CN118339454A - Novel lateral chromatography detection - Google Patents

Abstract

The invention provides a novel lateral chromatography detection method. The lateral chromatography detection uses an antibody immobilized on a label, which is an iron (III) oxide particle, to detect an antigen in a sample.

Description

Novel lateral chromatography detection

Technical Field

The invention relates to a novel lateral chromatography detection method.

Background

Immunoassays using fragments comprising proteins, particularly antibodies, and their molecular recognition sites have been used in the medical diagnostic field. For example, there are known clinical tests for detecting antigen proteins involved in a specific disease, or for qualitatively or quantitatively detecting a specific pathogenic microorganism, virus, or chemical substance in clinical samples such as nasal swab liquid, blood, urine, or the like. In immunoassay, lateral chromatography detection is used in a wide range of fields such as clinical, veterinary, agricultural, food industry, biological defense and sanitary environments, since it is possible to visualize the presence of an antigen by visually observing the color developed on a membrane by an antigen-antibody reaction, and thus, it is possible to detect a target substance by a simple operation without requiring a special detection device.

Lateral chromatography detection is a method excellent in both sensitivity and reproducibility as a clinical examination method, but has a technical problem in terms of running cost particularly in fields other than the medical diagnosis field (agriculture, food industry, sanitary environment investigation, etc.). Detection devices for detecting food allergens, detecting lateral chromatography for living environment investigation, and the like are commercially available for non-medical diagnostic purposes, but most of them are sold in a price range of more than 1,000 yen per test. For example, food allergens, sanitary environment surveys, and the like, consumers should be properly conducted when such devices are needed, but use of the consumers is limited due to the high price of the devices. One of the reasons for this is that the lateral chromatography assay is basically a disposable format, and expensive carriers for detection or proteins for detection that serve the assay function cannot be reused. In particular, gold nanoparticles are frequently used as a detection carrier for lateral chromatography detection (for example, non-patent document 1), but there are problems in that gold is a rare metal, and is affected by market conditions of world gold market, and is expensive and unstable in price. In addition, latex nanoparticles, colored silica nanoparticles, colored cellulose nanoparticles, and the like are also used, and are nanoparticles manufactured by using a high technology, and therefore, are sold in a price range equivalent to gold nanoparticles, and even if such materials are used, the technical problem that the carrier is expensive is not solved.

On the other hand, magnetic detection type lateral chromatography detection using iron (II, III) oxide (Fe ₃O₄) nanoparticles is utilized, but in addition to nanoparticles still being expensive, the main focus is on detecting magnetism, and therefore, it has been a technical problem in terms of general consumer utilization on the premise that a dedicated detection device is utilized. In addition, lateral chromatography detection using iron (II, III) oxide nanoparticles was also confirmed visually (non-patent document 2), but the visibility was insufficient.

(Non-patent literature) 1)Tanaka,R.et al.A novel enhancement assay for immunochromatographic test strips using gold nanoparticles.Anal Bioanal Chem 385,1414-1420,2006

(Non-patent literature) 2)Connolly,R.&O'Kennedy,R.Magnetic lateral flow immunoassay test strip development-Considerations for proof of concept evaluation.Methods 116,132-140,2017

Disclosure of Invention

The present invention relates to the following 1) and 2).

1) A lateral flow assay wherein an antibody immobilized to a label, which is an iron (III) oxide particle, is used to detect an antigen in a sample.

2) A reagent for lateral chromatography detection, which comprises an antibody immobilized on iron (III) oxide particles.

Drawings

FIG. 1 shows a general structure of a test strip for lateral flow assay.

Fig. 2 is a comparison of the detection line discrimination of iron (III) oxide particles and iron (II, III) oxide particles.

Detailed Description

In the present specification, the term "lateral chromatography detection" refers to a method of expanding a sample in a direction horizontal to a membrane in a method of detecting the presence of an antigen contained in the sample by visual perception using a labeled antibody that specifically binds to an antigen and is immobilized to a label and a capture antibody that specifically binds to an antigen and is immobilized to a membrane. The "label" here refers to a substance that supports an antibody and functions as a visually detectable label. In the lateral chromatography detection, specifically, a complex is formed between a labeled antibody and an antigen in a sample, and a capture antibody immobilized on a membrane captures the complex, whereby the complex is accumulated and developed, and therefore, the presence of the antigen in the sample can be detected. In the present specification, the expression "antibody is supported on a carrier or a membrane" or the state of being supported is "immobilized" or "immobilized".

In the present specification, the target "antigen" is not particularly limited, and examples thereof include antigens derived from allergens, biomarkers, viruses, bacteria, fungi, protozoa, and the like. In the present specification, the term "detection" may also be referred to as "measurement", and "detection of an antigen" includes the demonstration of the presence or absence of an antigen and the quantification of an antigen, and should be interpreted in the broadest sense and not be interpreted in any way.

An allergen refers to a substance that enters an organism from the outside by inhalation, penetration, ingestion, or contact and causes an allergic reaction or allergy. As the allergen, those derived from: grass pollen (reed, timothy, barley grass, duck grass, bermudagrass, wheat, creeping bentgrass, paspalum, stone grass, meadow bluegrass, yellow fescue, meadow fescue, ryegrass, etc.); weed pollen (sage, nettle, ragweed, humulus scandens, dandelion, mugwort, sorrel, ragweed, aster ageratoides, plantain, mugwort, etc.); tree pollen (acacia, olive, maple, walnut, mulberry, oak, birch, elm, alder, fir, hinoki, juniper, beech, pine, willow, etc.); fungi or bacteria (aspergillus, alternaria, staphylococcus aureus enterotoxin a, staphylococcus aureus enterotoxin B, candida, cladosporium, trichophyton, malassezia (m. Sympodialis), penicillium, vermicularia, malassezia, mucor etc.); animal skin (duck feathers, cat dander, dog dander, cow dander, horse dander, rabbit epithelium, hamster epithelium, guinea pig epithelium, sheep epithelium, pig epithelium, goat epithelium, chicken feathers, goose feathers, tiger skin parrot feces, mice, rats, etc.); insects (foot-pulling bees, moths, cockroaches, hornet, bees, aedes, mosquitoes (adults), etc.); parasites (nematodes, roundworms, etc.); acarina (cheese mites, tyrophagus putrescentiae, dust mites, house dust mites, etc.); food (egg, milk, wheat, buckwheat, peanut, shrimp, crab, almond, abalone, cuttlefish, salmon roe, orange, cashew, kiwi, beef, walnut, sesame, salmon, blue fish, soybean, chicken, banana, pork, matsutake, peach, yam, apple, gelatin, etc.); allergens of human insulin and the like.

The biomarker is a substance in a living body such as body fluid such as blood, saliva, sweat, urine, or feces, and the like, and the protein, nucleic acid, or the like is an index of a change in a disease state or a therapeutic effect, and is a substance used for diagnosis of a disease state, prognosis of a disease state, or the like. Examples of the biomarker include CK-MB, H-FABP, BNP, NT-proBNP, troponin (troponin), myoglobin, albumin, ceruloplasmin, calbindin, clusterin, cysteine protease inhibitor C, KIM-1, NGAL, osteopontin (Osteopontin), TFF3, TIMP-1, VEGF-A, L-FABP, chorionic hormone, interleukin, amylase 、NMP22、CEA、PSA、CYFRA21-1、SLX、CA125、SCC、NSE、ProGRP、CA19-9、CA19-9、AFP、PIVKA-II、AFP-L3、Span-1、DUPAN-2、CA50、BTA、CA15-3, and the like.

The virus is not limited to the type of nucleic acid (RNA, DNA) and the presence or absence of an envelope, and may be any type of virus. For example, as the nucleic acid, there may be mentioned: influenza virus with RNA; coronavirus; SARS coronavirus; SARS coronavirus-2; RS virus; mumps virus; lassa virus; dengue virus; rubella virus; human immunodeficiency virus, norovirus; poliovirus; an echovirus; hepatitis A virus; hepatitis E virus; rhinovirus; astrovirus; rotavirus; coxsackievirus; enteroviruses; arenavirus, human herpesvirus with DNA as nucleic acid; vaccinia virus; hepatitis B virus, adenovirus; b19 virus; milk polyposis virus; human papilloma virus, and the like. Examples of the bacteria include pertussis bacteria, diphtheria bacteria, escherichia coli, influenza bacteria, helicobacter bacteria, M.melilitis bacteria, pseudomonas aeruginosa, pneumococcus bacteria, group A streptococcus, group B streptococcus, staphylococcus aureus, bacillus tetani, legionella bacteria, mycoplasma tuberculosis, vibrio enteritis bacteria, salmonella bacteria, pathogenic Escherichia coli, campylobacter bacteria, bacillus subtilis, dysentery bacteria, bacillus cereus, botulinum bacteria, and mutant streptococcus bacteria. Examples of fungi include Aspergillus fungi (e.g., aspergillus fumigatus (Aspergillus fumigatus), aspergillus flavus (Aspergillus flavus), aspergillus terreus (Aspergillus terreus), aspergillus nidulans (Aspergillus nidulans), aspergillus niger (Aspergillus niger), aspergillus flitidus (Aspergillus ustus), etc.), blastomyces fungi (e.g., bacillus dermatitis (Blastomyces dermatitidis), etc.), candida fungi (e.g., candida albicans (Coccidioides immitis), etc.), coccocus fungi (e.g., cryptococcus neoformans (Cryptococcus neoformans), cryptococcus garteus (Cryptococcus gattii), etc.), histoplasma fungi (e.g., histoplasma capsulatum (Histoplasma capsulatum), etc.), paracosporium fungi (e.g., paracosporium brazil (Paracoccidioides brasiliensis), etc.), sporotrichum fungi (e.g., sporotrichum (Sporothrix schenckii), etc.), etc. Examples of protozoa include plasmodium, leishmania, cryptosporidium, trypanosoma gambir, trypanosoma rotundii, trypanosoma cruzi, trichomonas, toxoplasma, babesia, amoeba dysenteriae, giardia, and the like.

The present invention relates to providing a novel lateral chromatography assay that can be implemented at very low cost compared to existing methods.

In order to solve the above-described problems, the present inventors have studied various substances as a carrier for an antibody for immobilization of detection for lateral chromatography detection, that is, a marker for an antibody for detection, and as a result, have found that iron (III) oxide (Fe ₂O₃) particles, which are inexpensive to obtain and have a natural color of a red system similar to gold nanoparticles, are chemically stable and insoluble oxides, or are safe compounds usable as pigments, are suitable as markers. In addition, it was found that both the case of immobilizing immunoglobulin G (IgG) on iron (III) oxide particles and the case of immobilizing heavy chain variable region antibodies derived from heavy chain antibodies expected to be produced at low cost by microbial culture on iron (III) oxide particles, it was possible to construct a lateral chromatography test for visually confirming the color development generated by iron (III) oxide particles. Even more surprising, it was also found that in the lateral chromatography detection using iron (III) oxide particles, the discrimination was significantly superior compared to the case where iron (II, III) oxide particles were used.

According to the present invention, it is possible to perform a lateral chromatography detection having detection sensitivity equivalent to that of a lateral chromatography detection using conventional gold nanoparticles as a label and at a very low cost. Therefore, cost reduction of the lateral flow assay device can be expected, and application of the lateral flow assay device is expected to be promoted in a wide range of fields not limited to the medical diagnosis field and the non-medical field.

Examples of the sample to be subjected to the lateral chromatography detection of the present invention include a sample containing an antigen or possibly an antigen. Examples of such a sample include biological samples such as tracheal swabs, nasal swab solutions, oral swab solutions, throat swab solutions, nasal wash solutions, nasal aspirates, nasal discharge, saliva, sputum, tears, blood, serum, urine, feces, tissues, cells, broken products of tissues or cells, food materials, processed foods, environmental samples, and samples collected from hard or soft surfaces. The sample may be directly supplied to the detection, or the sample may be pulverized, antigen extracted, and the antigen-containing solution recovered, if necessary, and the target antigen may be appropriately concentrated, or diluted with water or a buffer solution. Preferably, the sample is a liquid sample.

The method of the present invention is a lateral chromatography assay that uses an antibody immobilized on a label, which is an iron (III) oxide particle, to detect an antigen in a sample.

Iron (III) oxide is a reddish brown solid of the formula Fe ₂O₃ (CAS registry number: 1309-37-1). Iron (III) oxide is a compound which is insoluble in water and chemically stable, and has high safety as a practical result of use of the pigment. In addition, it can be obtained in a large amount at low cost.

The shape of the iron (III) oxide particles is not particularly limited, and may be spherical, needle-like, or spindle-like, for example.

The average particle diameter of the iron (III) oxide particles is not particularly limited, but is preferably 10nm or more, more preferably 50nm or more, preferably 1000nm or less, more preferably 500nm or less. The average particle diameter of the iron (III) oxide particles is preferably in the range of 10 to 1000nm, more preferably 50 to 500nm. The average particle diameter of the iron (III) oxide particles can be measured by a laser diffraction/scattering method.

As Iron (III) oxide particles, for example, iron (III) oxide (particle size: 300nm, high purity chemical institute of Co., ltd.) and Iron (III) oxide (particle size: less than 5 μm, sigma-Aldrich) are commercially available, and these can be used.

The antibody immobilized on the iron (III) oxide particles may be any antibody that specifically binds to the target antigen, and may be either a polyclonal antibody or a monoclonal antibody. In addition, it may be a fragment of an antibody, for example, F (ab ') ₂, F (ab'), single chain Fv (scFv), disulfide Fv (dsFv) in which an amino acid residue substituted for a cysteine residue in VH and VL is bonded by disulfide bond or a polymer thereof, or a dimerized V region (Diabody) in which scFv is dimerized. Further, a peptide containing a part of an antibody, that is, a peptide having a part of an amino acid sequence constituting an antibody is also included in a fragment of an antibody as long as it specifically binds to an antigen of interest. The immunoglobulin class of the antibody is not particularly limited, and may be any of IgG, igM, igA, igE, igD, igY immunoglobulin classes, preferably IgG. The antibody may be any of a non-human animal antibody, a human chimeric antibody, a humanized antibody, and a human antibody. Examples of the antibody of the non-human animal include antibodies of mice, rats, hamsters, guinea pigs, rabbits, goats, camels, dromedaries, alpacas, and the like.

As the antibody immobilized on the iron (III) oxide particles, commercially available polyclonal antibodies or monoclonal antibodies can be used. Alternatively, a polyclonal antibody or a monoclonal antibody produced by a known method may be used. Examples of the monoclonal antibody derived from a mammal include antibodies produced by hybridomas, and antibodies produced by designing antibody genes or antibody fragment genes and using known genetic engineering methods.

For example, an antibody can be produced by inserting a DNA encoding an H chain variable region and a DNA encoding an L chain variable region downstream of a promoter of an appropriate vector, respectively, producing a recombinant vector, introducing the recombinant vector into a host cell, producing an H chain variable region and an L chain variable region from the obtained transformant, and joining them by using a peptide capable of joining them, or joining a DNA encoding an H chain variable region and a DNA encoding an L chain variable region by using a DNA encoding a known linker and inserting the joined DNA and DNA encoding an L chain variable region downstream of a promoter of an appropriate vector, producing a recombinant vector, expressing the recombinant vector in a host cell, and the like, thereby producing a single-chain recombinant antibody protein (scFv) having an antigen-binding ability (see MACCFFERTY, J.et al., nature,348,552-554,1990;Tim Clackson et al,Nature,352,642-628,1991, and the like). In addition, an antibody in which a DNA encoding a variable region and a DNA encoding a constant region are combined and expressed can be produced. In this case, the constant region may be the same as the antibody derived from the variable region, or may be derived from a different antibody.

Basically, the antibody-producing hybridoma can be produced by the following procedure using known techniques. For example, the antigen peptide may be combined with an appropriate carrier protein, for example, keyhole Limpet Hemocyanin (KLH) or bovine serum albumin, if necessary, to further enhance immunogenicity, and the resulting mixture may be immunized against a non-human mammal. The antigenic peptide used as the sensitizing antigen (immunogen) can be produced by genetic engineering methods or chemical synthesis.

The mammal immunized with the sensitizing antigen is not particularly limited, and is preferably selected in consideration of suitability of myeloma cells of the mammal to be used as a parent cell for cell fusion, and generally rodents, for example, mice, rats, hamsters, and the like are used.

Immunization of animals against a sensitizing antigen can be performed according to a known method. For example, by injecting the sensitizing antigen into the abdominal cavity or subcutaneously in a mammal. Specifically, the sensitized antigen is diluted to an appropriate amount with PBS (Phosphate-Buffered Saline) or physiological Saline, and suspended, and the obtained liquid is mixed with a proper amount of a normal adjuvant, for example, a complete friedel adjuvant, as needed, and emulsified, and then administered to the subcutaneous, intradermal, intraperitoneal, etc. of an animal, and after brief stimulation, the same operation is repeated as needed. The amount of the antigen to be administered is appropriately determined depending on the route of administration and the type of animal, and is preferably about 10 μg to 1mg per administration. After the immunization was performed in this manner and it was confirmed that the desired antibody level in the serum was increased, the mammal was collected blood, and the serum component was purified, whereby polyclonal antibodies could be obtained. In the purification of the serum component, an affinity column or the like for immobilizing the sensitizing antigen can be used.

In the production of monoclonal antibodies, immune cells are taken out of the mammal after the antibody level has been raised, and cell fusion is performed. Examples of preferred immune cells for cell fusion include spleen cells.

As myeloma cells of a mammal as another parent cell fused with the above-mentioned immune cell, various known cell lines such as P3X63, NS-1, MPC-11, SP2/0 and the like have been suitably used.

The cell fusion of the immune cells and myeloma cells can be carried out by a known method, for example, a method of Kohler et al (Kohler et al, nature, vol,256, p495-497 (1975)), or the like. Specifically, fusion cells (hybridomas) are formed by adding adjuvants such as dimethyl sulfoxide to a nutrient medium such as RPMI1640 medium or MEM medium, if necessary, in the presence of a cell fusion promoter such as polyethylene glycol (PEG having an average molecular weight of 1000 to 6000, 30 to 60% concentration) or sendai virus (HVJ), and mixing immune cells and myeloma cells in the nutrient medium.

Hybridomas formed by fusion are cultured in a selective medium such as a medium (HAT medium) containing hypoxanthine, thymidine, and aminopterin for 1 to 7 days, and separated from unfused cells. The resulting hybridomas are further selected using the antibodies produced thereby. The selected hybridoma was monocloned according to a known limiting dilution method, and established as a monoclonal antibody-producing hybridoma.

As a method for detecting the activity of an antibody produced by a hybridoma, a known method can be used. For example, ELISA, coacervation reaction, and radioimmunoassay may be mentioned.

In order to obtain a monoclonal antibody from the resulting hybridoma, it is possible to employ: a method comprising culturing the hybridoma according to a usual method and obtaining the hybridoma as a culture supernatant; or a method in which the hybridoma is administered to a mammal suitable for the hybridoma and the hybridoma is proliferated to obtain the hybridoma as ascites.

The purification of the antibody can be performed by a known purification method such as salting out, gel filtration, ion exchange chromatography or affinity chromatography.

Alternatively, the antibody immobilized on the iron (III) oxide particle may be a heavy chain variable region antibody. As the heavy chain variable region antibody, VHH antibodies and IgNAR antibodies can be cited. VHH antibodies are low molecular antibodies produced by camelids that do not have a light chain but are composed of a single domain (singledomain) comprising the variable region of a heavy chain antibody. The VHH antibody has 3 antigen binding loops (antigen complementarity determining regions; CDRs) similarly to the H chain of the IgG antibody and the like. Since VHH antibodies have a molecular weight as small as one tenth that of IgG antibodies, they can bind to epitopes even when they cannot bind to epitopes due to steric problems in normal IgG, and can bind to surfaces of virus particles modified with a plurality of sugar chains, and thus can be used as target molecules with a large range. Further, VHH antibodies are also excellent in acid resistance and heat resistance, and unlike IgG, they can be produced in e.coli, yeast, and the like without being produced in cultured cells. Therefore, the method has the advantage of easy mass production and purification. Further, VHH antibodies are composed of 1-chain peptides, and thus are easy to change functions by protein engineering techniques, chemical modification techniques, and the like. From these points of view, the antibody immobilized to the iron (III) oxide particle is preferably a heavy chain variable region antibody, more preferably a VHH antibody.

The method for producing the heavy chain variable region antibody is not particularly limited, and can be easily produced by techniques known in the art. For example, a method of producing a recombinant antibody by combining a peptide solid-phase synthesis method with a Natural Chemical Ligation (NCL) method or by genetic engineering, preferably by incorporating a nucleic acid encoding an antibody into an appropriate vector (e.g., a plasmid) and introducing the vector into a host cell, is known.

Herein, as the plasmid for antibody expression, plasmids suitable for various host cells can be used. For example, it is possible to use: pBR322, pBR325, pUC12, pUC13, pUC19, other plasmids from E.coli; pUB110, pTP5, pC194, pHY300pLK, other vectors from Bacillus subtilis; pSH19, pSH15, other vectors derived from yeast; lambda phage, other phages; adenovirus, adeno-associated virus, lentivirus, vaccinia virus, baculovirus, other viral vectors, and vectors in which they are suitably modified.

These expression plasmids have an origin of replication, a selectable marker and a promoter suitable for each plasmid, and may have an enhancer, a transcription termination sequence (terminator), a ribosome binding site, a polyadenylation signal and the like as required. In addition, in order to facilitate purification of the expressed polypeptide, a nucleotide sequence for fusing and expressing a FLAG tag, his tag, HA tag, GST tag, or the like may be inserted into the expression plasmid.

The antibody-producing strain can be produced by introducing the above-mentioned expression plasmid into a desired strain by a desired method, for example, electroporation or protoplast-PEG method. Examples of host cells used for producing the recombinant antibody include E.coli, bacillus subtilis, corynebacterium, various fungi, animal cells, plant cells, other cells, baculovirus/insect cells, and yeast cells. Among these, coryneform bacteria and bacillus subtilis can be preferably used, and bacillus subtilis having high productivity is more preferable.

When the expressed antibody is extracted from the cultured cells or cultured cells, after the culture, the cells or cultured cells are collected by a known method and suspended in a suitable buffer, and after the cells or cells are disrupted by ultrasonic waves, lysozyme, cold junction thawing or the like, the cells or cells are centrifuged or filtered to obtain a soluble extract. In the case of secretory expression, the expressed antibody may be obtained from the supernatant of the culture medium. The target peptide can be obtained from the obtained extract by a suitable combination of known separation and purification methods.

As a known separation and purification method, there can be used: methods utilizing solubility such as salting out and solvent precipitation; methods using mainly molecular weight differences such as dialysis, ultrafiltration, gel filtration, SDS-PAGE, etc.; a method using a charge difference such as ion exchange chromatography; methods utilizing specific affinity such as affinity chromatography; a method using a difference in hydrophobicity such as reversed-phase high performance liquid chromatography; or a method using the difference in isoelectric point such as isoelectric point electrophoresis.

In one example, when the target antigen is lysozyme contained in an egg, specific examples of the VHH antibody include a VHH antibody comprising the amino acid sequence shown in sequence No. 13 (hereinafter referred to as "1ZVY" in the examples described below), a VHH antibody comprising the amino acid sequence shown in sequence No. 15 (hereinafter referred to as "1ZVH" in the examples described below), and the like. In another example, when the target antigen is SARS-CoV-2S1 protein, which is an antigen derived from SARS-CoV-2, specific examples of the VHH antibody include a VHH antibody (hereinafter referred to as "E9" in the examples) composed of the amino acid sequence shown in SEQ ID NO. 17. In another example, when the antigen of interest is immunoglobulin G (IgG), specific examples of the VHH antibody include a VHH antibody composed of the amino acid sequence shown in SEQ ID NO. 19 (referred to as "VHH28-His" in the examples described below).

Immobilization of the antibody to the iron (III) oxide particles may be achieved by physical adsorption, chemical bonding via covalent bond of functional group or the like, or adsorption using a raw material to adsorb peptide or the like, and from the viewpoint of operability, physical adsorption or adsorption using a raw material to adsorb peptide or the like is preferable. The physical adsorption, adsorption of peptides using a raw material, and the like can be usually performed in a predetermined buffer. Examples of the type of buffer include commonly used buffers such as phosphate buffer, tris buffer, and Goldbuffer. The pH of the buffer is preferably 6.0 to 9.5, more preferably 6.5 to 8.5, and even more preferably 7.0 to 8.0. The concentration of the antibody is preferably 0.01 to 100. Mu.g/mL, more preferably 0.1 to 20. Mu.g/mL, and still more preferably 1 to 10. Mu.g/mL.

In the case of immobilization of an antibody, the iron (III) oxide particles may be used as they are, or may be modified in advance by chemical modification of protein immobilization, for example, modification with PEG, NHS, carboxyl, amine, streptavidin, or the like, in order to reduce nonspecific immobilization of proteins other than the object of immobilization before antibody immobilization.

After the immobilization of the antibody, the iron (III) oxide particles may be further capped with a capping agent that is generally used. The capping may be performed using a polymer compound such as a protein, e.g., BSA, casein, gelatin, polyvinyl alcohol (PVA), polyvinylpyrrolidone (PVP), or PEG.

The antibody immobilized on the iron (III) oxide particles in this manner, that is, the iron (III) oxide particle-labeled antibody, may be dispersed and stored in a storage reagent for preventing denaturation. As the denaturation inhibitor, proteins such as BSA, glycerol, sugar, etc. can be used.

In the lateral chromatography detection of the present invention, an antibody is labeled with iron (III) oxide particles, and an antigen in a sample is detected. Specifically, the detection includes a step of bringing an iron (III) oxide particle-labeled antibody into contact with a sample. In one embodiment, the lateral chromatography detection of the present invention may be performed using a reagent containing an iron (III) oxide particle-labeled antibody, preferably a reagent containing an iron (III) oxide particle-labeled antibody and a membrane to which a capture antibody is immobilized.

The capture antibody may be any antibody that specifically binds to the target antigen, and examples thereof include the same antibodies as those immobilized on the iron (III) oxide particles. In view of detection sensitivity, as the capture antibody, in order to be able to detect an antigen by a so-called sandwich assay, an antibody recognizing an epitope different from an antibody immobilized on the iron (III) oxide particle is preferably used.

As the film, any film of any material can be used. For example, a film formed by forming a film of a polysaccharide such as polyethylene, polyethylene terephthalate, polypropylene, nylon, glass, cellulose, or cellulose derivative, or a ceramic, can be used. By properly selecting the pore size and structure of the membrane, the rate at which complexes formed by the iron (III) oxide particle-labeled antibodies and antigens spread on the membrane can be controlled. As the membrane, a nitrocellulose membrane is preferably used, and the pore diameter thereof is preferably 1 to 20. Mu.m, more preferably 5 to 10. Mu.m, from the viewpoint of the development speed.

A capture antibody is immobilized on the membrane. The capture antibodies are preferably immobilized in such a way that detection lines are formed on the membrane. Immobilization of the capture antibody on the membrane may be achieved by physical adsorption, chemical bonding via covalent bond of functional group or the like, or adsorption using a raw material to adsorb peptide or the like, and physical adsorption or adsorption using a raw material to adsorb peptide or the like is preferable from the viewpoint of operability. Immobilization of the capture antibody on the membrane can be carried out by a known method. For example, the capture antibody may be applied in a linear form to the film by using a device having a mechanism capable of ejecting the liquid from a nozzle at a constant speed and moving in the horizontal direction. In this case, the concentration of the capture antibody is preferably 0.01 to 100mg/mL, more preferably 0.1 to 10mg/mL. The amount of the capture antibody immobilized on the membrane is preferably 0.5 to 2. Mu.L/cm. The location of the immobilized capture antibody on the membrane may be suitably selected to suit the design of the detection system.

The capture antibody solution can be usually prepared using a predetermined buffer solution. Examples of the type of the buffer include commonly used buffers such as phosphate buffer, tris buffer, and Gooder buffer. The pH of the buffer is preferably in the range of 6.0 to 9.5, more preferably 6.5 to 8.5, and even more preferably 7.0 to 8.0.

After immobilization of the capture antibody, the membrane may also be further capped with commonly used capping agents. As the end-capping, proteins such as BSA, casein and gelatin, and polymers such as PVA, PVP, PEG can be used.

By drying the membrane coated with the capture antibody, a membrane having an appropriate amount of the capture antibody immobilized thereon can be obtained.

A control capture antibody may also be immobilized on the membrane. The control capture antibody is preferably immobilized in such a way that a control line is formed on the membrane. The control capture antibody may be any antibody capable of binding to the iron (III) oxide particle-labeled antibody, and may be appropriately selected depending on the type, source, and the like of the iron (III) oxide particle-labeled antibody. The control line is used to ensure the reliability of the detection. The immobilization method of the control capture antibody on the membrane is the same as in the case of the capture antibody described above. The location of the immobilized control capture antibody on the membrane may be suitably selected to suit the design of the detection system, preferably further downstream than the detection line.

An example of specific detection is shown below. The method comprises the steps of bringing an iron (III) oxide particle-labeled antibody into contact with a sample to prepare a sample solution, and dropping the sample solution onto a membrane to which a capture antibody is immobilized, or immersing the membrane to which the capture antibody is immobilized in the sample solution, wherein the sample solution spreads on the membrane by capillary phenomenon. When the target antigen is contained in the sample, the iron (III) oxide particles label the antibody and the target antigen in the sample to form a complex, which is captured by the capture antibody on the membrane, and the complex is aggregated, whereby a red color development from the iron (III) oxide particles is generated on the detection line. On the other hand, when the target antigen is not contained in the sample, no color development occurs on the detection line. By using such color development as an index, the presence or absence of the target antigen in the sample can be measured. That is, if the color development is observed on the detection line, it can be determined that the target antigen is contained in the sample, and if the color development is not observed on the detection line, it can be determined that the target antigen is not contained in the sample. In addition, in the case where the membrane has a control line, the control capture antibody captures the remaining iron (III) oxide particle-labeled antibody, and the iron (III) oxide particle-labeled antibody aggregates, irrespective of the presence or absence of the target antigen in the sample, thereby generating a red color development from the iron (III) oxide particles on the control line. By using such color development as an index, the rationality of detection can be evaluated. That is, if the color development is seen on the control line, it can be determined that the detection is performed normally, and if the color development is not seen on the control line, it can be determined that the detection is not performed normally.

In another embodiment, the lateral chromatography detection of the present invention can be performed using a general lateral chromatography detection reagent (test strip) composed of a sample pad, a binding pad, a membrane, and an absorbent pad. The general structure of the test strip is shown in fig. 1. In the present invention, the binding pad holds an antibody labeled with iron (III) oxide particles, and the capture antibody is immobilized on the membrane.

The sample pad is a portion to which a sample is dropped, and absorbs the sample in a state of being formed into a pad, and includes any substance and form through which the sample can pass. Examples of materials suitable for the sample pad include, but are not limited to, glass fiber (glass fiber), acrylic fiber, hydrophilic polyethylene material, dry paper, pulp, and fabric. The sample pad may also have the function of a bonding pad described later.

The conjugate pad is a portion that retains the iron (III) oxide particle-labeled antibody and has a function of forming a complex between the iron (III) oxide particle-labeled antibody and the target antigen in the sample when the sample passes through the conjugate pad.

Examples of materials suitable for the bonding pad include, but are not limited to, nonwoven fibers such as paper, cellulose mixtures, nitrocellulose, polyester, acrylonitrile copolymers, glass fibers, and rayon.

As the film, the same film as described above can be used. The membrane preferably comprises a detection line to which a capture antibody is immobilized, and a control line to which a control capture antibody is immobilized. The method of immobilizing the capture antibody, the control capture antibody, or both on the membrane is as described above.

The absorbent pad is located at the most downstream side, and is a liquid-absorbent portion that absorbs a sample developed on the film to control the development of the sample. Examples of the material suitable for the absorbent pad include, but are not limited to, filter paper.

The reagent is obtained by disposing and mounting a sample pad, a binding pad, and an absorption pad on a membrane. The arrangement may be changed as appropriate, and it is preferable to arrange the respective portions such that the sample dropped onto the sample pad passes through the sample pad by capillary phenomenon, is transferred to the bonding pad, passes through the bonding pad by capillary phenomenon, is transferred to the film, spreads on the film, and is absorbed by the absorption pad. These are usually arranged on a solid support such as a plastic adhesive sheet. The solid support is preferably composed of a substance that does not interfere with the development of the sample, and the binder is preferably composed of a substance that does not interfere with the development of the sample. In addition, in order to improve the mechanical strength of the film and prevent evaporation (drying) of moisture during detection, a polyester film or the like may be laminated. The reagent can be stored and mounted in a suitable container (housing) in consideration of the size of the reagent, the method and position of adding the sample, the immobilization position of the capture antibody, and the like. The state of being stored and mounted in this manner is referred to as a "device".

An example of specific detection is shown below. When a sample liquid is dropped onto the sample pad, the sample liquid sequentially passes through the sample pad and the bonding pad by capillary phenomenon, and spreads on the membrane. When the target antigen is contained in the sample, the iron (III) oxide particles held by the conjugate pad form a complex with the target antigen in the sample, which is captured by the capture antibody on the membrane, and the complex aggregates, thereby generating a red color development from the iron (III) oxide particles on the detection line. On the other hand, when the target antigen is not contained in the sample, no color development occurs on the detection line. By using such color development as an index, the presence or absence of the target antigen in the sample can be measured. That is, if the color development is observed on the detection line, it can be determined that the target antigen is contained in the sample, and if the color development is not observed on the detection line, it can be determined that the target antigen is not contained in the sample. In addition, in the case where the membrane has a control line, the control capture antibody captures the remaining iron (III) oxide particle-labeled antibody, and the iron (III) oxide particle-labeled antibody aggregates, irrespective of the presence or absence of the target antigen in the sample, thereby generating a red color development from the iron (III) oxide particles on the control line. By using such color development as an index, the rationality of detection can be evaluated. That is, if the color development is seen on the control line, it can be determined that the detection is performed normally, and if the color development is not seen on the control line, it can be determined that the detection is not performed normally.

As shown in examples described later, in the lateral flow chromatography detection, when iron (III) oxide particles are used as a label for immobilizing an antibody that specifically binds to an antigen, the discrimination is remarkably superior to the case of using iron (II, III) oxide particles (non-patent document 2 described above). In such detection, since the magnetic properties of the iron (III) oxide particles are not used as an index, but the color development is used as an index, an antigen in a sample can be detected by a simple method such as visual inspection without requiring a dedicated detection device. In addition, when the iron (III) oxide particles are used as the labeling substance, detection sensitivity equivalent to that of gold colloid particles commonly used as the labeling substance can be obtained. The iron (III) oxide particles can be easily and inexpensively obtained, and therefore, the cost of the label per detection is one percent or less compared to gold colloid particles, enabling a significant reduction in the cost of lateral chromatography detection. In addition, when VHH antibodies which can be produced in large quantities at low cost compared with normal IgG antibodies are used as antibodies immobilized on iron (III) oxide particles, mass productivity can be improved and costs can be further reduced.

With respect to the above-described embodiments, the present invention further relates to the following modes.

< 1 > A lateral flow assay wherein the lateral flow assay uses an antibody immobilized to a label, the label being an iron (III) oxide particle, to detect an antigen in a sample.

< 2 > The lateral flow assay of < 1 > comprising the step of contacting the antibody immobilized on the iron (III) oxide particles with the sample.

< 3 > The lateral chromatography assay of < 1 > or < 2 > comprising the step of capturing a complex formed by an antibody immobilized on iron (III) oxide particles and an antigen in a sample with a capture antibody.

< 4 > The lateral flow assay as described in < 3 > wherein the capture antibody is immobilized on a membrane.

The lateral chromatography assay of any one of < 5 > to < 1 > to < 4 > comprising the step of detecting an antigen using a color development produced by the iron (III) oxide particles as an indicator.

< 6 > The lateral flow chromatography assay according to < 5 >, wherein the color development is generated by aggregation of a complex formed by the antibody immobilized to the iron (III) oxide particle and the antigen in the sample, preferably by capture of a complex formed by the antibody immobilized to the iron (III) oxide particle and the antigen in the sample by capture antibody.

The lateral flow assay of < 7 > as defined in < 5 > or < 6 > comprising the step of determining that the sample contains an antigen in the event of a color development being seen and determining that the sample does not contain an antigen in the event of no color development being seen.

The lateral chromatography assay of any one of < 8 > to < 1 > to < 7 >, wherein the iron (III) oxide particles have an average particle diameter of 10 to 1000nm, preferably 50 to 500nm.

The lateral chromatography assay of any one of < 9 > to < 1 > to < 8 >, wherein the iron (III) oxide particles are iron (III) oxide particles that have not been chemically modified for protein immobilization prior to antibody immobilization.

The lateral chromatography assay of any one of < 10 > to < 1> - < 9 >, wherein the antibody immobilized on the iron (III) oxide particle is preferably an IgG antibody or a heavy chain variable region antibody, more preferably a heavy chain variable region antibody, further preferably a VHH antibody composed of an amino acid sequence shown in any one of SEQ ID NOS 13, 15, 17 and 19.

The lateral chromatography assay of any one of < 11 > to < 3 > - < 10 >, wherein the capture antibody is preferably an IgG antibody or a heavy chain variable region antibody, more preferably a heavy chain variable region antibody, further preferably a VHH antibody consisting of an amino acid sequence shown in any one of SEQ ID NOS 13, 15, 17 and 19.

< 12 > A reagent for lateral chromatography detection, which comprises an antibody immobilized on iron (III) oxide particles.

The reagent of < 13 > as set forth in < 12 >, wherein the reagent further comprises a membrane having a capture antibody immobilized thereon.

The reagent of < 14 > as set forth in < 12 > or < 13 >, wherein the reagent comprises a sample pad, a binding pad for holding an antibody immobilized to iron (III) oxide particles, a membrane immobilized with a capture antibody, and an absorbent pad.

The reagent according to any one of < 15 > to < 12 > to < 14 >, wherein the iron (III) oxide particles have an average particle diameter of 10 to 1000nm, preferably 50 to 500nm.

The reagent according to any one of < 16 > to < 12 > to < 15 >, wherein the iron (III) oxide particles are iron (III) oxide particles which have not been chemically modified for protein immobilization prior to antibody immobilization.

The reagent according to any one of < 17 > to < 12 > - < 16 >, wherein the antibody immobilized on the iron (III) oxide particle is preferably an IgG antibody or a heavy chain variable region antibody, more preferably a heavy chain variable region antibody, further preferably a VHH antibody composed of an amino acid sequence represented by any one of SEQ ID Nos. 13, 15, 17 and 19.

The reagent according to any one of < 18 > to < 13 > - < 17 >, wherein the capture antibody is preferably an IgG antibody or a heavy chain variable region antibody, more preferably a heavy chain variable region antibody, further preferably a VHH antibody comprising the amino acid sequence shown in any one of SEQ ID NOS 13, 15, 17 and 19.

Examples

The present invention will be described in more detail with reference to examples, but the present invention is not limited thereto.

EXAMPLE 1 production of VHH by protease-deficient recombinant Bacillus subtilis 1

(1) Use of strains

A derivative of Bacillus subtilis.sup.168 was used as the Bacillus subtilis strain. The defects of the extracellular protease gene (epr, wprA, mpr, nprB, bpr, nprE, vpr, aprE, aprX) were carried out according to the method described in Japanese patent No. 4485341 (the defective strains were designated as Δepr, Δwpra, Δmpr, ΔnprB, Δbpr, ΔnprE, Δvpr, ΔaprE, and ΔaprX, respectively, and the total defective strains were designated as 168Dpr 9). Further, the defect of the sigF gene involved in the formation of a cell was performed according to the method described in Japanese patent No. 4336082 (the defect strain is referred to as ΔsigF). In addition, as the E.coli strain for Gene construction, ECOS Competent E.coli DH 5. Alpha. Strain (Nippon Gene) was used.

(2) Using culture medium

LB medium: 1% Bacto ^TM Tryptone (Difco), 0.5% Bacto ^TM Yeast Extract (Yeast Extract) (Difco), 1% sodium chloride. 1.5% agar was added to the plate medium. Tetracycline (50 ppm) was added as needed.

SMMP solution: antibiotic Medium No. 3 (Antibiotic Medium) (Difco) (35 g/L), sucrose (171.5 g/L), disodium maleate (3.2 g/L), mgCl ₂·6H₂ O (4.06 g/L)

PEG solution: sucrose (85.75 g/L), disodium maleate (1.6 g/L), mgCl ₂·6H₂ O (2.03 g/L), PEG8000 (400 g/L)

DM3 medium: CMC (kanto chemical), 0.5% baco ^TM casein amino acid (Casamino Acids) (Difco), 0.5% baco ^TM yeast extract (Difco), 8.1% disodium succinate 6H ₂ O, 0.35% dipotassium hydrogen phosphate, 0.15% potassium dihydrogen phosphate, 0.5% glucose, 20mM magnesium chloride, 0.01% BSA, 50ppm tetracycline. 1% agar was added to the plate medium.

2 XL-mal medium: 2% Bacto ^TM tryptone (Difco), 1% Bacto ^TM yeast extract (Difco), 1% sodium chloride, 7.5% maltose monohydrate, 7.5ppm manganese sulfate, 15ppm tetracycline

The reagent is not particularly described, and is manufactured by Fuji film and Wako pure chemical industries, ltd.

(3) Construction of Gene plasmid

The construction of the gene expression plasmid was performed according to the following procedure. Synthetic genes of SEQ ID Nos. 1 and 2 (Thermo Fisher Co.) were mixed and introduced into B.subilis 168Dpr 9. DELTA. SigF strain according to the protoplast transformation method described below. The pK plasmid was extracted using the B.subilis 168Dpr 9. DELTA. SigF strain obtained by transformation. A PspoVG-S237-Ts-pK plasmid was constructed by mixing a PCR fragment obtained by amplifying a plasmid pK using PRIMESTAR MAX DNA polymerase (TaKaRa) and a primer set of SEQ ID Nos. 3 and 4 (PRIMER SET), a PCR fragment obtained by amplifying a promoter SpoVG (PspoVG) obtained by amplifying a genomic DNA of B.subtilis 168 strain using a primer set of SEQ ID Nos. 5 and 6 as a template, and a PCR fragment obtained by amplifying a secretion signal (S237 pre) from the S237 gene and a transcription terminator (Ts 237) obtained by amplifying a recombinant plasmid pHY-S237 described In Japanese patent application publication No. 2014-158430 as a template using primer sets of SEQ ID Nos. 7 and 8 and SEQ ID Nos. 9 and 10, respectively, and by ligating them to E.coli using In-Fusion HD Cloning Kit (Takara). A PCR fragment amplified using the primer set of SEQ ID Nos. 9 and 11 and PRIMESTAR MAX and the PspoVG-S237pre-Ts237-pK plasmid as a template was mixed with SEQ ID NO. 12 (VHH antibody corresponding to lysozyme: gene encoding 1ZVY, SEQ ID NO. 13), SEQ ID NO. 14 (VHH antibody corresponding to lysozyme: gene encoding 1ZVH, SEQ ID NO. 15) and SEQ ID NO. 16 (VHH antibody corresponding to SARS-CoV-2S1 protein: gene encoding E9, SEQ ID NO. 17) and then transformed into E.coli by ligation using In-Fusion HD Cloning Kit, whereby expression plasmids of the respective genes were constructed. The constructed plasmid was introduced into B.subilis 168Dpr9ΔsigF strain according to the protoplast transformation method described below. The primers used are shown in Table 1.

TABLE 1

Primer name	Base sequence (5 '. Fwdarw.3')	Sequence number
			pK R	CAAAATTGATCCTTTTTTTATAACAG	3
pK F	GGCAAAGCGTTTTTCCATAG	4
			PspoVG-pK F	CTTTTTTTATAACAGTAAGAAAAGTGATTCTGGGAG	5
PspoVG-R	AGTAGTTCACCACCTTTTCCC	6
			PspoVG-S237pre F	AGGTGGTGAACTACTATGATGTTAAGAAAGAAAACAAAG	7
S237pre-Ts237 R	AACTAGTTTAATAGATGCTGCAAGAGCTGCCGGAA	8
			Ts237 F	TCTATTAAACTAGTTATAGGG	9
Ts237-pK R	GAAAAACGCTTTGCCTCCAGTTATGCAAGAAAAAG	10
			S237 pre R	TGCTGCAAGAGCTGCCGGAAA	11

(4) Protoplast transformation method

The introduction of the plasmid into Bacillus subtilis was performed according to the protoplast method shown below. Each of the Bacillus subtilis strains stored in glycerol was cultured in 1mL of LB liquid medium at 30℃and 210rpm with shaking for one night. The next day, 10. Mu.L of this culture broth was cultured in a fresh 1mL LB liquid medium with shaking at 37℃and 210rpm for about 2 hours. The culture broth was recovered in a 1.5mL tube, centrifuged at 12,000rpm for 5 minutes, and the pellet from which the supernatant was removed was suspended in 500. Mu.L of SMMP containing 4mg/mL Lysozyme (SIGMA) and incubated at 37℃for 1 hour. Next, centrifugation was performed at 3,500rpm for 10 minutes, and the pellet from which the supernatant was removed was suspended in 400. Mu.L of SMMP. mu.L of this suspension was mixed with each plasmid, and 100. Mu.L of 40% PEG was added thereto for vortexing. To this liquid, 350. Mu.L of SMMP was added and mixed in reverse, and after incubation in Ai Bende centrifuge tubes (eppendorf tube) at 30℃for 2 hours, the mixture was spread on DM3 agar medium. The DM3 agar culture substrate was cultured at 30℃for 2 to 3 days to obtain colonies of the transformant.

(5) Culture conditions

The bacillus subtilis strain with the plasmid was inoculated in 1mL of LB medium containing 50ppm tetracycline and reciprocally shaken at 30 ℃ for one night to prepare a preculture solution. 1% of the preculture solution was inoculated into 20mL of 2 XL-mal medium placed in a Erlenmeyer flask and cultured at 30℃for 72 hours with shaking. The culture broth at the end of the culture was centrifuged at 7,500rpm for 5 minutes, and the supernatant was recovered. Ni-NTA agarose beads (Fuji photo-active pharmaceutical ingredients) were added to the supernatant, and the His tag-linked functional domain antibody contained in the supernatant was purified according to the protocol of the kit, and then the buffer was replaced with PBS (containing 30mM imidazole) by dialysis.

Example 2 lateral flow assay 1

(1) Method of

Nitrocellulose membrane FF120HP (cytiva lifesciences) was used. The antibody for detection was applied at a position 20mm from the lower end of the membrane cut into 5mm X100 mm. For a solution of 1mg/mL of the functional region antibody (1 ZVH or1 ZVY) produced by Bacillus subtilis in example 1, a detection line was drawn using a brush for a solution of 0.1mg/mL of a commercially available IgG antibody (lysozyme polyclonal antibody (Lysozyme Polyclonal Antibody) (Cosmo Bio) and SARS/SARS-CoV-2 coronavirus spike protein (Coronavirus Spike Protein) (ubuit 1) polyclonal antibody (Polyclonal Antibody) (Thermo FISHER SCIENTIFIC) (hereinafter referred to as SARS polyclonal antibody)) and then left standing at 37℃for 1 hour to dry. The dried film was immersed in N101 (day oil) after 3-fold dilution for 15 minutes, washed with ion-exchanged water 2 times, immersed in a 3% sucrose solution, and left to stand for 5 minutes. The film removed from the sucrose solution was dried at room temperature.

Iron (III) oxide particles (300 nm, high purity chemistry) were suspended in Milli-Q water at 30 mg/mL. 200. Mu.L of iron (II, III) oxide particles (10 nm, 5mg/mL toluene, and Wako pure chemical industries, ltd.) were suspended in 1mL ethanol, and centrifuged at 5,000rpm for 15 minutes, and the supernatant was removed. To the precipitate, 1ml of ethanol was added, and the mixture was centrifuged at 5,000rpm for 15 minutes, and the supernatant was removed. To the pellet was added 1mL of 20% ethanol, centrifuged at 5,000rpm for 15 minutes, the supernatant was removed, and 200. Mu.L of Milli-Q water was added to suspend it. To 6. Mu.g of iron (III) oxide particles or iron (II, III) oxide particles, or 100. Mu.L of gold particles (40 nm, 1OD (530 nm abs max), G-40-20, cosmo Bio) was added 500. Mu.L of 10mM Tris-HCl (pH 8), and 10 seconds of ultrasonic treatment (100. Mu.g of iron (III) oxide particles in E9) was performed (10 mM Tris-HCl (pH 8 to 9) when gold particles were used). A functional region antibody (1 ZVH or 1ZVY: 10. Mu.g, E9:1 mg) produced by Bacillus subtilis or a commercially available IgG antibody (lysozyme polyclonal antibody (Lysozyme Polyclonal Antibody): 1. Mu.g) was added thereto, and the mixture was allowed to stand for 15 minutes. 200. Mu.L of 10mM Tris-HCl (pH 8) containing 1% BSA and 0.1% PEG20000 was added thereto and allowed to stand for another 15 minutes. After centrifugation at 5,000rpm for 15 minutes, the supernatant was removed, 200. Mu.L of 10mM Tris-HCl (pH 8) containing 0.1% BSA and 0.5% Tween 20 was added, and 10 seconds of sonication was performed (no Tween 20 was used on the side of the iron (III) oxide particles with lysozyme polyclonal antibody or E9, and 0.1% BSA and 0.025% Tween 20 were used with gold particles).

For detection using 1ZVH, 1ZVY or lysozyme polyclonal antibody as an antibody, 10 μg of proteolytic enzyme (Fuji film and Wako pure chemical industries) as an antigen, and for detection using E9 or SARS polyclonal antibody as an antibody, 1 μg of SARS-CoV-2 spike glycoprotein (Spike Glycoprotein) (S1), sheep Fc-Tag (HEK 293) (NATIVE ANTIGEN) (hereinafter referred to as SARS-CoV-2S 1) as an antigen were added to a solution of iron (III) oxide particle-labeled antibody or iron (II, III) oxide particle-labeled antibody. In addition, for detection using 1ZVH, 1ZVY or lysozyme polyclonal antibody as an antibody, 10 μg of proteolytic enzyme as an antigen was added to a solution of gold particle-labeled antibody. The solution added with the antigen is allowed to act on the membrane, and lateral chromatography detection is performed.

(2) Results

To confirm the difference in detection discrimination between iron (II, III) oxide particles and iron (III) oxide particles, a lateral chromatography detection using 1ZVH on the detection line side and 1ZVY on the iron oxide particle side was performed. The results are shown in FIG. 2. The same amounts of particles and antibodies, antigens are used for both iron (II, III) oxide particles and iron (III) oxide particles, but iron (III) oxide particles present a more pronounced detection line than iron (II, III) oxide particles.

In order to confirm that the detection of various antigens by the lateral chromatography detection using the iron (III) oxide particles can be applied, studies were conducted to change the antibodies on the iron (III) oxide particle side and the detection line side. The results are shown in Table 2. From this result, it was revealed that any antigen can be detected by recognition of the detection line regardless of the combination of IgG or the functional region antibody on the iron (III) oxide particle side and the detection line side. In addition, in the lysozyme detection system (corresponding to paragraph 3 in table 2) using gold particles as a label and using 1ZVY, 1ZVH as the particle-side antibodies, it was also confirmed that the detection lines could be recognized. In addition, it was also shown that the amino acid sequence identity between the functional region antibodies used in this study was 68% in 1ZVY and 1ZVH, 63% in 1ZVY and E9, and 71% in 1ZVH and E9, and that lateral chromatography detection using iron (III) oxide particles could be utilized independent of the sequence of the functional region antibodies.

TABLE 2

Example 3 production of VHH by protease-deficient recombinant Bacillus subtilis 2

(1) Use of strains

The same strain as in example 1 (1) was used.

(2) Using culture medium

The same medium as in example 1 (2) was used.

(3) Construction of Gene plasmid

The construction of the gene expression plasmid was performed according to the following procedure. An expression plasmid of VHH28-His gene was constructed by mixing a PCR fragment amplified using KOD One DNA polymerase (TOYOBO) and a primer set of SEQ ID Nos. 20 and 21 with a synthetic gene (GenScript) having SEQ ID NO. 18 (VHH antibody corresponding to IgG containing His tag: gene encoding VHH28-His, translation amino acid sequence: SEQ ID NO. 19) as a template and a PCR fragment amplified using a primer set of SEQ ID Nos. 9 and 11 and PRIMESTAR MAX (Takara) with PspoVG-S237pre-Ts237-pK plasmid as a template, and ligating them with In-Fusion HD Cloning Kit (Takara).

Furthermore, an expression plasmid of VHH28-His-FLAG gene was constructed by mixing a PCR fragment amplified using the artificial synthetic gene of SEQ ID NO. 18 (GenScript) as a template and using the primer set of SEQ ID NO. 20 and 22 and a PCR fragment amplified using the primer set of SEQ ID NO. 23 and 11 and the KOD One DNA polymerase as a template and using the primer set of SEQ ID NO. 23 and 11, and then, by ligation using In-Fusion HD Cloning Kit, and then, by transformation into E.coli. The primers used are shown in Table 3.

The constructed plasmid was introduced into B.subtilis 168 Dpr9ΔsigF strain according to the protoplast transformation method of example 1 (4). The Bacillus subtilis strain retaining the obtained plasmid was cultured under the culture conditions of example 1 (5) to produce a functional region antibody.

TABLE 3

Example 4 lateral flow assay 2

(1) Method of

Nitrocellulose membrane FF120HP (cytiva lifesciences) was used. The antibody for detection was applied at a position 20mm from the lower end of the membrane cut into 5mm X100 mm. For a solution of 0.5mg/mL of the functional region antibody (VHH 28-His-FLAG) produced by Bacillus subtilis in example 3, a detection line was drawn using a brush for a solution of 0.1mg/mL of a commercially available IgG antibody (Anti-IgG (H+L), cat, rabbit-Poly (Bethyl Laboratories, A20-115A)), and then left standing at 37℃for 1 hour to dry. The dried film was immersed in N101 (day oil) diluted 5 times for 15 minutes, washed 2 times with ion-exchanged water, immersed in a 3% sucrose solution, and left to stand for 5 minutes. The film removed from the sucrose solution was dried at room temperature.

Iron (III) oxide particles (300 nm, high purity chemistry) were suspended in Milli-Q water at 30 mg/mL. 20. Mu.L of 30mg/mL iron (III) oxide particles was added to 500. Mu.L of 10mM Tris-HCl (pH 8), and subjected to ultrasonic treatment for 10 seconds. A functional region antibody (VHH 28-His: 3. Mu.g) produced by Bacillus subtilis was added and left standing for 15 minutes. 400. Mu.L of 10mM Tris-HCl (pH 8) containing 1% BSA and 0.1% PEG20000 was added thereto and allowed to stand for another 15 minutes. After centrifugation at 5,000rpm for 15 minutes, the supernatant was removed, 500. Mu.L of 10mM Tris-HCl (pH 8) containing 0.1% BSA and 0.025% to 0.05% Tween 20 was added, and 10 seconds of sonication was performed. For antigen, chromPure Cat IgG, whole molecular (Jackson ImmunoResearch Laboratories inc.) 1 μg was added to a solution of iron (III) oxide particle-labeled antibody. The solution added with the antigen is allowed to act on the membrane, and lateral chromatography detection is performed.

(2) Results

In order to confirm that the detection of Cat IgG by lateral chromatography detection using iron (III) oxide particles can be applied, studies were conducted to change antibodies on the detection line side. The results are shown in Table 4. From this result, it was revealed that Cat IgG can be detected by recognition of the detection line regardless of the combination of IgG or the functional region antibody on the detection line side.

TABLE 4

Claims (9)

1. A lateral chromatography assay, wherein,

The lateral chromatography detection uses an antibody immobilized on a label, which is an iron (III) oxide particle, to detect an antigen in a sample.

2. The lateral flow assay of claim 1, wherein,

Comprising the step of contacting the antibody immobilized on the iron (III) oxide particles with a sample.

3. The lateral flow assay of claim 1 or 2, wherein,

Comprises the step of detecting an antigen by using the color development produced by the iron (III) oxide particles as an index.

4. A lateral flow assay as claimed in any one of claims 1 to 3 wherein,

The average particle diameter of the iron (III) oxide particles is 10-1000 nm.

5. The lateral flow assay of any one of claims 1-4, wherein,

The antibody immobilized to the iron (III) oxide particles is a VHH antibody.

6. A reagent for lateral chromatography detection, wherein,

Comprising antibodies immobilized to iron (III) oxide particles.

7. The reagent according to claim 6, wherein,

Also included are membranes immobilized with capture antibodies.

8. The reagent according to claim 6 or 7, wherein,

Comprises a sample pad, a binding pad for holding an antibody immobilized to iron (III) oxide particles, a membrane immobilized with a capture antibody, and an absorbent pad.

9. The reagent according to claim 6 to 8,

The antibody immobilized to the iron (III) oxide particles is a VHH antibody.