Leu?Tyr?Asn?Ser?Thr?Phe?Phe
185 190 195 200
TCT?ACC?TTC?AAG?TGC?TAC?GGC?GTT?TCT?GCT?ACT?AAG?CTG?AAC?GAC?CTG?TGC?TTC?TCC?AAC 660
Ser?Thr?Phe?Lys?Cys?Tyr?Gly?Val?Ser?Ala?Thr?Lys?Leu?Asn?Asp?Leu?Cys?Phe?Ser?Asn
205 210 215 220
GTT?TAC?GCA?GAT?TCT?TTC?GTA?GTT?AAG?GGT?GAT?GAC?GTA?CGT?CAG?ATC?GCT?CCA?GGT?CAG 720
Val?Tyr?Ala?Asp?Ser?Phe?Val?Val?Lys?Gly?Asp?Asp?Val?Arg?Gln?Ile?Ala?Pro?Gly?Gln
225 230 235 240
ACT?GGT?GTT?ATC?GCT?GAC?TAC?AAC?TAT?AAA?CTG?CCG?GAC?GAT?TTC?ATG?GGT?TGC?GTT?CTG 780
Thr?Gly?Val?Ile?Ala?Asp?Tyr?Asn?Tyr?Lys?Leu?Pro?Asp?Asp?Phe?Met?Gly?Cys?Val?Leu
245 250 255 260
GCT?TGG?AAC?ACT?CGT?AAC?ATT?GAC?GCT?ACT?TCT?ACT?GGT?AAC?TAC?AAC?TAC?AAA?TAT?CGT 840
Ala?Trp?Asn?Thr?Arg?Asn?Ile?Asp?Ala?Thr?Ser?Thr?Gly?Asn?Tyr?Asn?Tyr?Lys?Tyr?Arg
265 270 275 280
TAC?CTG?CGT?CAC?GGC?AAA?CTG?CGT?CCG?TTC?GAA?CGT?GAC?ATC?TCT?AAC?GTG?CCG?TTC?TAA 900
Tyr?Leu?Arg?His?Gly?Lys?Leu?Arg?Pro?Phe?Glu?Arg?Asp?Ile?Ser?Asn?Val?Pro?Phe
285 290 295

Claims (4)

1. the proteic gene fragment of the SARS virus S of a chemosynthesis; this gene fragment coding contains the S protein fragments of the SARS virus of strong antigen epi-position; i.e. 460 amino acid of the 162nd amino acid to the; totally 299 amino acid; 5 ' end in this gene fragment has increased BamHI restriction enzyme site and two protection bases G T; increased terminator codon TAA and EcoRI restriction enzyme site and two protection base AC at 3 ' end, the gene order total length 916bp of chemosynthesis, sequence is as follows:
GT GGATCC?GAA?TAC?ATC?TCT?GAC?GCA?TTC?TCT?CTG?GAC?GTT?TCC?GAA?AAG?TCT?GGT
AAC TTC AAA?CAC?CTG?CGC?GAG?TTC?GTG?TTT?AAA?AAC?AAA?GAC?GGT?TTC?CTG?TAC
GTT TAC AAG?GGC?TAC?CAG?CCG?ATC?GAC?GTA?GTT?CGT?GAC?CTG?CCG?TCT?GGT?TTT
AAC ACT CTG?AAA?CCG?ATC?TTC?AAG?CTG?CCG?CTG?GGT?ATT?AAC?ATC?ACT?AAC?TTC
CGC GCT ATC?CTG?ACT?GCT?TTC?TCT?CCG?GCT?CAG?GAC?ACT?TGG?GGC?ACT?TCT?GCT
GCA GCC TAC?TTC?GTT?GGC?TAC?CTG?AAG?CCA?ACT?ACC?TTT?ATG?CTG?AAG?TAC?GAC
GAA AAC GGT?ACT?ATC?ACT?GAT?GCT?GTT?GAC?TGC?TCT?CAG?AAC?CCA?CTG?GCT?GAA
CTG AAA TGC?TCT?GTT?AAG?AGC?TTT?GAG?ATC?GAC?AAA?GGT?ATT?TAC?CAG?ACC?TCT
AAC TTC CGT?GTT?GTT?CCG?TCT?GGT?GAC?GTT?GTG?CGT?TTC?CCT?AAC?ATC?ACT?AAC
CTG TGC CCG?TTT?GGT?GAA?GTT?TTC?AAC?GCT?ACT?AAA?TTC?CCT?TCT?GTC?TAC?GCA
TGG GAG CGT?AAA?AAA?ATT?TCT?AAC?TGC?GTT?GCT?GAT?TAC?TCT?GTG?CTG?TAC?AAC
TCT ACC TTT?TTC?TCT?ACC?TTC?AAG?TGC?TAC?GGC?GTT?TCT?GCT?ACT?AAG?CTG?AAC
GAC CTG TGC?TTC?TCC?AAC?GTT?TAC?GCA?GAT?TCT?TTC?GTA?GTT?AAG?GGT?GAT?GAC
GTA CGT CAG?ATC?GCT?CCA?GGT?CAG?ACT?GGT?GTT?ATC?GCT?GAC?TAC?AAC?TAT?AAA
CTG CCG GAC?GAT?TTC?ATG?GGT?TGC?GTT?CTG?GCT?TGG?AAC?ACT?CGT?AAC?ATT?GAC
GCT ACT TCT?ACT?GGT?AAC?TAC?AAC?TAC?AAA?TAT?CGT?TAC?CTG?CGT?CAC?GGC?AAA
CTG CGT CCG?TTC?GAA?CGT?GAC?ATC?TCT?AAC?GTG?CCG?TTC?TAA GAATTCAC。
2. the gene fragment of the described chemosynthesis of claim 1, adopt genetic engineering technique to express the S protein fragments of the SARS virus of this gene order coding, purifying expressed proteins fragment, concrete grammar is as follows: express SARS virus S protein fragments construction of recombinant plasmid:
SARS virus S protein gene fragment with BamHI and EcoRI double digestion plasmid pET28a (+) and chemosynthesis, after electrophoresis reclaims, connect with the T4 dna ligase, SARS virus S protein gene fragment is inserted between carrier pET28a (+) the interior BamHI and EcoRI site, consistent with the initiator codon translation framework on the carrier, express a fusion rotein, 333 amino acid of total length, this fusion rotein N end has merged 34 amino acid on the carrier, the C end comprises 460 amino acid of the 162nd amino acid to the in the SARS virus S albumen, and full length amino acid sequence is as follows:
Met?Gly?Ser?Ser?His?His?His?His?His?His?Ser?Ser?Gly?Lys?Val?Pro?Arg?Gly
Ser?His?Met?Ala?Ser?Met?Thr?Gly?Gly?Gln?Gln?Met?Gly?Arg?Gly?Set?Glu?Tyr
Ile?Ser?Asp?Ala?Phe?Set?Leu?Asp?Val?Set?Glu?Lys?Set?Gly?Asn?Phe?Lys?His
Leu?Arg?Glu?Phe?Val?Phe?Lys?Asn?Lys?Asp?Gly?Phe?Leu?Tyr?Val?Tyr?Lys?Gly
Tyr?Gln?Pro?Ile?Asp?Val?Val?Arg?Asp?Leu?Pro?Ser?Gly?Phe?Asn?Thr?Leu?Lys
Pro?Ile?Phe?Lys?Leu?Pro?Leu?Gly?Ile?Asn?Ile?Thr?Asn?Phe?Arg?Ala?Ile?Leu
Thr?Ala?Phe?Ser?Pro?Ala?Gln?Asp?Thr?Trp?Gly?Thr?Ser?Ala?Ala?Ala?Tyr?Phe
Val?Gly?Tyr?Leu?Lys?Pro?Thr?Thr?Phe?Met?Leu?Lys?Tyr?Asp?Glu?Asn?Gly?Thr
Ile?Thr?Asp?Ala?Val?Asp?Cys?Ser?Gln?Asn?Pro?Leu?Ala?Glu?Leu?Lys?Cys?Ser
Val?Lys?Ser?Phe?Glu?Ile?Asp?Lys?Gly?Ile?Tyr?Gln?Thr?Ser?Asn?Phe?Arg?Val
Val?Pro?Ser?Gly?Asp?Val?Val?Arg?Phe?Pro?Asn?Ile?Thr?Asn?Leu?Cys?Pro?Phe
Gly?Glu?Val?Phe?Asn?Ala?Thr?Lys?Phe?Pro?Ser?Val?Tyr?Ala?Trp?Glu?Arg?Lys
Lys?Ile?Ser?Asn?Cys?Val?Ala?Asp?Tyr?Ser?Val?Leu?Tyr?Asn?Ser?Thr?Phe?Phe
Ser?Thr?Phe?Lys?Cys?Tyr?Gly?Val?Ser?Ala?Thr?Lys?Leu?Asn?Asp?Leu?Cys?Phe
Ser?Asn?Val?Tyr?Ala?Asp?Ser?Phe?Val?Val?Lys?Gly?Asp?Asp?Val?Arg?Gln?Ile
Ala?Pro?Gly?Gln?Thr?Gly?Val?Ile?Ala?Asp?Tyr?Asn?Tyr?Lys?Leu?Pro?Asp?Asp
Phe?Met?Gly?Cys?Val?Leu?Ala?Trp?Asn?Thr?Arg?Asn?Ile?Asp?Ala?Thr?Ser?Thr
Gly?Asn?Tyr?Asn?Tyr?Lys?Tyr?Arg?Tyr?Leu?Arg?His?Gly?Lys?Leu?Arg?Pro?Phe
Glu?Arg?Asp?Ile?Ser?Asn?Val?Pro?Phe
The Screening and Identification of expressed fusion protein engineering bacteria:
With the recombinant plasmid transformed e. coli bl21, coating contains the LB flat board of 60 μ g/ml kantlex, putting 37 ℃ spends the night, next day, picking transformed bacterium colony and the contrast bacterium that contains plasmid pET28a (+) at random, extract plasmid, plasmid with extraction is a template, pcr amplification SARS virus S protein gene fragment, contain the segmental positive recombinant plasmid of SARS virus S protein gene, should amplify the gene fragment that is about 916bp, will contain the positive transformant of recombinant plasmid, be seeded in the LB substratum that contains kantlex 60 μ g/mL, 37 ℃ of shaking culture 3h add IPTG to final concentration 0.5～1.0mmol/L, continue shaking culture and induce 4～6h, centrifugal collection thalline carries out SDS-PAGE and detects, recon is expressed the SARS virus S albumen that relative molecular weight is about 37kD, and expression amount is about 30%, and contrast bacterium BL21 does not have this protein band;
Express the proteic purifying of SARS virus S:
With the centrifugal receipts of the engineering bacteria of abduction delivering fusion rotein bacterium, thalline is resuspended in the lysate, lysate is 50mmol/L Tris-HCl pH8.0,10mmol/L EDTA, 10mmol/L DTT, carrying out ultrasonic bacteria breaking 10min, centrifugal collection supernatant, supernatant is directly gone up sample DEAE-Sepharose FF anion column, with the flushing of Tris-HCl damping fluid, collects and passes the peak earlier;
To go up step DEAE-Sepharose FF negatively charged ion and pass the peak, pack in the dialysis tubing, phosphoric acid salt dialyzate to pH7.4 stirs dialysis 4h, last sample S-Sepharose FF cation seperation column, with the NaCl eluant solution albumen that contains gradient concentration, collect 100mmol/L NaCl elution peak albumen, be the SARS virus S protein fragments of purifying.
3. the proteic gene fragment order of the SARS virus S of the described chemosynthesis of claim 1 utilizes bacterium, yeast cell, insect cell, mammalian cell and genetically modified animals and plants to carry out recombinant expressed, preparation.
4. the application of SARS virus S protein fragments in the SARS virus detection of antibodies of the described method preparation of claim 2 and claim 3.
CNB031318797A 2003-06-13 2003-06-13 Chemosynthesized SARS virus S gene segement, its expression and application Expired - Fee Related CN1184319C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CNB031318797A CN1184319C (en) 2003-06-13 2003-06-13 Chemosynthesized SARS virus S gene segement, its expression and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNB031318797A CN1184319C (en) 2003-06-13 2003-06-13 Chemosynthesized SARS virus S gene segement, its expression and application

Publications (2)

Publication Number Publication Date
CN1472321A CN1472321A (en) 2004-02-04
CN1184319C true CN1184319C (en) 2005-01-12

Family

ID=34153905

Family Applications (1)

Application Number Title Priority Date Filing Date
CNB031318797A Expired - Fee Related CN1184319C (en) 2003-06-13 2003-06-13 Chemosynthesized SARS virus S gene segement, its expression and application

Country Status (1)

Country Link
CN (1) CN1184319C (en)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005012337A2 (en) * 2003-07-15 2005-02-10 Crucell Holland B.V. Antigenic peptides of sars coronavirus and uses thereof
CN1319596C (en) * 2004-05-20 2007-06-06 南京大学 Prepn process of S190 polypeptide vaccine and its application in resisting SARS virus
CN100379869C (en) * 2004-08-09 2008-04-09 生宝生物科技股份有限公司 Super antigen fusion protein and its application method
CN100339390C (en) * 2004-09-08 2007-09-26 中国医学科学院药物研究所 Coronavirus specific T-cellantigen determinate cluster
CN101102794B (en) * 2004-11-11 2012-04-25 克鲁塞尔荷兰公司 Compositions against sars-coronavirus and uses thereof
CN101173290B (en) * 2007-10-24 2010-10-27 李越希 Chemically synthesized HSV1 virus gB glucoprotein extracellular region gene fragment, representation and application of the same
CN111217920B (en) * 2020-03-10 2020-11-17 河北精硕生物科技有限公司 N-S dominant epitope fusion protein of new coronavirus, preparation method and application thereof, expression protein, microorganism, application thereof and kit
CN111289745A (en) * 2020-03-25 2020-06-16 中山生物工程有限公司 Novel coronavirus IgM antibody enzyme-linked immunoassay kit and detection method thereof
CN111122864A (en) * 2020-03-25 2020-05-08 中山生物工程有限公司 Novel coronavirus IgG antibody enzyme-linked immunoassay kit and detection method thereof
WO2021212568A1 (en) * 2020-04-21 2021-10-28 苏州方科生物科技有限公司 Novel coronavirus specific antigen peptide and use thereof

Also Published As

Publication number Publication date
CN1472321A (en) 2004-02-04

Similar Documents

Publication Publication Date Title
CN1884303A (en) SARS-CoV virus structural protein infusion protein and its high yield expression and purification and uses
CN1460111A (en) HIV peptides from conserved regions in GAGP 17 and 924 and their application in e.g. vaccines
CN1184319C (en) Chemosynthesized SARS virus S gene segement, its expression and application
CN85106190A (en) The production of hepatitis B virus surface antigen
CN1877330A (en) Enzyme-linked immunologic diagnosis kit for core antigen of C type hepatitis virus and method for preparing same
CN1556857A (en) Novel peptides of the respiratory syncytial virus (RSV) G protein and their use in a vaccine
CN101031647A (en) Process for producing erysipelothrix rhusiopathiae surface protective antigen mutant in escherichia coli
CN1194991C (en) Recombinant Toxoplasma fusion protein antigen and preparation process and use thereof
CN1130566C (en) Diagnostic kit and method for the simultaneous diagnosis of hepatitis B and C
CN1866023A (en) Method for synchronous detection of multiple tubercle bacillus specific secretion antigens
CN1255540C (en) Vaccine-induced hepatitis B viral strain and uses thereof
CN1807452A (en) Helicobacter Pylori urease B subunit Th epitope peptide, its coding DNA, vaccine and uses
CN87105411A (en) The T cell in S district and B cell antigen decision base before the hepatitis B virus surface antigen
CN1079509A (en) HIV antigen
CN1207307C (en) Recombination human cytomegalovirus fusion protein and its preparing method, application
CN1765929A (en) Contain the fusion rotein of peptide carrier and Urogastron and nucleic acid and uses thereof
CN1737144A (en) Composite multiple epitope bivalent nucleic acid vaccine construction for foot-and-mouth disease
CN1495262A (en) Non-splicing variant of gp 350/220
CN1531548A (en) Chimeric chains that code for proteins that induce effects directed against viruses
CN1305525C (en) 0157 bacterium gene engineering multivalence subunit vaccine of human and sensitive animals and its preparing method
CN1763203A (en) Gene recombinant human cytomegalovirus fusion protein pp150/MDBP, preparation process and application thereof
CN1156491C (en) Modified treponema pallidum outer membrane protein, its immunoassay use and immunoassay kit
CN1290579C (en) Recombinant foot-and-mouth disease virus VP1 confluent protein vaccine
CN1609213A (en) Gene cloning of polyepitope antigen of hepatitis C virus and its coding sequence
CN1850977A (en) Soluble colibacillus expression plasmid and its use

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C19 Lapse of patent right due to non-payment of the annual fee
CF01 Termination of patent right due to non-payment of annual fee