CN1130566C

CN1130566C - Diagnostic kit and method for the simultaneous diagnosis of hepatitis B and C

Info

Publication number: CN1130566C
Application number: CN 94191953
Authority: CN
Inventors: 曹重明; 崔德永; 金天炯; 苏弘燮; 梁宰荣; 金仁寿; 崔东燮
Original assignee: Lucky Ltd
Current assignee: LG Corp
Priority date: 1993-04-28
Filing date: 1994-04-27
Publication date: 2003-12-10
Anticipated expiration: 2014-04-27
Also published as: JPH08504954A; JP3136327B2; KR100312534B1; WO1994025874A1; CN1122162A

Abstract

The present invention relates to a diagnostic kit for the simultaneous diagnosis of hepatitis B and hepatitis C and a diagnostic method therefor by employing said diagnostic kit; and, more specifically, to a diagnostic kit for the simultaneous diagnosis of hepatitis B and C comprising a hepatitis B and a hepatitis C viral antigens together, and a diagnostic method utilizing said kit.

Description

Be used for detecting simultaneously the kit and the method for hepatitis type B virus and hepatitis C virus

Invention field

The present invention relates to a kind of detection method of detecting the kit of hepatitis type B virus and hepatitis C virus simultaneously and adopting described kit of being used for.More specifically, the present invention relates to a kind of kit that is used for detecting simultaneously hepatitis type B virus and hepatitis C virus that comprises hepatitis B and C hepatitis virus antigen, and the detection method that adopts described kit.

Background of invention

In general, the hepatitis that known viruse brings out is caused that by various hepatitis viruss these viruses comprise hepatitis A virus, hepatitis type B virus, Hepatitis D virus, hepatitis E virus, cytomegalovirus and Epstein-Barr virus.

In these viruses, hepatitis type B virus (HBV) is a kind of hepadnavirus and the known various hepatopathys that comprise liver cancer that cause.HBV has the 3.2kb double-stranded DNA, it comprises 4 open reading frame (Garnem that the X gene of C gene, the P gene of coding DNA polymerase and the unidentified X protein of encoding of the S gene of encoded packets memebrane protein, the core protein of encoding is formed, D. wait the people, Ann.Rev.Biochem., 50,651-693 (1987)).

The HBV antigen that comprises HBV surface antigen, cAg and e antigen has been used to diagnosis of hepatitis b, and it is to be undertaken by infect the antibody that forms in the back detection serum at HBV.Particularly cAg is for detecting hepatitis B of great use in the starting stage, because anti-cAg antibody will soon form after infecting HBV and all can detect in each patient's who is infected by HBV almost serum; And, surface antigen definite hepatitis B whether aspect the recovery from illness of great use because find to have antibody-to-surface antigen in the recovery stage of hepatitis B.

In addition, known 70-80% in transfusional hepatitis causes that by hepatitis C virus (HCV) (Lancet 2 for A1ter, people such as H.J., 838-841 (1975); Dienstag, people such as J.L., Seminar Liver Dis., 6,67-81 (1986)); And this post-transfusion hepatitis can develop into cirrhosis or hepatocellular carcinoma usually.Described virus is a kind of RNA viruses of being made up of a RNA normal chain and produces a polyprotein precursor (Choo, people such as Q.L., Science, 244,359-362 (1989) by the open reading frame (ORF) of described chain; Choo, Q.L waits the people, Proc.Natl.Acad.Sci.USA, 88,2451-2455 (1991)).

The gene structure of hepatitis C virus similar (Miller, people such as R.H., Proc.Natl.Acad.Sci, 87,2057-2061 (1990) to the unit structure of flavivirus or pestivirus; Muraiso, K. wait the people, Biochem.Biophys.Res.Commun., 172,511-516 (1991)), and with described pass is the basis, the polyprotein of inferring hepatitis C virus from the N end to the C end successively by core-coating 1 (E1)-coating 2/ non-structure 1 albumen (E2/NS1)-non-structure 2 albumen (NS2)-non-structure 3 albumen (NS3)-non-structure 4 albumen (NS4)-non-structure 5 albumen (NS5) (Choo, Q.L. etc., Proc.Natl.Acad.Sci.USA, 88,2451-2455 (1991); Takamizawa.A. etc., J.Virol.65,1105-1113 (1991); Kato, N. etc., Proc.Natl.Acad.Sci.USA, 87,6524-6528 (1990)).

The infection of hepatitis C virus can be diagnosed (Hosoda, K. etc., Hepatology, 15,777-781 (1992) by directly detecting HCV RNA with polymerase chain reaction (PCR) from blood sample; Abe, K. etc., Hepatology, 15,690-695 (1992); Alter, H.J., Annals ofInternal Medicine 115,644-649 (1991)), can detect viral RNA at an easy rate by this method, promptly after infection, can detect in 1 to 2 week; Yet owing to need to analyze a large amount of samples, so this method expense height, the time is long.Another kind of diagnostic method is for example to detect anti-HCV (Choo, Q.L. etc., Proc.Natl.Acad.Sci.USA, 88, the 2451-2455 (1991) that is present in the blood serum sample by the enzyme-linked immunoassay that uses C100-3 albumen; Kuo, G. etc., Science, 244,362-384 (1989)).

Yet, people such as Contreras point out that the diagnostic method of described use ELISA is for the hepatopathy of suffering from except that hepatitis C, for example the patient's of Biliary Cirrhosis, Primary, autoimmunity disease, agnogenic cirrhosis etc. serum false positive results (Contreras occurs through regular meeting, M. etc., Lancet, 2,505 (1989); Cash J.D. etc., Lancet, 2,505 (1989)).People such as Theilmann report is when the first generation diagnostic reagent of using Ortho Diagnostic SystemsInc. and diagnostic method diagnosis, and the patient who suffers from rheumatoid arthritis above 60% demonstrates HCV positive signal (Lancet, 335,1346 (1990)).The above results means that the diagnostic method that uses ELISA may show false positive results, therefore also needs to carry out confirmatory test.

In addition, the Chiron Co. of the U.S. and OrthoDiagnostic Inc. develop a kind of employing recombinant immune trace determination method.(RIBA) the improved diagnostic method of the diagnostic result that obtains with ELISA of conclusive evidence, wherein said improved diagnostic method comprises two HCV specific antigen SOD-5-1-1 and SOD-C100-3 is printed on the nitrocellulose filter, make described antigen and the seroreaction of taking from hepatitis C patients, make antigen-antibody complex with the anti-IgG antibody response of peroxidase labelling, be that whether existing of in serum anti-ICV antibody determined on the basis with the color intensity of each antigen zone then.People such as Baudart are reported in 184 serum samples taking from paraproteinemia (paraproteinemia) patient to diagnose out with the ELISA method has 28 samples to be the HCV positive, yet when proving conclusively the positive serum sample with above-mentioned RIBA method, have only 1 sample to be diagnosed as the positive, 3 samples are waited until definite (Lancet, 336,63 (1990))

The Ortho Diagnostic Systems Inc. of the U.S. has also reported the second generation RIBA diagnostic reagent (RIBA II) that antagonism IICV antibody has the sensitivity of improvement, and it is to prepare by adding cAg C22-3 and non-structure 3 antigens c 33C in the first generation diagnostic reagent that is pre-existing in.It is more Zao and sensitivity is higher (J.Clin.Microbiol.30 (3), 552 (1992)) that people such as Vallari report that the spot immune trace determination method of using the diagnostic reagent comprise described C22-3, C33C and C100-3 albumen detects HCV antigen/antibody combination than the method for only using C100-3 albumen.

In most of the cases, hepatitis B is to diagnose respectively by different kits and sample with hepatitis C, and its expense is high and need a large amount of samples, but the specificity and the accuracy of existing method are unsatisfactory.

The inventor is devoted to develop and a kind ofly has higher sensitivity and specific kit and/or the method that is used for detecting simultaneously hepatitis type B virus and hepatitis C virus than existing ELISA method or RIBA method.

The present invention's general introduction

Therefore, fundamental purpose of the present invention is to provide a kind of kit that is used for detecting simultaneously hepatitis type B virus and hepatitis C virus.

Another object of the present invention is to provide a kind of detection method of using described kit to detect hepatitis type B virus and hepatitis C virus simultaneously.

According to an aspect of the present invention, a kind of kit is provided, it comprises: comprise one or more HCV antigen protein of the core protein of hepatitis C virus, non-structure 3 albumen, non-structure 4 albumen, non-structure 5 albumen and one or more epitope of envelope protein, and one or more HBV antigen protein that comprises one or more epitope of the core protein of hepatitis type B virus and surface antigen protein.

According to a further aspect in the invention, provide a kind of method that is used for detecting simultaneously hepatitis type B virus and hepatitis C virus of using kit of the present invention.

Brief description of drawings

Above and other objects of the present invention and characteristics will be clearer by the description of following preferred embodiment in conjunction with the accompanying drawings, wherein:

Fig. 1 has shown the nucleotide sequence of encoded K HCV CORE14 albumen, and by its encoded polypeptides amino acid sequence;

Fig. 2 has described the nucleotide sequence of encoded K HCV 897 albumen, and by the amino acid sequence of its encoded polypeptides;

Fig. 3 has described the nucleotide sequence of encoded K HCV NS4 albumen, and by the amino acid sequence of its encoded polypeptides;

Fig. 4 has represented the nucleotide sequence of encoded K HCV EIG, KHCVE2A and KHCV E2E respectively, and by the amino acid sequence of its encoded polypeptides;

Fig. 5 has shown the nucleotide sequence of encoded K HCV NS5-1.2 albumen, and by the amino acid sequence of its encoded polypeptides;

Fig. 6 has described the nucleotide sequence of HBV core gene, and by the amino acid sequence of its encoded polypeptides;

Fig. 7 represents the nucleotide sequence of a kind of HBV surface antigen of coding, and by the amino acid sequence of its encoded polypeptides;

Fig. 8 shows a kind of expression vector, is used to express and the encoded K HCV CORE14 albumen of ubiquitin gene fusion and the nucleotide sequence of KHCV897 albumen;

Fig. 9 A shows the result of the SDS-polyacrylamide gel electrophoresis (SDS-PAGE) behind the nucleotide sequence of expressing encoded K HCN UBCORE14 albumen and KHCV UB897 albumen in Bacillus coli cells respectively;

Fig. 9 B carries out the result of western blot analysis to the gel of Fig. 9 A for the serum that uses hepatitis C patients;

Figure 10 shows a kind of preparation of expression vectors strategy that is used to express with the nucleotide sequence of the encoded K HCV NS4E albumen of ubiquitin gene fusion of preparation;

Figure 11 A shows in the colibacillus cell SDS-PAGE result behind the nucleotide sequence of expressing encoded K HCN UBNS4E albumen;

Figure 11 B carries out the result of western blot analysis to the gel of Figure 11 A for the serum that uses hepatitis C patients;

Figure 12 shows dna fragmentation and the ubiquitin gene that is used to connect encoded K HCV E1G, KHCV E2A and KHCV E2E, and the strategy for preparing the expression vector of the DNA (UBE1E2 DNA) that is used to express connection;

Figure 13 A is the result of the SDS-PAGE after UB E1E2 DNA expresses in Bacillus coli cells;

Figure 13 B carries out the result of western blot analysis to the gel of Figure 13 A for the serum that uses hepatitis C patients;

Figure 14 schematically shows and is used to express the preparation of expression vectors of recombinant DNA that a kind of coding comprises the UBNS 4 E1 E2 albumen of ubiquitin, KHCV NS4E albumen and KHCV E1 E2 albumen;

Figure 15 A is the result of the sds polyacrylamide gel electrophoresis (SDS-PAGE) after the recombinant DNA of coding UBNS 4 E1 E2 albumen is expressed in Bacillus coli cells;

Figure 15 B carries out the result of western blot analysis to the gel of Figure 15 A for the serum that uses hepatitis C patients;

Figure 16 schematically shows the preparation of expression vectors that is used to express with the nucleotide sequence of the encoded K HCV NS5-1.2 albumen of ubiquitin gene fusion;

Figure 17 A is the result of the sds polyacrylamide gel electrophoresis (SDS-PAGE) after the recombinant DNA of encoded K HCV UBNS5-1.2 albumen is expressed in Bacillus coli cells;

Figure 17 B carries out the result of western blot analysis to the gel of Figure 17 A for the serum that uses hepatitis C patients;

Figure 18 has schematically shown the preparation of expression vectors that is used to express HBV CORE gene and a kind of ubiquitin gene Fusion gene (UB HBV CORE DNA);

Figure 19 A is the SDS-PAGE result of UB HBV CORE DNA after Bacillus coli cells is expressed;

Figure 19 B carries out the result of western blot analysis to the gel of Figure 19 A for the serum that uses hepatitis B patient;

Figure 20 has schematically shown the preparation of expression vectors that is used for expressing at yeast cells the dna fragmentation of coding HBV surface antigen;

SDS-PAGE result after the dna fragmentation that Figure 21 shows coding HBV surface antigen is expressed in yeast cells; And

Figure 22 shows and uses kit of the present invention, adopts the testing result of Western blotting determination method to blood serum sample.

Detailed description of the present invention

The full text of all documents of quoting from herein all as a reference.

Following term used herein should have following connotation;

Term " HCV " refers to cause the virus of non-A non-B hepatitis or hepatitis C. Term HCV and HCV can be used alternatingly in this article.

Term " Korean-type HCV " or " KHCV " refer to a kind of novel HCV that separates from Korea S's hepatitis C patients, its cDNA has the ORF of the nucleotide sequence of an encode such amino acid sequences, and wherein the 842nd, 849 and 853 amino acid is respectively phenylalanine, leucine and threonine; Perhaps be leucine, phenylalanine and alanine.

Term " epitope " is meant the antigenic determinant of a peptide species, and it can cause immune response and/or can be autospecific and a kind of complementary antibody structure in the immunocompetence host.Epitope of the present invention is made up of 6 amino acid usually at least, preferably is made up of 7 or 8 amino acid.

Other term used herein has the identical and implication of traditional used with prior art.

Hereinafter the amino acid sequence number of the nucleotide sequence number of HCV cDNA or HCV albumen is based on 93-683 number disclosed full KHCV nucleotide sequence of Korean Patent public publication or amino acid sequence.

Below the present invention will be described in more detail.1.HCV determining of the epitope of antigen protein

HCV, KHCV (KHCV-LBC1 for example, be deposited in ATCC on May 14th, 1991, preserving number is ATCC 75008, according to budapest treaty about the international recognition of the preservation of the microorganism that is used for proprietary program, see the Korean Patent public publication 93-683 number) the information of nucleotide sequence of cDNA be used to the primer of synthesized polymer enzyme chain reaction, it is corresponding to 5 ' and 3 ' end of the cDNA fragment of encoded K HCV897 albumen, coating 1 and coating 2 albumen or non-structure 5 albumen.

(it is preserved in ATCC on June 27th, 1991 according to budapest treaty with KHCV 897 genes with described primer, preserving number is ATCC68640), (it was preserved in ATCC to the KHCV env gene on Dec 11st, 1991, preserving number is ATCC 68878,69866 and 74117) and KHCV NS5 gene (seeing Korean Patent public publication 93-683) carry out polymerase chain reaction for template, to obtain the cDNA fragment of KHCV 897 genes, KHCV coating 1 and coating 2 genes and KHCV NS5 gene.Each cDNA fragment is inserted a carrier, transform suitable hosts such as Escherichia coli with described expression vector.To carry out polyacrylamide gel electrophoresis by the polypeptide that transformed host cells is produced, and use the serum of hepatitis C patients to carry out western blot analysis then, be the epi-position of KHCV antigen with the polypeptide of KHCV antibody response to determine those specifically.Also detected the position of epitope in KHCV cDNA complete sequence that is determined.

Consequently, find that the epitope of KHCV 897 albumen is present in the carboxyl terminal of KHCV 897 albumen, it is (seeing the amino acid of epitope of KHCV shown in Figure 2 897 albumen and the sequence of nucleotide) from expressing corresponding to 366 base-pairs of the 4348th to 4713 nucleotide of KHCV cDNA.

For envelope protein, find that epi-position is present in the carboxyl terminal of KHCV coating 1 albumen (E1G albumen), it is to express from 309 base-pairs corresponding to the 1201st to 1509 nucleotide of KHCVcDNA; And the amino terminal that is present in KHCV coating 2 albumen (E2A albumen), it is to express from 240 base-pairs corresponding to the 1510th to 1749 nucleotide of KHCV cDNA; And the carboxyl terminal that is present in KHCV coating 2 albumen (E2E albumen), it is (the seeing the KHCV E1G shown in Fig. 4, the amino acid sequence of the flat KHCV E2E of KHCV E2A albumen and the nucleotide sequence of these albumen of encoding) of expressing from corresponding to 249 base-pairs of the 2281st to 2529 nucleotide of KHCV cDNA.

In addition, the epitope of NS5 albumen is present in the amino terminal of NS5 albumen, it is by corresponding to 1200 base-pairs coding of the 6649th to 7284 nucleotide that comprises KHCV 403 cDNA fragments, and with than the higher sensitivity of KHCV 403 specifically with KHCV patient's seroreaction.

2, the recombinant protein that comprises one or more HCV epitope

The epi-position of HCV or HBV antigen is very important for the effective and economic diagnostic reagent of exploitation.Particularly, consider that economy, effect and degree of accuracy more preferably comprise the fusion of one or more epitope; The fusion that comprises more than an epitope is most preferred.

As the HCV recombinant protein that comprises more than a HCV epi-position, preferably can comprise the reorganization KHCV CORE518 fusion of the epi-position that contains KHCV core protein and NS3 albumen, and the reorganization KHCV NS4E1E2 fusion that contains the epi-position of KHCV E1, E2 and NS4 albumen.

These recombinant proteins can be by containing the described fusion of encoding the various expression vector systems of nucleotide sequence be prepared; And this carrier is adjustable to comprise described fusion can increase the specific proteins of protein expression rate with other, is preferably the production of the recombination fusion protein of ubiquitin.The recombination fusion protein that comprises ubiquitin and KHCV fusion can be used for purposes of the present invention, needs only for example HCV antigenicity of its essential feature that contains KHCV albumen.

Above-mentioned expression system can be used for the occasion that required albumen is unstable and can be digested at an easy rate by the proteinase of host cell effectively, because ubiquitin can be protected required albumen not attacked by proteinase or stablize required albumen.In addition, the expression of the desired recombinant protein that merges with ubiquitin can be definite with anti-ubiquitin antibody, and utilize the characteristic of ubiquitin and be purified at an easy rate.3, HBV antigen protein

For example adopt that the nucleotide sequence information of disclosed hepatitis type B virus cDNA prepares hepatitis B virus core antigen and surface antigen in Korean Patent document 90-5959, these two kinds of antigens comprise one or more epitope respectively.The amino acid sequence of HBV cAg and surface antigen (Pre S2 S Ag) is shown in Fig. 6 and Fig. 7 respectively.Because the present known HBV that many types are arranged, therefore the amino acid sequence of HBV cAg and surface antigen may have JND in every type HBV, and it also can be adopted by the present invention.

Can prepare the HBV antigen protein by the dna fragmentation that adopts various expression vector systems to express a kind of HBV antigen protein of coding.The dna fragmentation of coding HBV antigen protein can be for example by adopting synthetic primer utilize PCR to prepare, this synthetic primer is held corresponding with the 5 ' end and 3 ' of the cDNA fragment of coding HBV cAg and surface antigen respectively.

The HBV antigen protein can be with the preparation of recombinant protein form, and this recombinant protein comprises HBV antigen protein and other specific proteins that can increase protein stability or promote purification step, is preferably above-mentioned the 2nd described ubiquitin.4, the expression of antigen protein in microbial hosts

For HCV or the HBV albumen that obtains desirable HCV of comprising or HBV epi-position, usefulness contains the HCV of coding HCV or HBV epi-position or the expression vector of HBV cDNA fragment transforms a compatible host cell; At the cell that allows to cultivate under the condition of expressing after transforming.

The selection of suitable host is subjected to the influence of a series of known factors, and these factors comprise, for example with the compatibility of selected carrier, by the toxicity of recombinant plasmid encoded protein, reclaim easy degree, protein properties, biological safety and the expense of desired albumen.Must balancedly consider these factors, it should be understood that not every host expresses specific recombinant DNA molecules on an equal basis effectively.

Spendable suitable hosts includes, but not limited to bacterium such as Escherichia coli and yeast such as saccharomyces cerevisiae among the present invention.

The polypeptide of producing in host cell can be by being used in combination classic method, for example, clasmatosis, centrifugal, dialyse, saltout, chromatography, gel filtration, electrophoresis separate and purifying with electroelution.

Polypeptide of the present invention also can be by suitable method chemosynthesis, as pure solid phase synthesis, and the part solid phase method, fragment condensation or classical solution are synthetic.Preferably by the disclosed solid phase synthesis of Merrifield (J.Am.Chem.Soc., 85,2149 (1963)).

On the other hand, known can the generation can not change the aminoacid replacement in protein of biology and immunologic competence basically and be described in TheProteins by people such as Neurath, Academic Press, New York (1979).As long as the protein by its generation keeps identical antigenic characteristic, aminoacid replacement of equal value on the then this function is also included within the scope of the invention.

Adopt single-letter or the trigram abbreviation expression nucleotide and the amino acid of standard in this manual.The implication of these abbreviations can be at the biological chemistry textbook such as the Lehninger of standard, Principles of Biochemistry, and Worth PublishersInc.New York, pp.96 finds in 798 (1984).

5, be used for detecting simultaneously the kit and the method for hepatitis type B virus and hepatitis C virus

Kit according to the present invention comprises at least a HCV antigen protein that contains one or more HCV epitope, preferably includes KHCV NS4E albumen, KHCV E1G albumen, KHCV E2A albumen, KHCV E2E albumen, KHCV COREEPI albumen, KHCV518 albumen and KHCV NS5-1.2 albumen; And at least a HBV antigen protein that comprises one or more epitope of HBV core protein or surface antigen protein.

More preferably, kit of the present invention comprises HCV or the HBV antigen protein that exists with the recombinant protein form, and wherein epitope and another kind of albumen are preferably ubiquitin and merge.

Most preferably, kit of the present invention can comprise KHCV CORE14 albumen, KHCVUB897 albumen, KHCV UBNS4E albumen, KHCV UBNS4E1E2 albumen, KHCVUBNS5-1,2 albumen, HBV CORE albumen and HBVS2 S Ag albumen.Therefore, this kit is because it can detect the specific antibody with the non-detectable HCV envelope protein of other known agent box, so it can provide more accurate testing result when detecting HCV.In addition, also comprising HBV CORE albumen and HBVS2 surface antigen this point in kit of the present invention makes and can detect hepatitis type B virus in the detection hepatitis C virus.

The amount of the every kind of antigen protein that is comprised in kit of the present invention can at random be adjusted, and preferably uses every kind of albumen of equimolar amounts.

Using under the situation that merges the ubiquitin antigen protein, ubiquitin is also included within the kit as a contrast albumen.

In addition, kit of the present invention can comprise damping fluid, the human immunoglobulin(HIg) as positive control, support material or other reagent that may need, and this depends on the detection method that adopts kit.

Detection to hepatitis type B virus and hepatitis C virus can preferably be measured with Western blotting by using kit of the present invention to carry out with any method commonly known in the art.

The invention still further relates to a kind of by utilize the detection method of kit of the present invention with the Western blotting determination method.Detection method of the present invention all has more specificity and accuracy than any existing method when the HBV of the serum that is used for detecting hepatitis and HCV antibody, therefore, it can be as the test of a kind of detection method that detects hepatitis C virus and definite hepatitis C and as the detection method that detects HBV and HCV simultaneously.

Adopt the detection method of antigen protein can comprise following step:

The first, one or more HBV antigen protein and one or more HCV antigen protein are added on the solid support, for example nitrocellulose filter or microlitre well are so that described antigen protein is adsorbed on the surface of described material;

The second, will be added on the topped solid support of antigen with a kind of testing sample of thinning agent dilution,, then can form antigen-antibody complexes if having HBV antibody or HCV antibody in the serum;

The 3rd, on support material, add a kind of enzyme, the anti-human IgG that for example HRP (horseradish peroxidase), or alkaline phosphatase puts together is so that this enzyme and the antibodies in the complex of second step formation; And

At last, add the substrate of enzyme on described material, for example substrate o-phenylenediamine two hydrochloric acid (OPD) of peroxidase and hydrogen peroxide are color reaction to occur.When containing HCV antibody or HBV antibody in the tested serum, owing to the reaction of enzyme-to-substrate specific color can appear.

Color depth available light densitometer or micropore reader are measured, and are that existing of HCV antibody or HBV antibody can be determined in the basis with the measurement result.

The used solid support of the first step can comprise nitrocellulose filter, vinyl film and immobilon P ^R, be preferably nitrocellulose filter.The HBV antigen protein can mix or be adsorbed onto individually on the solid support, and the HCV antigen protein also is like this.

Preferably, adopt the detection method of kit of the present invention to comprise following step:

(A) handle human immunoglobulin(HIg), KHCV UBCORE14 albumen, the KHCV UB NS5-1 be adsorbed with purifying with a lock solution, 2, the nitrocellulose filter of HBV CORE, HBV Pre S2 S Ag and ubiquitin;

(B) filter membrane after will sealing and a supporting film are parallel pastes mutually, and the cutting film is with preparation filter membrane bar, and this filter membrane bar comprises each filter membrane of the homalographic that can form 8 protein bands;

(C) with a described filter membrane bar and a test serum example reaction;

(D) with the filter membrane bar of gained in (C) and anti-human IgG antibody's reaction with horseradish peroxidase or alkali phosphatase enzyme mark;

(E) substrate of adding horseradish peroxidase or alkaline phosphatase; And

(F) measure the color depth of each protein band after presenting color reaction on the filter membrane bar that in (E), obtains.

The recombinant protein of the present invention that comprises more than a kind of epitope in use prepares under the situation of detectable, and it can obtain than the sensitiveer and more accurate detection of situation of using the existing antigen that a kind of epitope is only arranged.In addition, comprise that the kit more than the recombinant protein of a kind of HBV or HCV epitope has shown excellent testing result of the present invention comprising more than a kind of.

Following embodiment is used to specifically describe the present invention rather than restriction the present invention, and except as otherwise noted, the experimental technique among the embodiment all carries out according to following reference example.

Except as otherwise noted, the number percent of following solid solid mixture, liquid liquid number percent and solid-liquid number percent are respectively based on w/w, volume/volume and weight/volume.Reference example 1: use digestion with restriction enzyme DNA

In the 1.5ml eppendorf pipe of a sterilization, add restriction enzyme and reaction buffer, make reaction volume between 50-100 μ l, be reflected at 37 ℃ and carried out 1-2 hour.After reaction is finished, with reaction mixture in 65 ℃ of thermal treatments 15 minutes (or under heat-resisting restriction endonuclease situation with the phenol extracting and use precipitation with alcohol) with the inactivation restriction enzyme.

In this reference example used Restriction Enzyme and reaction buffer available from NEB (New Engand Biolabs, Jolla, MA, U.S.A.).

10 times of reaction buffers composed as follows that is used for restriction enzyme reaction:

10 * NEB reaction buffer 1:100mMbisTris propane-HCl, 100mM MgCl ₂, 10mM dithiothreitol (DTT) (DTT), pH7.0

10 * NEB reaction buffer 2:100mM Tris-HCl, 100mM MgCl ₂, 500mMNaCl, 10mM DTT, pH7.0

10 * NEB reaction buffer 3:100mM Tris-HCl, 100mM MgCl ₂, 1000mM NaCl, 10mM DTT, pH7.0

10 * NEB reaction buffer 4:200mM Tris-acetate, 100mM magnesium acetate, 500mM potassium acetate, 10mM DTT, pH7.0 reference example 2: phenol extracting and precipitation with alcohol

After enzyme and DNA reaction were finished, with the DNA in fermentoid or the recovery reaction mixture, wherein used phenol was in advance with the damping fluid balance that contains 10mM Tris-HCl (pH8.0) and 1mM EDTA with the phenol extracting for reaction mixture.

The phenol extracting is following carrying out: mix isopyknic sample and phenol by thermal agitation; 15000rpm centrifugal mixture 5 minutes; Water is transferred in the new pipe.Repeat above-mentioned steps three times.

(chloroform: isobutyl alcohol=24: 1) the above-mentioned water of extracting is also isolated water again to use isopyknic chloroform then; Add the 3M sodium acetate of 0.1 volume and the absolute ethyl alcohol of 2.5 volumes to aqueous phase;-70 ℃ deposit deposited in 30 minutes or-20 ℃ more than 12 hours the back 15000rpm, 4 ℃ of following centrifugal mixtures 20 minutes to reclaim nucleic acid.Reference example 3: coupled reaction

Use T4DNA ligase and 10 * coupled reaction damping fluid (0.5M Tris-HCl, pH7.0,0.1M MgCl available from NEB ₂, 0.2M DTT, 10mMATP, 0.5mg/ml bSA (BSA)) and carry out the coupled reaction of DNA.Reaction volume is generally 20 μ l, and the DNA cohesive end connects with 10 T4 of unit ligases, flat terminal the connection with 100 T4 of unit dna ligases of DNA.

Be reflected at 16 ℃ and carried out 5 hours or carried out more than 14 hours, after reaction is finished, reaction mixture is heated 15 minutes with inactivation T4 dna ligase at 65 ℃ at 4 ℃.Reference example 4 Transformed E .coli

E.coli bacterial strain (E.coli HB101 (ATCC 33694) for example, E.coli W3110 (ATCC 27325) becomes E.coli JM105 (ATCC 47016)) conversion be to adopt method commonly known in the art, for example, people such as Maniatis are at Molecular Cloning:A Laboratory Manual, Cold SpringHarbor Press, N.Y. described in (1982), or Cohen is described in the Proc.Natl.Acad.Sci U.S.A 69,2110 (1972).Reference example 5: oligonucleotides synthetic

Use automatic solid phase phosphoramidite chemical method to utilize a dna synthesizer (Applied Biosystems Inc., model: 380B, U.S.A.) synthetic oligonucleotide.

With denaturing polyacrylamide gel (2M urea, 12% acrylamide and bis (29: 1), 50mM Tris, 50mM boric acid, 1mM EDTA-Na ₂) electrophoresis and employing acetonitrile: water (50: 50) is made the C of eluant, eluent ₁₈The oligonucleotides that SEP-PAK (Waters Inc.U.S.A) column chromatography purifying is synthetic; By measure the amount of O.D. definite kernel thuja acid at 260nm.Reference example 6: polymerase chain reaction (PCR)

At 10-100ng template DNA, 10 μ l, 10 * Taq polymeric enzyme reaction damping fluid (10mm Tris-HCl, pH8.3,500mM KCl, 15mMMgCl ₂0.1% (w/v) gelatin), the potpourri of 10 μ ldNTP (it is 10mM that dGTP, dATP, TTP and dCTP are equipped with), 2 each primer of μ g (use 2 primers in the reaction usually; the consumption of the primer in the middle of being positioned at when using 3 primers is 0.02 μ g) and 0.5 μ l Ampli Taq archaeal dna polymerase (Perkin Elmer Cetus; U.S.A.) add an amount of distilled water in the potpourri of Zu Chenging so that cumulative volume is 100 μ l, be not evaporated with the protective reaction potpourri to wherein adding 50 μ l mineral oil.

(Perkin ElmerCetus U.S.A.) carries out PCR, and thermal cycle is set as repetition 25 times or more to adopt a kind of thermal cycler; Described circulation is: 95 ℃ 1 minute → 55 ℃ 1 minute → 72 ℃ 2 minutes, at last 72 ℃ the reaction 10 minutes.

Reaction is finished the back with phenol extracting potpourri, with precipitation with alcohol recovery PCR product, and with sediment be dissolved in 20 μ l TE buffer solution (10mM Tris-HCl, 1mM EDTA, pH7.5).The anti-human IgG antibody's that reference example 7:HRP puts together preparation

Sepharose CL-4B affinity column and Protein G post (Pharmacia LKB with human IgG absorption, Sweden) the anti-human IgG Fc of chromatogram purification district (Immunovision Inc., Arizona, U.S.A., antibody Cat.No.GHF-1001) is so that the purity of described antibody surpasses 90%.At J.Histochemcytochem.22, the sodium metaperiodate method described in 1084 (1974) is with the antibody that horseradish peroxidase-labeled obtained according to Nakane etc., and method is as follows:

Be dissolved in 5mg horseradish peroxidase (the Boehringer Mannheim of 1.2ml distilled water (DW), Germany, Cat.No.814,393) add the 0.1M sodium periodate solution that 0.3ml is dissolved in 100mM sodium phosphate buffer (pH7.0) in the solution, potpourri at room temperature reacted 20 minutes.The solution that obtains was to 1mM sodium acetate buffer dialysis 16 hours.

1.5ml the superoxide enzyme solutions that obtains mixes with the 1ml 20mM sodium carbonate liquor (pH9.5) that is dissolved with antibody purification with 10mg/ml concentration, potpourri at room temperature reacted 2 hours.Add 10 μ l subsequently and be dissolved in the boric acid hydrogen sodium solution (4mg/ml) of DW to remove this alkali of unreacted Schiff by a reduction reaction.The solution that obtains thus spends the night to the normal saline dialysis of phosphate-buffered, crosses sephadex G-200 post subsequently to remove free antibody or peroxidase.Embodiment 1 preparation KHCV UBCORE14 and KHCV UB897 albumen

＜step 1〉amplification (1-1) the preparation primer of KHCV CORE14 and KHCV897 DNA

In order to increase KHCV CORE14 and KHCV 897 DNA (it is made up of 343-726 nucleotide district and the 3916-4713 nucleotide district of KHCV LBC1 respectively) and they are cloned under trp promoter control comprise on the E.coli expression vector of ubiquitin gene synthetic following primer:

The PCOREUBI primer: 5 '-CTTGGTGTTGAGACTCCGCGGTGGTATGAGCACGAATCCTAAACC-3 comprises and ubiquitin gene 3 ' terminal 25 overlapping nucleotide at 5 ' end, and the 343-360 nucleotide of KHCV-LBC1;

The PSALCORE14 primer: 5 '-GGGGTCGACTATTAGCATGTGAGGGTGTGGATGAC-3 ' contains translation stop codon after the 726th nucleotide of KHCV-LBC1, and a SalI recognition site; The PK897SAL primer: 5 '-GACTGGTCGACTATTAACACGTATTACAGTCGATCAC-3 ' comprises two translation stop codon (TAATAC) that are positioned at 3 ' end behind KHCV-LBC1 the 4713rd nucleotide, and a SalI recognition site; PK897 UBI primer: 5 '-CTTGGTGTTGAGACTCCGCGGTGGTGCGGTGGAATTCATACCCG-3 ' contains and ubiquitin gene 3 ' terminal overlapping 25 nucleotide that are positioned at 5 ' end, and design is used for from other nucleotide of the initial translation of KHCV-LBC1 the 3916th nucleotide.(1-2) polymerase chain reaction

Add 2 μ g PCOREUB1 primers and 2 μ g PSALCORE14 primers among the test tube A, add 2 μ g PK897SAL primers and 2 μ g PK897UB1 primers among the test tube B, add 50ng KHCV-LBC1 DNA (ATCC 75008) in each test tube fully, 10 μ l, 10 * polymerase buffer, 10 μ l 2mM dNTP (12mM dGTP, 2mM dATP, 2mM TTP, 2mM dCTP), 2.5 Taq of unit polymerases add distilled water and make cumulative volume transfer to 100 μ l.

In reaction mixture, add mineral oil to avoid evaporating, repeat 25 times with reference example 6 in identical thermal cycle to carry out PCR.(1-3) separation and purified pcr product

The product that obtains in above-mentioned (1-2) carries out 5% polyacrylamide gel electrophoresis, the result confirms that about 384bp DNA is amplified among the test tube A, about 897bp DNA is amplified among the test tube B, uses the polyacrylamide gel electrophoresis purifying described dna fragmentation identical with (1-2) and difference called after K384 fragment and K897 fragment.＜step 2〉preparation ubiquitin gene (2-1) preparation primer

According to people such as Ozkaynak at EMBO.J., 6, the information of the ubiquitin gene of report designs following 3 kinds of different oligonucleotides and synthetic with a dna synthesizer among the 1429-1439 (1987): UBI1:5 '-CCCCATATGCAAATTTTCGTCAAAACTCTAACAGGGAAGACTATAACCCT

AGAGGTTGAATCTTCCGACACTATTGACAACGTCAA-3′UBI2：5′-TAGTTGCTTACCAGCAAAAATCAATCTCTGCTGATCCGGAGGGATACCTT

CTTTATCTTTGAATTTTACTTTTGACGTTGTCAATAGTCTC-3′UBI3：5′-ACCACCGCGGAGTCTCAACACCAAGTGAAGAGTAGATTCCTTTTGGATGT

TGTAGTCAGACAAGGTTCTACCATCTTCTAGTTGCTTACCAGCAAAAA-3′

UBI1 be designed to 5 ' end have Nde I recognition site (5 '-CATATG-3 ') and 20 nucleotide are arranged approximately and UBI2 overlapping; UBI2 is designed to have Sac II recognition site (5 '-CCGCGG-3 ') and can change its coded amino acid sequence.(2-2) preparation ubiquitin gene

In the potpourri of 2 μ g UBI1,0.02 μ g UBI2 and 2 μ g UBI3, add 1 μ l, 10 * PCR damping fluid, 10 μ l 2mM dNTP potpourris and 2.5 Taq of unit polymerases, adding distil water makes cumulative volume transfer to 100 μ l, carries out PCR in the mode identical with reference example 6.The potpourri that obtains is carried out 5% polyacrylamide gel electrophoresis to separate about 240bp DNA, and it is named as the Ub fragment, and the fragment that is separated to is dissolved in 20 μ l TE damping fluids.＜step 3〉preparation expression vector (3-1) polymerase chain reaction

Prepare 2 test tubes, it is as follows to contain primer fully:

Test tube A:2 μ g UBI1 primer and 2 μ g PSALCORE14 primers; And

Test tube B:2 μ g UBI1 primer and 2 μ g PK897SAL primers.

In test tube A, add 50ng K384 fragment and 50ng UB fragment as template, in test tube B, add 50ng K897 fragment and 50ng UB fragment as template, add 10 μ l, 10 * polymerase buffer, 10 μ l 2mMd NTP and 2.5 Taq of unit polymerases more fully, adding distil water makes cumulative volume transfer to 100 μ l, in each reaction mixture, add 50 μ l mineral oil to avoid evaporating, repeat 25 thermal cycles in the reference example 6 to carry out PCR.(3-2) with digestion with restriction enzyme section and carrier DNA

In NEB damping fluid 3 with the every kind of PCR product that obtains in NdeI and the SalI catapepsis above-mentioned (3-1).

The fragment that obtains in test tube A and test tube B is named as KHCV UBCORE 14 and KHCV UB897 respectively.

In NEB damping fluid 3,, in NEB damping fluid 4, use Pst I and Nde I catapepsis 2 these plasmids of μ g with Pst I and Sal I catapepsis 2 μ g ptrp 322H-HGH (seeing the open 91-457 of Korean Patent).Separated product on 0.7% Ago-Gel is separated to the fragment of about 1.5kb and 0.86kb, respectively called after PL and PT fragment.(3-3) connect

Use the fragment of preparation in above-mentioned (3-2), carry out following coupled reaction:

Connect and add 100ng KHCV UBCORE14 among the test tube A, connect and add 100ng KHCVUB897 among the test tube B.Add 100ng PL, 100ng PT, 2 μ l 10 * connection damping fluid and 10 T4 of unit dna ligases to every Guan Zhongbei, add distilled water and make cumulative volume transfer to 20l, be reflected at 16 ℃ and carried out 12 hours.Separate the carrier after every kind of connection, with its transformed into escherichia coli HB101 (ATCC 33694), separate the carrier and the called after ptrp H-UB-CORE14 that contain the UBCORE14 fragment, separate the carrier and the called after ptrp H-UB-KHCV 897 that contain KHCV UB897 fragment.＜step 4〉expression of KHCV UB CORE14 DNA and KHCV UB897 ' DNA

With above-mentioned＜step 3〉every kind of plasmid Transformed E .coli W3110 (ATCC 37339) cell of preparation, wherein the E.coli W3110 that transforms with ptrp H-UB-KHCV 897 on June 27th, 1991 in the ATCC preservation, preserving number is ATCC 69640; The E.coli W3110 that transforms with ptrp H-UB-CORE14 on July 1st, 1991 in the ATCC preservation, preserving number is ATCC 68642, above preservation is to carry out according to the budapest treaty about the microbial preservation that is used for proprietary program of international recognition.

The E.coli W3110 (ATCC 37339) that transforms with plasmid ptrp H-UB-CORE14 and ptrpH-UB-KHCV 897 is containing liquid LB nutrient culture media (the 6%Bacto tryptone of 50 μ g/ml ampicillins, 0.5% yeast extract, 1%NaCl) in 37 ℃ of shaken cultivation 12 hours.The 5ml culture is inoculated into 1l M9 nutrient culture media (40mM K ₂HPO ₄, 22mM KH ₂PO ₄), 8.5mM NaCl, 18.7mM NH ₄Cl, 1% glucose, 0.1mM MgSO ₄, 0.1mM CaCl ₂, 0.4% casein hydrolysate, 10 μ l/ml vitamin B1s, 40 μ g/ml ampicillins) in, in 37 ℃ of shaken cultivation 3-4 hours.When its OD of 650nm place value arrived 0.5, adding indole acrylic acid (IAA) in culture, to make final concentration be 1.4mM, after 5 hours with the centrifugal gained culture of 3000rpm 25 minutes to collect E.coli cell precipitation thing.＜step 5〉determine expressing protein and reactivity thereof with hepatitis C patients serum

With above-mentioned＜step 4〉in every kind of cell precipitation thing obtaining be suspended in and adopt Laemmli method (Nature, 227,680 (1970)) to carry out 15%SDS-PAGE in the damping fluid then to determine the expression of KHCV UB CORE14 and KHCV UB897 albumen.The results are shown among Fig. 9 A.

Among Fig. 9 A, swimming lane M represents the standard molecular weight mark, promptly is followed successively by 72,43,29 and 18 kilodaltons from top to bottom; Swimming lane 1 is the product with E.coli of the plasmid that does not contain the KHCV gene; Swimming lane 2 is the product with the E.coli of ptrp H-UB-CORE14 conversion, wherein produces the albumen of the 23kd that has an appointment; Swimming lane 5 is the product with the E.coli of ptrp H-UB-KHCV 897 conversions, wherein produces the albumen of the 40kd that has an appointment;

Swimming lane

3,4 and 6 shows other KHCV albumen.

According to Towbin at Proc.Natl.Acad.Sci.U.S.A., the albumen that the method described in 76,4750 (1979) will be separated on gel print to nitrocellulose filter (Bio-Rad Lab., aperture 0.22 μ m, CA, U.S.A) on.Filter membrane is put among the PBS (10mM phosphate, pH7.0,0.15M NaCl) that contains 0.2%Tween 20, and the 2 hours non-specific binding with blocking-up IgG and albumen of at room temperature vibrating.Filter membrane is put into an IgG solution, and this solution is to prepare by the PBS dilution IgG (8.2mg/ml) of purifying from Korea S HCV patient that contains 0.5% gelatin and 0.05%Tween 20 with 200 times of volumes; Vibrated 1 hour so that albumen and IgG reaction in the room temperature gentleness.Subsequently with the PBS filter wash film 4 times that contains 0.2%Tween 20, each 5 minutes.Filter membrane is put into anti-human IgG antibody's solution, and this solution is that (U.S.A.) the anti-human IgG of labelled goat prepares for Bio-Rad Lab., CA with horseradish peroxidase by the PBS dilution that contains 0.5% gelatin and 0.05%Tween 20 with 200 times of volumes; At room temperature vibrated 1 hour.With the PBS filter wash film that contains 0.2%Tween 20 4 times, each 5 minutes, use 50mM Tris damping fluid (pH7.0) to wash then twice.

The 50mM Tris damping fluid that contains 400 μ g/ml 4-chloro-1-naphthols and 0.03% hydrogen peroxide to the filter membrane adding is to produce color reaction.By above-mentioned western blot analysis gained the results are shown in Fig. 9 B, the sample of every swimming lane is identical with Fig. 9 A among the figure B.

Protein-specific ground and KHCV antibodies that result's confirmation produces in reorganization E.coli.＜step 6〉transform KHCV UBCORE14 albumen and KHCV UB897 albumen＜step 6-A〉purifying KHCV UBCORE14 albumen (6-A-1) smudge cells and remove soluble protein

Will be in＜step 4〉in the 4g E.coli cell precipitation thing that obtains be suspended in 4 ℃ of damping fluid 1 (50mM Tris of 20ml, pH7.5,5mM EDTA, the 10mM beta-mercaptoethanol, the 1mM phenylmethylsulfonyl fluoride, 1 μ g/ml pepstatin A) in, in suspension, add the 4mg lysozyme, stirred the mixture 30 minutes on ice, on ice bath, be output as 80% and 50% ultrasonic processor (HEAT SYSTEMS ULTRASONIC INC. then with energy rate circulation, W225, U.S.A.) sonicated 20 minutes is with smudge cells and obtain the E.coli cell homogenates.(6-A-2) handle with urea

The cell homogenates that obtains in the usefulness hydro-extractor (BeckmanJ2-21, Rotor JA20) centrifugal (6-A-1) under 12000rpm obtained supernatant to remove insoluble precipitate in 20 minutes.

Adding 9M urea in supernatant, to make final concentration be 8M, at room temperature stirred gains 12 hours.(6-A-3) use acid treatment

Add 1M sodium acetate (pH4.5) in the solution that obtains so that final concentration is 10mM in (6-A-2), adding 1M acetate adjusting pH subsequently is 5.0, stirring at room 1 hour.Obtain supernatant with hydro-extractor (Beckman J2-21, ROtor JA14) centrifugal solution under 11000rpm to remove precipitation.(6-A-4) CM ion-exchange chromatography

The solution that contains KHCV UB-CORE 14 albumen that obtains in (6-A-3) is crossed with damping fluid 2 (8M urea with 1ml/ minute flow velocity, 1mM EDTA, 100mM beta-mercaptoethanol and 10mM acetate, pH5.0) balance contains 25ml CM-Sepharose resin (Pharmacia, post Sweden) (2.5cm * 10cm), fully wash with free form with described damping fluid and to stay material in the post, adding 500ml sodium chloride concentration gradient with 3ml/ minute flow velocity subsequently is that the above-mentioned damping fluid 2 of 0-0.5M is with elution of bound albumen, eluate is carried out sds polyacrylamide gel electrophoresis, demonstration KHCV UBCORE14 albumen by wash-out, is collected the component that contains KHCV UBCORE14 and is used for next step under about 0.3M concentration.(6-A-5) S-200 gel permeation chromatography

With YM5 ultra filtration membrane (Amicon, U.S.A.) component of collecting in (6-A-4) is concentrated into 10ml, concentrate with 0.5ml/ minute flow velocity by with containing 6M urea, the S-200 Sephacryl post (2.5cm * 100cm of the PBS solution equilibria of 1mMEDTA and 1mM beta-mercaptoethanol, Pharmacia, Sweden) with according to the molecular weight protein isolate, protein component is carried out sds polyacrylamide gel electrophoresis, collect the component that contains KHCV UBCORE14.(6-A-6) Mono-S chromatography

Damping fluid 3 (6M urea with equal volume, 1mMEDTA, 1mM beta-mercaptoethanol and 10mM phosphate, pH7.0) component that contains KHCV UBCORE14 albumen that obtains in the dilution (6-A-5), subsequently by FPLCMono-S post (HR5/5 with the buffer A balance, Pharmacia Sweden), washes post with described buffer A, add gradually with 0.8ml/ minute flow velocity then and contain 6M urea, 1mMEDTA, 1mM beta-mercaptoethanol, the buffer B of 10mM phosphate and 0.4mM sodium chloride, dosage is: added 35% in preceding 5 minutes, below added 70% in 55 minutes, added 100% in last 10 minutes, with elution of bound albumen.When the consumption of buffer B reaches 60%, when promptly sodium chloride concentration was 0.25M, KHCV UB-CORE14 albumen was by wash-out.

Component is dialysed to PBS solution at 4 ℃, and acquisition 4mg purity is at least 90% KHCV UB-CORE14 albumen.＜step 6-B) purifying KHCV UB897 albumen (6-B-1) clasmatosis and remove soluble protein

4g is by＜step 4〉in the E.coli cell precipitation thing that obtains as＜step 6-A (6-A-1) as described in handle with smudge cells and therefrom obtain insoluble precipitate.(6-B-2) wash insoluble precipitate with Triton X-100 and Tris damping fluid

The sediment that obtains in (6-B-1) is suspended in damping fluid 4 (the 50mM Tris that 50ml contains 1%Triton X-100, pH8.5,5mM EDTA, the 2mM beta-mercaptoethanol) in, stirred suspension was also used hydro-extractor (Beckman J2-21 in 30 minutes under the room temperature, RotorJA14) at 11000rpm centrifugal 25 minutes, remove supernatant, obtain insoluble precipitate.To precipitate subsequently and be suspended in again in the 50ml damping fluid 4.Stir again and centrifugal suspending liquid, supernatant discarded obtains insoluble precipitate.

Only can obtain purity and be at least 60% KHCV UB897 albumen by above-mentioned simple washing procedure.(6-B-3) with 8M urea dissolving insoluble precipitate.

The insoluble precipitate that contains KHCV UB897 albumen that will obtain in (6-B-2) is suspended in damping fluid 5 (the 20mM phosphate that 50ml contains 8M urea, pH6.0,2mM EDTA, 2mM beta-mercaptoethanol) in, stirring at room suspending liquid 1 hour and the centrifugal insoluble precipitate that discards obtain supernatant.(6-B-4) S-Sepharose ion-exchange chromatography

The supernatant that obtains in (6-B-4) is by the S-Sepharose post (Pharmaeia with damping fluid 5 balances that contain 4M urea, FF, 2.5cm * 7cm, U.S.A), with 600ml sodium chloride concentration gradient is the buffer solution elution of 0-0.2M, protein component is carried out SDS-PAGE, collect the component that contains high-purity KHCV UB897 albumen.(6-B-5) remove urea and FPLC-Mono Q ion-exchange chromatography

The protein component of collecting (6-B-4) that contains KHCV UB897 albumen is to damping fluid 6 (10mM Tris, pH8.5,2mM EDTA, the 2mM beta-mercaptoethanol) dialysis is to remove urea, (Pharmacia HR5/5), contains the buffer solution elution that the sodium chloride concentration gradient is 0-0.4M with 40ml to application of sample to the FPLCMono Q ion exchange resin column with described damping fluid balance, collection contains the component of highly purified KHCVUB897 albumen, obtains purity and is at least 90% KHCV UB897 albumen.Embodiment 2 preparation KHCV UB NS4E albumen＜steps 1〉amplification KHCV NS4E DNA (1-1) preparation primer

For preparation KHCV NS4E DNA (its 5422-5547 nucleotide district by KHCV-LBC1 forms (and be cloned into containing in the ubiquitin expression carrier under trp promoter control, synthesize following primer:

The PNS4ET2 primer: 5 '-TGAGACTCCGCGGTGGTATCATCCCCGATAGGGAAGTT-3 ' comprises the 5422-5442 nucleotide of Sac II recognition site and KHCV-LBC1; And

The PNS4ESAL primer: 5 '-AAAAAAGTCGACTATTACAACCCGAGCGCCTTCTGTTT-3 ' comprises translation stop codon and Sal I recognition site that is positioned at behind KHCV-LBC1 the 5547th nucleotide.(1-2) polymerase chain reaction

In a test tube, add 2 μ g PNS4ET2 primers and 2 μ g PNS4ESAL primers, add 50ng KHCV-LBC1 DNA (ATCC 75008) again, 10 μ l, 10 * polymerase buffer, 10 μ l 2mM dNTP (2mM dGTP, 2mM dATP, 2mMTTP, 2mM dCTP), 2.5 the Taq of unit polymerase, it is 100 μ l that adding distil water is regulated cumulative volume.

In reaction mixture, add 50 μ l mineral oil to avoid evaporating, repeat 25 thermal cycles identical to carry out PCR with reference example 6.(1-3) separation and purified pcr product

The PCR product that obtains in above-mentioned (1-2) is carried out 5% polyacrylamide gel electrophoresis, and the result confirms that about 130bp DNA is amplified.Use identical polyacrylamide gel electrophoresis purify DNA and called after NS4E fragment as mentioned above.＜step 2〉the preparation expression vector

(ATCC 68642 to use Sac II and Sal I catapepsis 2 μ g ptrp H-UB-CORE14 in NEB damping fluid 3, see Korean Patent public publication 93-683), the potpourri that obtains carries out 7% agarose gel electrophoresis to separate the 2.7kb fragment, and it is named as ptrp H-UB-T2/L fragment.

In addition, as described in the reference example 1 in NEB damping fluid 3 with Sac II and Sal I fully digest 2 μ g above-mentioned＜step 1 (1-3) in NS4E fragment of obtaining.

Connect the above-mentioned dna fragmentation that obtains of adding 100ng in the test tube one, add the above-mentioned ptrp H-UB-T2/L fragment that obtains of 50ng, 2 μ l 10 * connection damping fluid, 10 T4 of unit dna ligases simultaneously, add distilled water and make cumulative volume transfer to 20 μ l, carried out coupled reaction 12 hours at 16 ℃.

With connecting potpourri Transformed E .coli W3110 (ATCC 37339) to obtain to contain the reorganization E.coli cell (Figure 10) of the ptrp H-UB-NS4E plasmid that comprises the NS4E fragment.＜step 3〉preparation KHCV NS4E albumen

With above-mentioned＜step 2〉preparation plasmid ptrp H-UB-NS4 Transformed E .coli W3110 (ATCC 37339).

E.coli cell after the conversion the liquid Luria nutrient culture media that contains 50 μ g/ml ampicillins (the 6%Bacto tryptone, 0.5% yeast extract, 1%NaCl) in 37 ℃ of shaken cultivation 12 hours.The 3ml culture is seeded to 300ml M9 nutrient culture media (40mM K ₂HPO ₄, 22mMKH ₂PO ₄, 8.5mM NaCl, 18.7mM NH ₄Cl, 1% glucose, 0.1mM MgSO ₄, 0.1mM CaCl ₂0.4% casein hydrolysate, 10 μ g/ml vitamin B1s, 40 μ g/ml ampicillins) in, 37 ℃ of shaken cultivation 4 hours, when when the 650nmOD value reaches 0.3, adding indole acrylic acid (IAA) in culture, to make final concentration be 50 μ g/ml, with the centrifugal culture of 11000rpm 25 minutes, collect E.coli cell precipitation thing after 5 hours.＜step 4〉determine the expression and the reactivity thereof of UB NS4E albumen with the serum of hepatitis C patients

With Laemmli method (Nature 227,680 (1970)) with above-mentioned＜step 3 the cell precipitation thing that obtains carries out 15%SDS-PAGE, gel with coomassie brilliant blue R250 dyeing to determine Recombinant Protein Expression (Figure 11 A).In Figure 11 A, swimming lane 1 is represented the standard molecular weight label, and swimming lane 2-13 shows the E.coli product that transforms with plasmid ptrp H-UB-NS4E, and swimming lane 14 has shown the E.coli product with plasmid of not being with any KHCV dna fragmentation.

The albumen that will on gel, separate Towbin method (Towbin etc., Proc.Natl.Acad.Sci., U.S.A., 76,4750 (1979)) print to nitrocellulose filter (Bio-Rad Lab., aperture 0.22 μ m, CA.U.S.A.) on, filter membrane is put into PBS (10mM phosphate, the pH7.0 that contains 0.5%Tween 20,0.15M NaCl), in 2 hours non-specific binding of room temperature jog with blocking-up IgG and albumen.Filter membrane is put into IgG solution, and this solution is by preparing to final concentration 16 μ g/ml with the IgG of the PBS dilution that contains 0.5% gelatin and 0.05%Tween 20 purifying from Korea S HCV patient; Vibrated 1 hour so that albumen and IgG reaction in the room temperature gentleness.Subsequently with the PBS filter wash film 4 times that contains 0.2%Tween 20, each 5 minutes.Filter membrane is put into anti-human IgG antibody's solution, this solution is by use the anti-human IgG of the goat (anti-human IgG-HRP of goat of horseradish peroxidase-labeled with the PBS dilution that contains 0.5% gelatin and 0.05%Tween20 of 500 times of volumes, Bio-RadLab., CA. U.S.A.) prepares; Room temperature vibration 1 hour, with the PBS filter wash film that contains 0.2%Tween 20 4 times, each 5 minutes; Use 50mM Tris damping fluid (pH7.0) to wash secondary subsequently.Adding contains the 50mM Tris damping fluid of 400 μ g/ml 4-chloro-1-naphthols and 0.03% hydrogen peroxide to produce color reaction on filter membrane.Above-mentioned western blot analysis the results are shown in Figure 11 B, wherein swimming lane 1-4 shows the E.coli product that transforms with plasmid ptrp H-UB-NS4E, swimming lane 5 has shown the E.coli product that contains the plasmid of not being with any KHCV dna fragmentation, and swimming lane 6 shows the standard molecular weight label.＜step 5〉purifying UBNS4E albumen (5-1) smudge cells and remove insoluble protein

With 3g in above-mentioned＜step 3 in the E.coli cell precipitation thing that obtains be suspended in 40ml damping fluid 7 (20mM Tris, pH8.0,1mM EDTA, the 10mM beta-mercaptoethanol, the 1mM phenylmethylsulfonyl fluoride, 1 μ g/ml pepstatin A) in, adding lysozyme in suspending liquid, to make final concentration be 0.2mg/ml, and the solution that obtains was placed 30 minutes on ice.Obtain thing and in ice bath, be output as 80% and 50% ultrasonic processor and carry out 15 minutes sonicated, obtain the E.coli cell homogenates with smudge cells with energy rate circulation.

With the above-mentioned cell homogenates that obtains in a hydro-extractor (Beckman J2-21, Rotor JA20) with centrifugal 25 minutes of 15000rpm to remove insoluble precipitate, obtain soluble protein.(5-2) DEAE-Sepharose ion-exchange chromatography

It is 9.0 that the protein solution that obtains in (5-1) adds 1M HCl adjustment pH value of solution, obtain with 2ml/ minute flow velocity by using damping fluid 8 (20mM Tris, pH9.0,1mM EDTA and 1mM beta-mercaptoethanol) the DEAE-Sepharose post of balance, remain in free albumen in the post with same buffer solution elution.Subsequently with 8ml/ minute flow velocity add 300ml contain concentration gradient be the damping fluid 8 of NaCl of 0-0.4M with elution of bound albumen, every 4ml component is collected eluent.Protein component is carried out 15%SDS-PAGE contains UBNS4E albumen with collection component.(5-3) S-200 gel permeation chromatography

With YM10 ultra filtration membrane (Amicon, U.S.A.) concentrating protein component to the volume of collecting in (5-2) is 5ml, pass through to use the S-200 resin column (Pbarmacia of PBS balance then with 1ml/ minute flow velocity, 2.5cm * 90cm), every 3ml component is collected the albumen that elutes and is carried out 15%SDS-PAGE contains high-purity UBNS4E albumen with collection component.(5-4) FPLC-phenyl-superose chromatography

Add in the protein component of in (5-3), collecting NaCl to final concentration be 2.0M, obtain thing contains the PBS balance of 2.0MNaCl by usefulness with 0.7ml/ minute flow velocity FPLC-phenyl-superose post (Pharmacia, HR5/5,0.5cm * 5cm), add same damping fluid and remain in free albumen in the post with wash-out.Adding 40ml subsequently contains the PBS that linear concentration gradient is the NaCl of 2.0M-OM (10mM phosphate, pH7.0) with elution of bound albumen, every 1.4ml component is collected eluent.

Protein component is carried out 15%SDS-PAGE comprise the component of UBNS4E albumen, measure the antigentic specificity of purifying protein with western blot analysis with at least 95% purity with collection.Embodiment 3 preparation KHCV UBE1E2 albumen

＜step 1〉amplification KHCV E1E2 DNA

(1-1) preparation primer

To comprise the KHCVE1E2 gene of HCV envelope protein antigen epi-position in order increasing and to be cloned into comprising in the ubiquitin expression carrier under trp promoter control synthetic following primer:

The PE2ET2 primer: 5 '-TGAGACTCCGCGGTGGTACTCGGGGAGAGCGTTGTGAC-3 ' comprises the 2281-2298 nucleotide of a Sac II recognition site and KHCV-LBC1;

The PE2EGE1G primer: 5 '-TTCCTTCTTCTGGCGGACGCGGTTTCCCAGCTGTTCACCTTC-3 ' is included as the 2509-2529 nucleotide district of the KHCV-LBC1 of E2E DNA3 ' end region, and be the 1201-1221 nucleotide district of KHCV-LBC1 of 5 ' end region of E1G gene; And

The PE2AXHO primer: 5 '-AAAAAACTCGAGTTACCACCCCTGCGCGAATGTATC-3 ' comprises translation stop codon that is positioned at after KHCV-LBC1 the 1749th nucleotide, and an Xho I recognition site.(1-2) polymerase chain reaction

In a test tube, add 2 μ g PE2EGE1G primers and 2 μ g PE2AXHO primers, add 50ng KHCV-LBC1 DNA (ATCC 75008) simultaneously as template, 10 μ l, 10 * polymerase buffer, 10 μ l 2mM dNTP (2mM dGTP, 2mM dATP, 2mM TTP, 2mM dCTP), 2.5 the Taq of unit polymerase, adding distil water make cumulative volume transfer to 100 μ l.

In reaction mixture, add 50 μ l mineral oil to avoid evaporating, repeat 25 times with reference example 6 described identical thermal cycles to carry out PCR.(1-3) separation and purified pcr product

The PCR product that obtains in above-mentioned (1-2) is carried out 5% polyacrylamide gel electrophoresis, and the result 550bp DNA that confirms to have an appointment is amplified.With above-mentioned identical this DNA of polyacrylamide gel electrophoresis purifying and called after GE1 GE2A fragment.(1-4) second polymerase chain reaction

In a test tube, add 2 μ g PE2ET2 primers and 2 μ g PE2AXHO primers, add 50ng plasmid pYLBC-A/G-UBE2C (ATCC74117 simultaneously as template, see Korean Patent public publication 93-683) and 50ng GE1GE2A fragment, 10 μ l, 10 * polymerase buffer, 10 μ l 2mM dNTP (2mMdGTP, 2mM dATP, 2mM TTP, 2mMd CTP), 2.5 Taq of unit polymerases make cumulative volume transfer to 100 μ l to adding distil water wherein.

In reaction mixture, add 50 μ l mineral oil to avoid evaporating, repeat 25 reference example 6 described identical thermal cycles to carry out PCR.(1-5) separation and purified pcr product

The PCR product that obtains in above-mentioned (1-4) is carried out 5% polyacrylamide gel electrophoresis, and the result 800bp DNA that confirms to have an appointment is amplified.With above-mentioned identical described DNA of polyacrylamide gel electrophoresis purifying and called after E1E2 fragment.＜step 2〉the preparation expression vector

According to reference example 1 in NEB damping fluid 3 with the dna fragmentation that obtains among Sac II and the XhoI catapepsis 2 μ g (1-5).

In a test tube, put into the above-mentioned dna fragmentation that obtains of 100ng, add again 50ng embodiment 2＜step 2 in the ptrp H-UB-T2/L fragment that obtains, 2 μ l 10 * connection damping fluid, 10 T4 of unit dna ligases, it is 20 μ l that adding distil water is adjusted cumulative volume, carries out coupled reaction 12 hours at 16 ℃.

With connecting the reorganization E.coli cell (Figure 12) that potpourri Transformed E .coli W3110 (ATCC 37339) obtains to contain the plasmid ptrp H-UB-E1E2 that comprises the E1E2 fragment.＜step 3〉expressing K HCV UBE1E2 albumen

With above-mentioned＜step 2〉E.coli W3110 (ATCC37339) cell that transforms of the plasmid ptrp H-UB-E1E2 of preparation is with embodiment 2＜step 3〉identical method cultivates centrifugal then collection E.coli cell precipitation thing.＜step 4〉determine the expression and the reactivity thereof of UBE1E2 albumen with the serum of hepatitis C patients

With embodiment 2＜step 4 identical mode is with above-mentioned＜step 3 the cell precipitation thing confirmed the expression and the reactivity thereof of UBE1E2 albumen with the serum of hepatitis C patients, the results are shown in Figure 13, wherein A is SDS-PAGE result, and B is the western blot analysis result.

In Figure 13 A and B, swimming

lane

1 and 4 is for having the E.coli product of the plasmid of not being with any KHCV dna fragmentation;

Swimming lane

2 and 5 illustrates the E.coli product that transforms with ptrp H-UB-E1E2; Swimming lane 3 is the standard molecular weight label, promptly from the gel under be 43,29,18 and 14 kilodaltons.＜step 5〉purifying UBE1E2 albumen (5-1) smudge cells and remove soluble protein

With 3g above-mentioned＜step 3 in the E.coli cell precipitation thing that obtains as embodiment 2＜step 5 handle with smudge cells as described in (5-1) and therefrom obtain insoluble precipitate.(5-2) washing insoluble precipitate

The sediment that obtains in (5-1) is suspended in 40ml to be contained in the damping fluid 8 of 1%Triton X-100, stirring at room suspension 30 minutes and at a hydro-extractor (Beckman J2-21, Rotor JA20) in centrifugal 25 minutes of 15000rpm to remove soluble protein, obtain insoluble precipitate.(5-3) with 4M urea and 0.5%Triton X-100 washing

The insoluble precipitate of (5-2) is suspended in damping fluid 9 (the 20mM phosphate that 100ml contains 8M urea and 0.5%Triton X-100, pH6.0,1mM EDTA and 10mM beta-mercaptoethanol) in, stirring at room suspension 2 hours and the centrifugal soluble protein of removing obtain insoluble precipitate.(5-4) with 1%SDS dissolution precipitation thing

The insoluble precipitate of (5-3) is suspended in 10ml contains among the PBS (10mM phosphate, pH7.0,150mM NaCl) of 1%SDS, stirred suspension 12 hours and the centrifugal insoluble precipitate of removing under the room temperature, obtain supernatant.(5-5) S-200 gel permeation chromatography

With the YM10 ultra filtration membrane (Amicon U.S.A.) is concentrated into 4ml with the supernatant that obtains among the 20ml (5-4), use subsequently a hydro-extractor (Beckman J2-21, Rotor JA21) centrifugal 25 minutes of 15000rpm to remove insoluble precipitate, obtain supernatant.This supernatant with 40ml/ hour flow velocity by with the S-200 resin column of the PBS balance that contains 1%SDS (Pharmacia LKB, 2.5cm * 90cm).Every 3ml component is collected the albumen under the wash-out and is carried out 15%SDS-PAGE and comprises the component that purity is at least 90% UBE1E2 albumen with collection.Embodiment 4 preparation KHCV NS4E1E2 albumen＜steps 1〉amplification NS4E1E2 gene (1-1) preparation primer

For the gene and the KHCV NS4E DNA of amplification coding HCV envelope protein antigen epi-position and be cloned into containing in the ubiquitin expression carrier under trp promoter control, synthetic following primer.The PNS4ET2 primer: 5 '-TGAGACTCCGCGGTGGTATCATCCCCGATAGGGAAGTT-3 ' comprises the 5422-5442 nucleotide of a Sac II recognition site and KHCV-LBC1; The PNS4EGE2C3 primer: 5 '-CAGAAGGCGCTCGGGTTGCCAGGAGGAGGAGGTGGTA

CTCGGGGAGAGCGTTGT-3 '. be included as the KHCV-LBC1 5530-5547 nucleotide district of NS4E DNA3 ' end region successively, a proline codon, six codon glycines, and be the KHCV-LBC1 2281-2298 nucleotide district of E2E gene 5 ' end region; And PE2AXHO primer: 5 ' AAAAAACTCGAGTTACCACCCCTGCGCGAATGTATC-3 ' comprises the translation stop codon that is positioned at after KHCV-LBC1 the 1749th nucleotide and gives and an Xho I recognition site.(1-2) polymerase chain reaction

In a test tube, put into 2 μ g PNS4EGE2C-3 primers and 2 μ g pE2AXHO primers, add 50ng again as the ptrp H-UB-E1E2 of template (embodiment 3＜step 2 〉), 10 μ l, 10 * polymerase buffer, 10 μ l2mM dNTP (2mM dGTP, 2mMd ATP, 2mM TTP, 2mMd CTP), 2.5 the Taq of unit polymerase, adding distil water to cumulative volume are 100 μ l.

In reaction mixture, add 50 μ l mineral oil to prevent volatilization, repeat 25 thermal cycles identical to carry out PCR with reference example 6.(1-3) separation and purified pcr product

The PCR product that obtains in above-mentioned (1-2) is carried out 5% polyacrylamide gel electrophoresis, and the result 800bp DNA that confirms to have an appointment is amplified.With above-mentioned same this DNA of polyacrylamide gel electrophoresis purifying and called after GENVEPI-III fragment.(1-4) second polymerase chain reaction

In a test tube, put into 2 μ g PNS4ET2 primers and 2 μ g PE2AXHO primers, add again as the 50ng embodiment 2 of template＜step 2 in the plasmid ptrp H-UB-NS4E that obtains, the GENVEPI-III fragment that 50ng above-mentioned (1-3) obtains, 10 μ l, 10 * polymerase buffer, 10 μ l 2mM dNTP (2mM dGTP, 2mM dATP, 2mMTTP, 2mMd CTP), 2.5 Taq of unit polymerases, adding distil water to cumulative volume are 100 μ l.

In reaction mixture, add 50 μ l mineral oil to avoid evaporating, repeat 25 thermal cycles identical to carry out PCR with reference example 6.(1-5) separation and purified pcr product

The PCR product that above-mentioned (1-4) obtained carries out 5% polyacrylamide gel electrophoresis, and the result 920bp DNA that confirms to have an appointment is amplified, with above-mentioned same this DNA of polyacrylamide gel electrophoresis purifying and called after NS4E1E2 fragment.＜step 2〉the preparation expression vector

As described in the reference example 1 in NEB damping fluid 3 with Sac II and XhoI catapepsis 2 μ g＜steps 1 (1-5) in dna fragmentation of obtaining.

In a test tube, put into the above-mentioned dna fragmentation that obtains of 100ng, add 50ng embodiment 2＜step 2 again〉the middle ptrpH-UB-T2/L fragment that obtains, 2 μ l 10 * connection damping fluid, 10 T4 of unit dna ligases, adding distil water to cumulative volume is 20 μ l, carries out coupled reaction 12 hours at 16 ℃.

With connecting potpourri Transformed E .coli W3110 (ATCC 37339) to obtain to contain the reorganization E.coli cell (Figure 14) of the plasmid ptrp H-UB-NS4E1E2 that comprises the NS4E1E2 fragment.＜step 3〉expression of NS4E1E2 dna fragmentation

With embodiment 2＜step 3 identical mode cultivates and has above-mentioned＜step 2 in E.coli W3110 (ATCC 37339) transformant of plasmid ptrp H-UB-NS4E1E2 of preparation, centrifugal then collection E.coli cell precipitation thing.＜step 4〉determine the expression and the reactivity thereof of UBNS4E1E2 albumen with the serum of hepatitis C patients

With embodiment 2＜step 4 identical mode is with above-mentioned＜step 3 the cell precipitation thing confirmed expression and the reactivity thereof of UBNS4E1E2 albumen in E.coli with the serum of hepatitis C patients, the results are shown in Figure 15, wherein A is SDS-PAGE result, and B is the western blot analysis result.

In Figure 15 A and B, swimming

lane

Swimming lane

2 and 5 illustrates the E.coli product that transforms with ptrp H-UB-NS 4 E1 E2; Swimming lane 3 is the standard molecular weight label, promptly from the gel under be 92,70,43,29 and 18 kilodaltons.＜step 5〉purifying UBNS 4 E1 E2 albumen (5-1) smudge cellses and remove soluble protein

With 3g above-mentioned＜step 3 in the E.coli cell precipitation thing that obtains as embodiment 2＜step 5 as described in handle with smudge cells and therefrom obtain insoluble precipitate.(5-2) washing insoluble precipitate

With insoluble precipitate of obtaining in (5-1) as embodiment 3＜step 5 handle to remove soluble protein as described in (5-2), obtain insoluble precipitate.(5-3) with the washing of 4M urea

Insoluble precipitate in (5-2) is suspended in 30ml contains in the damping fluid 2 of 4m urea, stirring at room suspension 2 hours is also centrifugal to remove soluble protein at 15000rpm with a hydro-extractor (Beckman J2-21, Rotor JA21); Obtain insoluble precipitate.(5-4) with the washing of 6M guanidine hydrochloride

Insoluble precipitate in (5-3) is suspended in 30ml to be contained in the damping fluid 2 of 6M guanidine hydrochloride, stirring at room suspending liquid 2 hours and with a hydro-extractor (Beckman J2-21, RotorJA21) centrifugal at 15000rpm to remove soluble protein, obtain insoluble precipitate.(5-5) with 1%SDS dissolution precipitation thing

The insoluble precipitate of (5-3) is suspended in PBS (the 10mM phosphate that 10ml contains 1%SDS, pH7.0,150mM NaCl) in, stir suspension 12 hours under the room temperature and at a hydro-extractor (Beckman J2-21, Rotor JA21) with the centrifugal insoluble precipitate of removing of 15000rpm, obtains supernatant in.(5-6) S-300 gel permeation chromatography

(Amicon U.S.A.) is concentrated into 4ml with the supernatant that obtains among the 10ml (5-5), uses a hydro-extractor (Beckman J2-21, Rotor JA21) subsequently, to remove insoluble precipitate, obtains supernatant centrifugal 25 minutes of 15000rpm with the YM10 ultra filtration membrane.This supernatant with 40ml/ hour flow velocity by (Pharmacia LKB, 2.5cm * 90cm) carry out gel permeation chromatography with the S-300 resin column of the PBS balance that contains 0.1%SDS.Every 2ml component is collected the albumen under the wash-out and is carried out 15%SDS-PAGE and comprises the component that purity is at least 90% UBNS4E1E2 albumen with collection, and the antigentic specificity of purifying protein is confirmed by western blot analysis.Embodiment 5 preparation KHCV NS5-1.2 albumen＜steps 1〉amplification NS5-1.2DNA (1-1) preparation primer

For the KHCV NS5-1.2DNA that increases (its 6649-7824 nucleotide by KHCV-LBC1 is formed) and be cloned into containing in the ubiquitin expression carrier under trp promoter control synthetic following primer.The PNS5T2 primer: 5 '-TGAGACTCCGCGGTGGTACGGGCATGACCACTGACAAC-3 ' comprises the 6649-6669 nucleotide of a Sac II recognition site and KHCV-LBC1; And PNS51.2SAL primer: 5 ' AAAAAAGTCGACTATTACGCCTTCCCCTTCATCTCCTT-3 ' comprises translation stop codon that is positioned at after KHCV-LBC1 the 7824th nucleotide, and a Sal I recognition site.(1-2) polymerase chain reaction

In a test tube, add 2 μ g PNS5T2 primers and 2 μ g PNS51.2 SAL primers, add 50ng KHCV-LBC1 DNA (ATCC 75008) simultaneously as template, 10 μ l, 10 * polymerase buffer, 10 μ l 2mMd NTP (2mM dGTP, 2mM dATP, 2.mMTTP, 2mMd CTP), 2.5 the Taq of unit polymerase, adding distil water make cumulative volume transfer to 100 μ l.

The PCR product that obtains in above-mentioned (1-2) is carried out 5% polyacrylamide gel electrophoresis, and the result 1.3kb DNA that confirms to have an appointment is amplified.With above-mentioned identical this DNA of polyacrylamide gel electrophoresis purifying and called after NS5-1.2 fragment.＜step 2〉the preparation expression vector

According to reference example 1 in NEB damping fluid 3 with Sac II and Sal I catapepsis 2 μ g＜steps 1 dna fragmentation that obtains in (1-3).

With connecting the reorganization E.coli cell (Figure 16) that potpourri Transformed E .coli W3110 (ATCC 37339) obtains to contain the plasmid ptrp H-UB-NS5-1.2 that comprises the NS5-1.2 fragment.＜step 3〉expression NS5-1.2DNA fragment

With above-mentioned＜step 2〉E.coli W3110 (ATCC 37339) cell that transforms of the plasmid ptrp H-UB-NS5-1.2 of preparation is with embodiment 2＜step 3〉identical mode cultivates centrifugal then collection E.coli cell precipitation thing.＜step 4〉determine the expression and the reactivity thereof of UBNS5-1.2 albumen with the serum of hepatitis C patients

With embodiment 2＜step 4 identical mode is with above-mentioned＜step 3 the cell precipitation thing confirmed the expression and the reactivity thereof of UBNS5-1.2 albumen with the serum of hepatitis C patients, the results are shown in Figure 17, wherein A is SDS-PAGE result, and B is the western blot analysis result.

In Figure 17 A and B, swimming lane 1 is for having the E.coli product of the plasmid of not being with any KHCV dna fragmentation;

Swimming lane

2 and 3 illustrates the E.coli product that transforms with ptrp H-UBNS5-1.2.＜step 5〉transform UBNS5-1.2 albumen (5-1) smudge cells and remove soluble protein

As embodiment 3＜step 5 sediment that obtains in the processing (5-1) as described in (5-2) to be to remove soluble protein, obtains insoluble precipitate.(5-3) dissolving insoluble precipitate

The insoluble precipitate of (5-2) is suspended in 100ml contains in the damping fluid 3 (50mM Tris, pH9.0,1mM EDTA, 10mM beta-mercaptoethanol) of 8M urea, stirring at room suspending liquid 1 hour and the centrifugal insoluble precipitate of removing obtain supernatant.(5-4) DEAE-Sepharose ion-exchange chromatography

The supernatant that obtains (5-3) with 2ml/ minute flow velocity by (Pharmacia, 2.5cm * 3cm) remain in free albumen in the post with same buffer solution elution with the DEAE-Sepharose post of above-mentioned damping fluid 3 balances.Subsequently with 8ml/ minute flow velocity add 300ml contain concentration gradient be the damping fluid 3 of NaCl of 0-0.3M with elution of bound albumen, every 4ml component is collected eluent.Protein component is carried out 15%SDS-PAGE contains UBNS5-1.2 albumen with collection component.(5-5) S-300 gel permeation chromatography

With YM10 ultra filtration membrane (Amicon, U.S.A.) concentrating protein component to the volume of collecting in (5-4) is 3ml, S-300 resin column (the Pharmacia that contains damping fluid 3 balances of 8M urea then with 10ml/ hour flow velocity by usefulness, 1.2cm * 120cm), collect the albumen that elutes and carry out 15%SDS-PAGE contains high-purity UBNS5-1.2 albumen with collection component with the 0.5ml component.(5-6) FPLC-phenyl-superose chromatography

The protein component of collecting in (5-5) is crossed the YM10 ultra filtration membrane, and (Amicon is U.S.A.) to concentrate its volume to 4ml.With a saturating folded film (Spectrum MedicalIndustries, Inc.M.W. cutoff value 6000-8000) concentrate is dialysed to remove urea to PBS (10mM phosphate, pH7.0,15mM NaCl).In solution, add NaCl to final concentration be 1.5M, obtain thing with 0.7ml/ minute flow velocity by with the FPLC-phenyl superose post of same buffer balance (Pharmacia, HR5/5,0.5cm * 5cm); Add identical damping fluid and be retained in free albumen in the post with wash-out.Add then and contain the PBS elution of bound albumen that linear concentration gradient is the NaCl of 1.5M-0M, and every 0.7ml is one group of collection eluate.Protein component is carried out 15%SDS-PAGE comprise the component that purity is at least 95% UBNS5-1.2 albumen with collection; The antigentic specificity of purifying protein is proved conclusively with western blot analysis.Embodiment 6 preparation HBVCORE albumen＜steps 1〉the preparation primer

(it is the part of Korea S type hepatitis B cDNA (pHBVadr) for the HBVCORE DNA that increases, see korean patent application publication 90-5959) and be cloned into trp promoter control comprising in the ubiquitin expression carrier down, synthesize following primer: the PCORET2 primer: 5 '-TGAGACTCCGCGGTGGTATGGACATTGACCCGTATAAA-3 ' comprises the 1-21 nucleotide of a Sac II recognition site and HBVCORE DNA.The PCORESAL primer: 5 '-AAAAAAGTCGACTATTAACATTGAGATTCCCGAGATTG-3 ' comprises a 3 ' terminal terminator codon and a Sal I recognition site that stops translation at HBVCORE DNA.(1-2) polymerase chain reaction

In a test tube, add 2 μ g PCORET2 primers and 2 μ g PCORESAL primers, add 50ng pHBVadr simultaneously as template, 10 μ l, 10 * polymerase buffer, 10 μ l 2mM dNTP (2mM dGTP, 2mM dATP, 2mMTTP, 20mMd CTP), 2.5 the Taq of unit polymerase, adding distil water make cumulative volume transfer to 100 μ l.

The PCR product that obtains in above-mentioned (1-2) is carried out 5% polyacrylamide gel electrophoresis, and the result 550bp DNA that confirms to have an appointment is amplified.With above-mentioned identical this DNA of polyacrylamide gel electrophoresis purifying and called after HBVCORE fragment.＜step 2〉the preparation expression vector

According to reference example 1 in NEB damping fluid 3 with Sac II and Sal I catapepsis 2 μ g above-mentioned＜step 1 (1-3) in the dna fragmentation that obtains.

With connecting the reorganization E.coli transformant (Figure 18) that potpourri Transformed E .coli W3110 (ATCC 37339) obtains to contain the plasmid ptrp H-UB-HBVCORE that comprises the HBVCORE fragment.＜step 3〉expression HBVCORE DNA

With above-mentioned＜step 2〉E.coli W3110 (ATCC 37339) cell that transforms of the plasmid ptrp H-UB-HBVCORE of preparation is with embodiment 2＜step 3〉identical mode cultivates centrifugal then collection E.coli cell precipitation thing.＜step 4〉determine the expression and the reactivity thereof of HBVCORE albumen with the serum of hepatitis B patient

With embodiment 2＜step 4 identical mode is with above-mentioned＜step 3 the cell precipitation thing confirmed the expression and the reactivity thereof of UBHBVCORE albumen with the serum of hepatitis B patient, the results are shown in Figure 19, wherein A is SDS-PAGE result, and B is the western blot analysis result.

In Figure 19, swimming lane 1 is for having the E.coli product of the plasmid of not being with any HBVDNA fragment;

Swimming lane

2 and 3 illustrates the E.coli product that transforms with ptrp H-UB-HBVCORE.＜step 5〉purifying UB HBVCORE albumen (5-1) smudge cells and remove soluble protein

With 3g above-mentioned＜step 3 in the E.coli cell precipitation thing that obtains as embodiment 2＜step 5 handle with smudge cells as described in (5-1) and therefrom obtain insoluble precipitate.(5-2) handle and the DEAE-Sepharose ion-exchange chromatography with 6M urea

Adding urea to final concentration in the insoluble precipitate that obtains in above-mentioned (5-1) is 6M, by to add 1M NaOH be 280ml to final volume the pH of suspension is transferred to 9.0.

Obtain thing with 3ml/ minute flow velocity by (Pharmacia, 1.25cm * 5cm) add identical damping fluid and remain in free albumen in the post with wash-out with the DEAE-Sepharose post of damping fluid 8 balances that contain 6M urea.Adding 100ml with 3ml/ minute flow velocity subsequently, to have concentration gradient be that the damping fluid 8 of 0-0.5M NaCl is collected eluate for one group with elution of bound albumen and every 3ml.Protein component carries out 15%SDS-PAGE comprises UB HBVCORE albumen with collection component.(5-3) S-300 gel permeation chromatography

The protein component that obtains in above-mentioned (5-2) with YM10 ultra filtration membrane (Amicon U.S.A.) is concentrated into the 5ml volume, then with 1ml/ minute flow velocity by with the S-300 resin column of damping fluid 8 balances (Pharmacia LKB, 2.5cm * 90cm).Collect the albumen that elutes and carry out 15%SDS-PAGE comprises high-purity UB HBVCORE albumen with collection component with one group of 3ml.(5-4) urea is removed in dialysis

Use a dialysis membrane (Spectra/por, No.1, M.W. cutoff value: 6000-8000) at 4 ℃ of protein components of collecting in above-mentioned (5-3) to damping fluid 10 (20mM Tris, pH8.0,1mM EDTA, 10mM β 3-mercaptoethanol) dialyse removing urea, centrifugal subsequently to obtain to contain the solubility supernatant that purity is at least 95% UB HBVCORE albumen.Embodiment 7 preparation HBV Pre S2 S Ag albumen＜steps 1〉the preparation expression vector

The carrier pLBC-PSAG14 (seeing Korean Patent publication 90-5959) that 10 μ g comprise HBV Pre S2 DNA handled 1 hour with 10 unit limit restriction endonuclease BamH at 37 ℃, carried out 1% agarose gel electrophoresis contains the dna sequence dna of coding ADH2 promoter-front surface antigenic-surface antigen-GAPDH terminator with acquisition BamHI box then.This box is dissolved in 20 μ l TE damping fluids, is cloned into the pYLBC that cuts and handle with bacterial alkaline phosphatase with the BamHI enzyme.(Yeast Genetics Stock Center U.S.A.) also therefrom separates recombinant expression carrier pYPSAG100 (Figure 20) according to Hinnen method (Proc.Natl.Acad.Sci.U.S.A., 75,1929-1933 (1978)) transformed saccharomyces cerevisiae X400-5B.＜step 2〉preparation HBV Pre S2 S Ag albumen

With above-mentioned＜step 1〉in carrier pYPSAG100 transformed saccharomyces cerevisiae X400-5B (the Yeast Genetics Stock Center that obtains, U.S.A.), (every liter of nutrient culture media contains 6.7g and does not contain amino acid whose yeast nitrogen yeast after the conversion at 3ml leucine auxotrophy nutrient culture media, the 182g sorbierite, 2% glucose, 0.25g adds leucine) cultivated 24 hours in 30 ℃.

(DYNAC U.S.A.) the centrifugal culture of 3000rpm 5 minutes, removes supernatant with a hydro-extractor.Sediment is at 5ml nutrient culture media (2% glucose, 1% yeast extract, the 2%Bacto peptone) vibration is 8 hours in, at the centrifugal culture of 3000rpm to remove supernatant, obtain sediment, sediment is cultivated the expression with the front surface antigenic and the surface antigen of induced hepatitis B virus in 4 hours in 30 ℃ in 5ml YEPE nutrient culture media (5% ethanol, 1% yeast extract, 2%Bacto peptone).＜step 3〉purifying Pre S2 S Ag albumen

A hydro-extractor (Beckman rotor JA4.2, U.S.A.) with the centrifugal 1l of 3500rpm above-mentioned＜step 2 culture that obtains 10 minutes to be to collect the yeast cells sediment.The cell precipitation thing is dissolved in 50ml damping fluid (10mM Tris-HCl, pH7.5), 1mM EDTA, 0.1%Triton X-100,1mM phenylmethylsulfonyl fluoride) in and to add isopyknic diameter in this suspension be the beaded glass of 0.45mm, with the suspension thermal agitation that obtains 3 times, each 5 minutes, (Beckman rotor JS-13 U.S.A.) obtained thing 30 minutes in that 1500rpm is centrifugal, obtained supernatant with a hydro-extractor.

Supernatant by with monoclonal antibody (the CHII 5-60 of hepatitis B vaccine surface antigen, Lucky Central Research Institute) the Sepharose CL-4B affinity column (Pharmacia of combination, U.S.A.), wherein the dried Sepharose CL-4B of the every gram of this post contains the 8mg monoclonal antibody.(10mM Tris, pH7.5 1MNaCl) fully wash post with the activation post by elution buffer.Add the supernatant that contains surface antigen and wash the A of post continuously with 1ml/ hour flow velocity until eluate with 10mM Tris-1M NaCl damping fluid ₂₈₀Reach 0.Xiang Zhuzhong adds damping fluid, and (10mM Tris-HCl is pH7.5) to remove nonspecific proteins and to regulate the A of eluate ₂₈₀Be 1.

Work as A ₂₈₀Arrive at 1 o'clock, add damping fluid (3M NH ₄SCN, 50mM Tris is pH7.5) with the surface antigen protein of elution of bound, and at A ₂₈₀The peak value place collect 20ml wash-out component down, (50mM Tris pH7.5) dialysed 24 hours to the 4l damping fluid with this component at 4 ℃.

With YM30 ultra filtration membrane (Amicon, U.S.A.) will obtain thing and be concentrated into 1ml, concentrate is crossed SepharoseCL-4B post (1.5 * 90cm, Phatmacia Co., U.S.A.), (0.1M sodium phosphate, pH7.0 be with elution of bound albumen, and collect eluate with every group of 2ml by add damping fluid with 50ml/ hour flow velocity.Use Oszyme II (Abott Co.) to measure every pipe and collect and have reactive component.In the solution that obtains, add CsCl ₂Solution is so that its final concentration is 1.2g/cm ³, with a hydro-extractor (Beckman rotor 41Ti, U.S.A.) the centrifugal suspension of 35000rpm 24 hours to obtain sediment.

Adopt Laemmli method (Nature 227,680 (1970)) that sediment is carried out SDS-PAGE contains described albumen with collection component (Figure 21).Embodiment 8 preparation immunoblotting assay kits

With engram analysis damping fluid (100mM sodium carbonate, pH9.5) 5 kinds of HCV antigen protein (KHCV CORE14 of dilution, KHCV NS4E, KHCV NS4E1E2, KHCV 897 and KHCV NS5-1.2), 2 kinds of HBV antigen proteins (HBV CORE and HBV Pre S2 S Ag), ubiquitin and immunoglobulin G while (hIgG) make its concentration as follows:

HIgG:5 μ g/ml and 0.1 μ g/ml;

KHCV CORE14：10μg/ml；

KHCV NS4E：20μg/ml；

KHCV NS4E1E2：10μg/ml；

KHCV 897：10μg/ml；

KHCV NS5-1.2：20μg/ml；

HBV CORE：10μg/ml；

HBV Pre S2 S Ag:10 μ g/ml; And

UB：5μg/ml.

Every kind of dilution that contains antigen protein is added to nitrocellulose filter (Schliescher ﹠amp; Schuell; BA83; aperture 0.22 μ m; U.S.A.) narrow line is (in 0.7 * 0.7mm); described narrow line is used a kind of slot blot device (Bio-Rad Lab., Dot SF blotter, Cat.No.170-6542 in advance; U.S.A.) soak the trace damping fluid, wash once with identical damping fluid with volume in the following sequence subsequently:

Narrow line 1:hIgG 5 μ g/ml, 250 μ l;

Narrow line 2:KHCV CORE14 10 μ g/ml, 250 μ l;

Narrow line 3:KHCV NS4E 20 μ g/ml, 125 μ l; And

KHCV NS4E1E2 10μg/ml，125μl；

Narrow line 4:KHCV 897 10 μ g/ml, 250 μ l;

Narrow line 5:KHCV NS5-1.2 20 μ g/ml, 250 μ l;

Narrow line 6:HBV CORE 10 μ g/ml, 250 μ l;

Narrow line 7:HBV Pre S2 S Ag 10 μ g/ml, 250 μ l;

Narrow line 8:UB 5 μ g/ml, 250 μ l; And

Narrow line 9:hIgG 0.1 μ g/ml, 250 μ l.

By filtering protein solution to the vacuum pressure that applies 10-20 minute 8-10Hg on the nitrocellulose filter and antigen protein being printed on the nitrocellulose filter, in each narrow line, add 250 μ l trace damping fluids to wash film one time, and once filter again.

Take off nitrocellulose filter and about 10 minutes of 60 ℃ of dryings with a pincet.Dried nitrocellulose filter is put into the physiological saline by phosphate-buffered that contains 0.1% gelatin, in 30 minutes non-specific binding of room temperature jog with blocks protein and free imprinted sites.Filter membrane after dried under above-mentioned the same terms is numbered or is incorporated on the support that bears serial numbers with suitable method subsequently.Filter membrane is cut into the filter membrane bar that comprises all narrow lines, and every contains a kind of antigen protein.Embodiment 9 uses HP immunoblotting kit to detect

Every filter membrane bar of preparation in the foregoing description 8 is put into a glass tube (13 * 100mm), Xiang Guanzhong add contain 5 μ g/ml UB, with PBS (0.25% gelatin, 1%Triton X-100,1mm EDTA and 0.02%Thimerosal) blood serum sample of 50 times of dilutions is until complete submergence filter membrane bar.Effective parafilm film sealed and the slight vibration of room temperature 2 hours so that antigen on the filter membrane bar and the antibody response in the blood serum sample.

Remove serum deprivation with a suction means from glass tube, add 4ml wash solution (PBS that comprises 0.05%Tween 20) and wash the filter membrane bar one time in each glass tube, about 4 minutes of oscillating tube is removed wash solution subsequently.

10 filter membrane bars are collected in one to be contained in the reaction utensil of 20ml wash solution and with wash solution and washes 3 times.Adding contains goat anti-human IgG antibody (the goat anti-hIgG (γ)-HRP) of the 20ml of 10 μ g/ml UB with horseradish peroxidase-labeled in reaction utensil, described antibody (contains 10% hyclone, 1%Ficoll with 5-7 μ g/ml enzyme labelled antibody thinning agent, 0.05%Tween 20, the PBS of 0.02%Thimerosal) dilution.

Obtain thing the slight vibration of room temperature 40 minutes reacting, and, wash altogether four times at every turn with the described damping fluid washing of 20ml, use the 20ml reaction buffer then (50mm Tris, pH7.5) washing is washed 2 times altogether at every turn.Contain the reaction buffer of 400 μ g/ml4-chloro-1-naphthols and 0.03% hydrogen peroxide to wherein adding 20ml, and the slight vibration of room temperature 20 minutes to react.

After removing reaction buffer, film is with distillation washing 2 times, is transferred on the absorption paper and drying at room temperature 20 minutes, and visible colour band is illustrated in the filter membrane bar.

The results are shown in table 1, wherein show for sample 1-18 number, show the result who obtains with the serum of taking from hepatitis B patient for sample 19-21 number by the result of Ortho kit test positive.

Table 1

	ELISA			Immunoblotting assay
	ELISA			Immunoblotting assay								Sample No.	The 1st generation of Ortho	The 1st generation of Lucky	The HCV antigen protein				The HBV antigen protein		Judge
KHCV CORE14 KHCV NS4E1E2		KHCV 897	KHCV NS5-1.2	HBV CORE	HBV Pre S2		HCV	HDV							The HCV antigen protein				The HBV antigen protein		Judge
KHCV CORE14 KHCV NS4E1E2		KHCV 897	KHCV NS5-1.2	HBV CORE	HBV Pre S2		HCV	HDV	1	+	-				-	-	-	-	-	-	-	-
2	+	+		3+	3+	3+	3+	-	1	+	-	-	+	-	-	-	-	-	-	-	-	-
2	+	+		3+	3+	3+	3+	-	3	+	+	-	+	-	3+	2+	3+	3+	-	-	+	-
4	+	+/-		-	-	-	-	-	3	+	+	-	-	-	3+	2+	3+	3+	-	-	+	-
4	+	+/-		-	-	-	-	-	5	+	+	-	-	-	-	2+	3+	2+	1+	2+	+	Convalescence
6	+	-		-	-	-	-	-	5	+	+	-	-	-	-	2+	3+	2+	1+	2+	+	Convalescence
6	+	-		-	-	-	-	-	7	+	-	-	-	-	-	-	-	-	-	+	-	Convalescence
8	+	-		-	-	-	-	+	7	+	-	+	-	Convalescence	-	-	-	-	-	+	-	Convalescence
8	+	-		-	-	-	-	+	9	+	-	+	-	Convalescence	-	-	-	-	+	-	-	-
10	+	-		-	-	-	-	-	9	+	-	-	-	-	-	-	-	-	+	-	-	-
10	+	-		-	-	-	-	-	11	+	-	-	-	-	-	-	-	-	-	+	-	Convalescence
12	+	-		-	-	-	-	-	11	+	-	+	-	Convalescence	-	-	-	-	-	+	-	Convalescence
12	+	-		-	-	-	-	-	13	+	-	+	-	Convalescence	2+	2+	2+	2+	1+	1+	+	Convalescence
14	+	-		2+	1+	3+	-	1+	13	+	-	1+	+	Convalescence	2+	2+	2+	2+	1+	1+	+	Convalescence
14	+	-		2+	1+	3+	-	1+	15	+	-	1+	+	Convalescence	-	-	-	-	1+	1+	-	Convalescence
16	-	-		-	-	-	-	1+	15	+	-	1+	-	Convalescence	-	-	-	-	1+	1+	-	Convalescence
16	-	-		-	-	-	-	1+	17	+	-	1+	-	Convalescence	-	-	-	-	1+	1+	-	Convalescence
18	+	-		-	-	-	-	-	17	+	-	-	-	-	-	-	-	-	1+	1+	-	Convalescence
18	+	-		-	-	-	-	-	19	-	-	-	-	-	-	-	-	-	2+	-	-	Acute
20	-	-		-	-	-	-	3+	19	-	-	-	-	Acute	-	-	-	-	2+	-	-	Acute
20	-	-		-	-	-	-	3+	21	-	-	-	-	Acute	-	-	-	-	2+	2+	-	Convalescence

The judgement of embodiment 10 test results

By the color depth of more every kind of antigen protein and two kinds of contrasts, as the above-mentioned test result that judges.

1) at first, checks and to be with 1 and be with and whether have color in 9 on the hIgG and be with whether there is not color in 8 on the ubiquitin.

2) be that the basis illustrates the reactive as follows of every band with colourity: Colourity on every band Reactive0-less than with the colourity of hIgG in 9+/-be similar to the colourity 1+ of hIgG in 9 with 1 and with 9 between the colourity of hIgG 2+ greater than the colourity 3+ of hIgG in 1

3) according to above-mentioned 2) indication, as the specimen that judges:

Reactive

JudgeThe 1+ or the higher positive-or+/-negative 1+ or higher but be 1+ or higher with the colourity of UB undetermined in 8

4) under the hepatitis B situation, if HBVCORE and HBV Pre S2 S Ag band is+or have only HBV Pre S2 S Ag band for+, then this patient is considered to be in hepatitis B convalescence, if having only the HBVCORE band for+, think that then the patient is just suffering from acute hepatitis B.

Judged result according to above-mentioned standard is shown in Table 1, in by 18 kinds of blood serum samples of Ortho first generation detection kit test positive, ELISA method (Korean Patent publication 93-683) detection with Lucky Ltd. only has 5 kinds of samples to be positive, and a kind of sample is neutral; And have 5 kinds of samples to be positive with kit detection of the present invention.

Detect with the ELISA method of Lucky Ltd. that to be neutral sample 4 negative with kit detection of the present invention the time.

These results show that kit of the present invention greatly reduces false positive results than Ortho kit, and can be used for proving conclusively blood serum sample by the ELISA test positive to reduce the false positive detection probability.

On the other hand, tested the blood serum sample of 178 kinds of hepatitis with kit of the present invention and PCR, had 136 kinds of samples to be detected as the positive, test result is shown in following table 2.

Table 2

	NS5 1.2	897	CORE 14	NS4E1E2
	NS5 1.2	897	CORE 14	NS4E1E2	PCR+(123)	75	83	119	88
PCR-(13)	8	11	13	11	PCR+(123)	75	83	119	88

In addition, (Orho Diagnostic Systems Co. USA) detects above-mentioned blood serum sample, to confirm above-mentioned test result with RIBA II.

Its result with relatively be shown in following table 3 with the result of kit of the present invention acquisition.

Table 3

	Kit of the present invention		RIBA II
	Kit of the present invention		RIBA II		Positive	Neutral	Positive	Do not determine
	PCR+(123)	123	0	113	Positive	Neutral	Positive	Do not determine	10
PCR-(13)	PCR+(123)	123	0	113	13		13		10

As shown in table 3, identical with kit testing result of the present invention in by 123 kinds of samples of PCR test positive, and 10 kinds of samples are arranged for determining with RIBA II (Ortho DiagnosticSytems Co.) detection.

These results show that method of the present invention can significantly reduce the error-detecting probability and can detect two kinds of hepatitis viruss, i.e. hepatitis C virus and hepatitis type B virus simultaneously.

And,, infect so might detect HCV more accurately because kit of the present invention contains the epitope of many KHCV envelope proteins, KHCV E1E2 albumen and KHCV NS5-1.2 albumen.

Although the present invention is described in conjunction with above-mentioned specific embodiments, it is conspicuous being understood that the various improvement of having done for the present invention and changing those skilled in the art, and is also contained in the appended claims restricted portion.

Claims

1, a kind of kit that is used for detecting simultaneously hepatitis type B virus and hepatitis C virus, it comprises:

(A) one or more comprise the C hepatitis virus antigen albumen of one or more epi-positions of the core protein of hepatitis C virus, non-structure 3 albumen, non-structure 4 albumen and envelope protein; And

(B) one or more comprise the hepatitis B virus antigen albumen of at least one epi-position of the albumen of the core protein that is selected from hepatitis type B virus and surface antigen protein.

2, kit as claimed in claim 1, it comprises:

(A) one or more are selected from the C hepatitis virus antigen albumen in one group that is made up of KHCV CORE 14 albumen, KHCV 897 albumen, KHCV NS4E albumen, KHCV NS4E1E2 albumen and KHCV NS5-1.2 albumen; And

(B) one or more are selected from the hepatitis B virus antigen albumen of HBV CORE albumen and HBV Pre S2 S Ag albumen, and described albumen has following amino acid sequence: KHCV CORE14:MetSerThrAsnProLysProGlnArgLysThrLysArgAsnThrAsnA rgArgProGlnAspIleLysPheProGlyGlyGlyGlnIleValGlyGlyValTyr LeuLeuProArgArgGlyProArgLeuGlyValArgAlaThrArgLysThrSerGl uArgSerGlnProArgGlyArgArgGlnProIleProLysAlaArgArgProGluG lyArgAlaTrpAlaGlnProGlyTyrProTrpProLeuTyrGlyAsnGluGlyLeu GlyTrpAlaGlyTrpLeuLeuSerProArgGlySerArgProSerTrpGlyProTh rAspProArgArgLysSerArgAsnLeuGlyLysValIleAspThrLeuThrCys; KHCV 897：AlaValGluPheIleProValGluSerMetGluThrThrMetArgSerProValPheThrAspAsnProSerProProAlaValProGlnThrPheGlnValAlaHisLeuHisAlaProThrGlySerGlyLysSerThrArgValProAlaAlaTyrAlaAlaGlnGlyTyrLysValLeuValLeuAsnProSerValAlaAlaThrLeuGlyPheGlyAlaTyrMetSerLysAlaHisGlyIleAspProAsnLeuArgThrGlyValArgThrIleThrThrGlyAlaProIleThrTyrSerThrTyrGlyLysPheLeuAlaAspGlyGlyGlySerGlyGlyAlaTyrAspIleIleMetCysAspGluCysHisSerThrAspSerThrThrIleTyrGlyIleGlyThrValLeuAspGlnAlaGluThrAlaGlyAlaArgLeuValValLeuSerThrAlaThrProProGlySerValThrValProHisLeuAsnIleGluGluValAlaLeuSerAsnThrGlyGluIleProPheTyrGlyLysAlaIleProIleGluAlaIleLysGlyGlyArgHisLeuIlePheCysHisSerLysLysLysCysAspGluLeuAlaAlaLysLeuSerGlyLeuGlyLeuAsnAlaValAlaTyrTyrArgGlyLeuAspValSerValIleProThrSerGlyAspValValValValAlaThrAspAlaLeuMetThrGlyPheThrGlyAspPheAspSerValIleAspCysAsnThrCys； KHCV NS4E:IleIleProAspArgGluValLeuTyrGlnGluPheAspGluMetGluGlu CysAlaSerHisLeuProTyrPheGluGlnGlyMetGlnLeuAlaGluGlnPheLy sGlnLysAlaLeuGlyLeu; KHCV ElG:ValSerGlnLeuPheThrPheSerProArgArgHisGluThrValGlnAspC ysAsnCysSerIleTyrProGlyArgValSerGlyHisArgMetAlaTrpAspMet MetMetAsnTrpSerProThrThrAlaLeuValValSerGlnLeuLeuArgIlePr oGlnAlaValValAspMetValThrGlySerHisTrpGlyIleLeuAlaGlyLeuA laTyrTyrSerMetValGlyAsnTrpAlaLysValLeuIleAlaMetLeuLeuPhe AlaGlyValAspGlyThrThrHisValThrGly; KHCV E2A:GlyAlaGlnGlyArgAlaAlaSerSerLeuThrSerLeuPheSerProGlyP roValGlnHisLeuGlnLeuIleAsnThrAsnGlySerTrpHisIleAsnArgThr AlaLeuSerCysAsnAspSerLeuAsnThrGlyPheValAlaAlaLeuPheTyrLy sTyrArgPheAsnAlaSerGlyCysProGluArgLeuAlaThrCysArgProIleA spThrPheAlaGlnGlyTrp; KHCV E2E:ThrArgGlyGluArgCysAspLeuGluAspArgAspArgSerGluLeuSerP roLeuLeuLeuSerThrThrGluTrpGlnValLeuProCysSerPheThrThrLeu ProAlaLeuSerThrGlyLeuIleHisLeuHisGlnASnIleValAspIleGlnTy rLeuTyrGlyIleGlySerAlaValValSerPheAlaIleLysTrpGluTyrIleV alLeuLeuPheLeuLeuLeuAlaAspAla; KHCV NS5-1.2：ThrGlyMetThrThrAspAsnValLysCysProCysGlnValProAlaProGluPhePheThrGluValAspGlyValArgLeuHisArgTyrAlaProAlaCysArgProLeuLeuArgGluGluValValPheGlnValGlyLeuHisGlnTyrLeuValGlySerGlnLeuProCysGluProGluProAspValAlaValLeuThrSerMetLeuThrAspProSerHisIleThrAlaGluThrAlaLysArgArgLeuAlaArgGlySerProProSerLeuAlaSerSerSerAlaSerGlnLeuSerAlaProSerLeuLysAlaThrCysThrThrHisHisAspSerProAspAlaAspLeuIleGluAlaAsnLeuLeuTrpArgGlnGluMetGlyGlyAsnIleThrArgValGluSerGluAsnLysValValIleLeuAspSerPheAspProLeuArgAlaGluAspAspGluGlyGluIleSerValProAlaGluIleLeuArgLysSerArgLysPheProProAlaLeuProIleTrpAlaProProAspTyrAsnProProLeuLeuGluSerTrpLysAspProAspTyrValProProValValHisGlyCysProLeuProProThrLysAlaProProIleProProProArgArgLysArgThrValValLeuThrGluSerThrValSerSerAlaLeuAlaGluLeuAlaThrLysThrPheGlySerSerGlySerSerAlaIleAspSerGlyThrAlaThrAlaProProAspGlnAlaSerGlyAspGlyAspArgGluSerAspValGluSerPheSerSerMetProProLeuGluGlyGluProGlyAspProAspLeuSerAspGlySerTrpSerThrValSerGluGluAlaSerGluAspValValCysCysSerMetSerTyrThrTrpThrGlyAlaLeuIleThrProCysAlaAlaGluGluSerLysLeuProIleAsnProLeuSerAsnSerLeuLeuArgHisHisAsnMetValTyrAlaThrThrSerArgSerAlaGlyLeuArgGlnLysLysValThrPheAspArgLeuGlnValLeuAspAspHisTyrArgAspValLeuLysGluMetLysAlaLysAla； HBVCORE:MetAspIleAspProTyrLysGluPheGlyAlaSerValGluLeuLeu SerPheLeuProSerAspPhePheProSerIleArgAspLeuLeuAspThrAlaSe rAlaLeuTyrArgGluAlaLeuGluSerProGluHisCysSerProHisHisThrA laLeuArgGlnAlaIleLeuCysTrpGlyGluLeuMetAsnLeuAlaThrTrpVal GlySerAsnLeuGluAspProAlaSerArgGluLeuValValSerTyrValAsnVa lAsnMetGlyLeuLysIleArgGlnLeuLeuTrpPheHisIleSerCysLeuThrP heGlyArgGluThrValLeuGluTyrLeuValSerPheGlyValTrpIleArgThr ProProAlaTyrArgProProAsnAlaProIleLeuSerThrLeuProGluThrTh rValValArgArgArgGlyArgSerProArgArgArgThrProSerProArgArgA rgArgSerGlnSerProArgArgArgArgSerGlnSerArgGluSerGlnCys; andHBV preS2 sAg：MetGlnTrpAsnSerThrThrPheHisGlnAlaLeuLeuAspProArgValArgGlyLeuTyrPheProAlaGlyGlySerSerSerGlyThrValAsnProValProThrThrAlaSerProIleSerSerIlePheSerArgThrGlyAspProAlaProAsnMetGluSerThrThrSerGlyPheLeuGlyProLeuLeuValLeuGlnAlaGlyPhePheLeuLeuThrArgIleLeuThrIleProGlnSerLeuAspSerTrpTrpThrSerLeuAsnPheLeuGlyGlyAlaProThrCysProGlyGlnAsnSerGlnSerProThrSerAsnHisSerProThrSerCysProProIleCysProGlyTyrArgTrpMetCysLeuArgArgPheIleIlePheLeuPheIleLeuLeuLeuCysLeuIlePheLeuLeuValLeuLeuAspTyrGlnGlyMetLeuProValCysProLeuLeuProGlyThrSerThrThrSerThrGlyProCysLysThrCysThrIleProAlaGlnGlyThrSerMetPheProSerCysCysCysThrLysProSerAspGlyAsnCysThrCysIleProIleProSerSerTrpAlaPheAlaArgPheLeuTrpGluTrpAlaSerValArgPheSerTrpLeuSerLeuLeuValProPheValGlnTrpPheAlaGlyLeuSerProThrValTrpLeuSerValIleTrpMetMetTrpTyrTrpGlyProSerLeuTyrAsnIleLeuSerProPheLeuProLeuLeuProIlePhePheCysLeuTrpValTyrIle.

3, kit as claimed in claim 1, wherein, at least a C hepatitis virus antigen albumen or hepatitis B virus antigen albumen are a kind of recombinant proteins, wherein the epi-position of antigen protein and another kind of albumen merge to form a peptide molecule.

4, kit as claimed in claim 3, wherein said another kind of albumen is ubiquitin.

5, kit as claimed in claim 4, it comprises KHCV UB CORE 14 albumen, KHCV UB NS4E albumen, KHCV UB NS4E1E2 albumen, KHCV UB 897 albumen and KHCV UB NS5-1.2 albumen, HBVCORE albumen and HBV Pre S2 S Ag.

6, kit as claimed in claim 5, it further comprises the ubiquitin as negative control albumen, and as the human immunoglobulin(HIg) of positive control albumen.

7, detect the method for hepatitis type B virus and hepatitis C virus simultaneously, it comprises following step:

(A) each each HCV antigen protein and each HBV antigen protein of kit of claim 1 to 6 contacted to form antigen antibody complex with blood serum sample;

(B) measure the amount of each antigen antibody complex; And

(C) amount based on different antigen antibody complexs detects hepatitis type B virus and hepatitis C virus.

8, be used for detecting simultaneously the method for hepatitis type B virus and hepatitis C virus, it comprises following step:

(A) handle the filter membrane that is absorbed with purifying human immunoglobulin(HIg), KHCVUB CORE 14 albumen, KHCV UB NS5-1.2 albumen, KHCV UB NS4E1E2 albumen, KHCV UB 897 albumen, HBV CORE albumen, HBV Pre S2 S Ag and ubiquitin respectively with a lock solution;

(B) filter membrane after will sealing is parallel is attached on the supporting film forming composite membrane, and cuts this composite membrane preparing a filter membrane bar, comprising each filter membrane of homalographic to form 8 protein bands;

(C) with filter membrane bar and blood serum sample reaction;

(D) with filter membrane bar of obtaining in (C) and anti-human IgG antibody's reaction with horseradish peroxidase or alkali phosphatase enzyme mark;

(E) substrate of a kind of horseradish peroxidase of adding or alkaline phosphatase;

(F) color density of every protein band of mensuration after carrying out chromogenic reaction on the filter membrane bar, and

(G) color density based on protein band detects hepatitis type B virus and hepatitis C virus.