CN118222704A

CN118222704A - Molecular probe for detecting CLDN18.2 non-coding region RNA and application thereof

Info

Publication number: CN118222704A
Application number: CN202211649863.2A
Authority: CN
Inventors: 范林洋
Original assignee: National Center for Nanosccience and Technology China
Current assignee: National Center for Nanosccience and Technology China
Priority date: 2022-12-21
Filing date: 2022-12-21
Publication date: 2024-06-21

Abstract

The invention provides a molecular probe for detecting CLDN18.2 non-coding region RNA and application thereof. Specifically, a molecular probe for detecting the CLDN18.2 non-coding region RNA and a detection method are provided. The molecular probe is an oligomeric single-stranded deoxyribonucleotide molecule with a stem-loop structure, wherein the 5 '-end is provided with 2-6 nucleotides, the 3' -end is provided with 3-6 nucleotides, and the 5 '-end and the 3' -end are matched with each other so as to be attracted with each other through hydrogen bonds, so that a stem-loop structure is formed. The molecular probe of the invention has better sensitivity, more convenient synthesis, more than one time of cost reduction, and great applicability, and is beneficial to large-scale production.

Description

Molecular probe for detecting CLDN18.2 non-coding region RNA and application thereof

Technical Field

The invention relates to the field of molecular biology, in particular to a molecular probe for detecting RNA of a CLDN18.2 non-coding region and application thereof.

Background

The incidence and mortality of gastric cancer in China are both high. In recent years, CLDN18.2 is approved by the FDA as a novel drug target for treating advanced CLDN18.2 high-expression gastric cancer. CLDN18.2 is a transmembrane protein belonging to Claudins (CLDNs) family and is an important component of cell tight junctions. The CLDN18.2 is found to be limited in expression in healthy tissues, and rapidly increases in expression in gastric cancer cells, so that the CLDN18.2 can be used as an effective therapeutic target of gastric cancer. Thus, detection of CLDN18.2 becomes critical.

The CLDN18 gene has 2 transcripts, CLDN18.1 and 18.2, respectively. Because of the high homology between CLDN18.1 and CLDN18.2 protein sequences, the present invention transfers test objects from CLDN18.2 protein to CLDN18.2 RNA, which poses great difficulty in the development of corresponding test antibodies. By analysis of the maximum difference sequences of CLDN18.1 and CLDN18.2, even in the coding region, there is a higher homology which is present not only in recognition of CLDN18.1 but also in the human transcriptome.

In view of the foregoing, there is a need in the art to develop a molecular probe for detecting CLDN18.2 non-coding region RNA with high specificity and high sensitivity.

Disclosure of Invention

The invention aims at providing a molecular probe for detecting the CLDN18.2 non-coding region RNA.

It is another object of the present invention to provide the use of molecular probes in the detection of peripheral circulation epithelial cells.

In a first aspect of the invention, there is provided a molecular probe for detecting CLDN18.2 non-coding region RNA, the probe having the structure of formula (I) in order from the 5 'end to the 3' end:

Z0-Z1-Z2-Z3-Z4(I)

Wherein "-" are each independently a bond;

z0 is a fluorescent group;

z1 is N1 nucleotides, N1 is a positive integer from 2 to 6;

Z2 is a hairpin loop sequence comprising the following core sequence: UCGACACAGAGCCACACGACAAGU (positions 4-27 of SEQ ID No: 1) or GUCGACACAGAGCCACACGACAAGUG (positions 3-28 of SEQ ID No: 1);

z3 is N2 nucleotides, N2 is a positive integer of 3-6, and I N1-N2I is less than or equal to 1;

Z4 is a quenching group;

wherein the nucleotide sequences in Z1 and Z3 are mutually attracted by hydrogen bonds through base complementation, and form a 'stem-loop' structure together with Z2.

In another preferred embodiment, the length of the molecular probe is 20 to 40nt, preferably 21 to 30nt.

In another preferred embodiment, all the hydroxyl groups on the carbon atom at position 2 on the probe are subjected to methylation modification and the phosphosite of the cyclic region is subjected to thiosulfate modification.

In another preferred embodiment, the molecular probe is an RNA probe, and the probe sequence is: 5'-GCGUCGACACAGAGCCACACGACAAGUGACGC-3', wherein the italic region spontaneously forms a "stem-loop" like structure due to the reverse complement pairing.

In another preferred embodiment, the molecular probe is a DNA probe, and the probe sequence is: 5'-CGTATGCCCGCAATCCCAATCAGTTACG-3'.

In another preferred embodiment, the probe is a DNA probe, the molecular probe comprises a nucleic acid sequence capable of hybridizing to bases 96-111 of the RNA encoded by the CLDN18.2 gene, and the molecular probe is not bound to double stranded DNA.

In another preferred embodiment, the molecular probe is directed to the sequence region: 5'-CGACACAGAGCCACACGACAAGTG-3', said identification region being located in front of the actual open reading frame.

In another preferred embodiment, the molecular probe is a DNA probe, and the probe sequence is: 5'-CCGCAATCCCAATCAG-3', wherein the 5 'and 3' ends each contain 3-6 complementary matable bases, forming a "neck" in the stem-loop structure.

In another preferred embodiment, one end of the molecular probe is provided with a fluorescent group, the other end is provided with a quenching group, and the fluorescent group and the quenching group are matched with each other.

In another preferred embodiment, the fluorophore is selected from the group consisting of: FAM, HEX, VIC, texas Red, AF488, AF555, AF647, CY3, CY5, cy7 and ROX.

In another preferred embodiment, the quenching group is selected from the group consisting of: DABYSL, BHQ1, BHQ2, BHQ3, ECLIPSE and TAMR.

In a second aspect of the invention, there is provided a detection system for detecting CLDN18.2 non-coding region RNA, the detection system comprising:

(a) The molecular probe according to the first aspect of the present invention;

(b) A target nucleic acid molecule to be detected;

When the fluorescent group emits light through the appointed excitation light, the physical distance between the fluorescent group and the quenching group corresponding to the fluorescent group is very short, and the emitted light emitted by the fluorescent gene is absorbed by the quenching group; when the molecular probe sequence is combined with the target nucleic acid molecule to be detected, the physical distance between the fluorescent group and the quenching group corresponding to the fluorescent group is increased, and the emitted light emitted by the fluorescent group cannot be absorbed by the quenching group so as to be recognized by the detector.

In another preferred embodiment, the detection system further comprises a buffer.

In another preferred embodiment, the concentration of the target nucleic acid molecule to be detected is in the range of 0-400nM, preferably 0-200nM, most preferably 1-100nM.

In another preferred embodiment, the molecular probe is a single-stranded DNA or a single-stranded nucleic acid probe comprising a partial DNA sequence.

In another preferred embodiment, the detection system is used for fluorescent quantitative detection.

In another preferred embodiment, the detection system is visualized using a detection platform selected from the group consisting of: fluorescent quantitative PCR instrument, fluorescent spectrophotometer, fluorescent multifunctional enzyme-labeled instrument, fluorescent microscope, cell/tissue scanning system capable of recognizing fluorescence, fluorescent imaging system, and flow cytometer.

In another preferred embodiment, the detection system is carried out in a microassay sample tank.

In another preferred embodiment, the trace detection sample groove comprises a 96-well plate, a 384-well plate, a cell glass slide and a microfluidic chip.

In another preferred embodiment, the detection system is carried out at a conventional temperature, preferably 25-40 ℃.

In a third aspect of the invention, there is provided a method of detecting the expression level of an RNA in a CLDN18.2 non-coding region, the method comprising:

(a) Providing a sample to be tested;

(b) Binding the molecular probe according to the first aspect of the invention to a sample to be tested, thereby detecting the expression level of CLDN18.2 in the sample.

In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

In another preferred embodiment, the sample is an in vitro or ex vivo sample.

In another preferred example, the sample is a cell sample, a blood sample, a serum sample, a tissue sample.

In another preferred embodiment, the cell sample is a tumor cell sample.

In another preferred embodiment, the tumor cell sample is a peripheral circulating epithelial cell.

In another preferred embodiment, the method further comprises: the signal intensity of the fluorescent group in the molecular probe is detected.

In another preferred embodiment, the method comprises fluorescence microscopy, flow cytometry.

In another preferred embodiment, the molecular probes are mediated by transfection reagents at the cellular level.

In another preferred embodiment, the transfection reagent comprises streptomycin O (SLO).

In another preferred embodiment, the molecular probe is required to pass through a cell-piercing agent for detection at the cellular level.

In another preferred embodiment, the perforating agent comprises Triton X-100.

In another preferred example, the molecular probe may be used in combination with gold nanoparticles having optical and magnetic properties, and nanomaterials such as iron oxide.

In a fourth aspect of the invention, there is provided the use of a molecular probe according to the first aspect of the invention for the preparation of a detection reagent or kit for detecting RNA in the non-coding region of CLDN 18.2.

In a fifth aspect of the invention, there is provided a kit for detecting an RNA of CLDN18.2 non-coding region in a tumor cell, said kit comprising a molecular probe according to the first aspect of the invention.

In another preferred embodiment, the kit contains reagents for detecting a phenotype of a tumor cell.

In another preferred embodiment, the tumor cells are circulating epithelial cells.

In another preferred embodiment, the reagent for detecting tumor cell phenotype further comprises CD45 antibody, CK antibody and Hoechst33342.

In another preferred embodiment, the kit further comprises reagents (e.g., dyes, detergents, buffers, etc.) for detecting CLDN18.2 RNA in peripheral circulating epithelial cells.

In another preferred embodiment, the kit further comprises a slide.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Drawings

FIG. 1 shows the structural formula of the RNA molecular probe of the non-coding region of CLDN 18.2.

FIG. 2 shows the results of specificity evaluation of the RNA molecular probe of the non-coding region of CLDN 18.2.

FIG. 3 shows that the molecular probe of the present invention can specifically recognize CLDN18.2RNA non-coding regions.

FIG. 4 shows the results of sensitivity assessment of the RNA molecular probe of the CLDN18.2 non-coding region.

FIG. 5 shows the evaluation results of sensitivity and temperature resistance of the RNA molecular probe in the non-coding region of CLDN18.2, wherein the left graph shows the test result of the molecular probe of the present invention, and the right graph shows the test result of the molecular probe in KHP 191113237.8.

FIG. 6 shows the results of cell level detection of the CLDN18.2 non-coding region RNA molecular probe.

FIG. 7 shows statistical results of cellular levels of the CLDN18.2 non-coding region RNA molecular probe.

FIG. 8 shows the results of cell staining scoring of CLDN18.2 non-coding region RNA molecule probes, wherein the new: the detection result of the product of the invention is old: KHP191113237.8 patent test results.

FIG. 9 shows the results of detection of circulating epithelial cells in the periphery of the CLDN18.2 non-coding region RNA molecular probe.

Figure 10 shows the method durability results of CLDN18.2 non-coding region RNA molecular probes (test of three test persons on one healthy subject).

FIG. 11 shows the results of detection of peripheral circulation epithelial cells of the CLDN18.2 non-coding region RNA molecular probe (CLDN 18.2 negative patient).

FIG. 12 shows the results of detection of peripheral circulating epithelial cells of the CLDN18.2 non-coding region RNA molecular probe (CLDN 18.2 positive patient).

Detailed Description

Through extensive and intensive research, the inventors developed for the first time a molecular probe for detecting CLDN18.2 non-coding region RNA and application in peripheral circulation epithelial cell detection through a large number of screens. The molecular probe adopted by the invention has an oligonucleotide structure, the sequences at two ends are complementary, and a fluorescent group and a quenching group for quenching the fluorescent group are respectively arranged at two ends. Under the conventional laboratory system (20-40 ℃, such as a conventional buffer system like PBS) a stem-loop structure can be naturally formed, so that the intermolecular distance between the original fluorescent groups and the quenching groups at the two ends is greatly reduced. If excitation light is used at this time, the light emitted by the fluorescent group is phagocytosed by the quenching group and cannot be recognized by the detector. When the molecular beacon is mixed with the target sequence (whether sense strand DNA or RNA), the core region of the molecular probe is complementarily combined with the target sequence, so that the stem-loop structure is converted into a linear structure, the quenching group is a fluorescent group, at the moment, the light emitted by the fluorescent group cannot be quenched and is recognized by the detector, and the fluorescent intensity of the detector is greatly increased. On this basis, the present invention has been completed.

Terminology

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

In this document, each abbreviation is in a conventional sense as understood by those skilled in the art unless otherwise indicated.

CLDN18.2

CLDN18.2 is a transmembrane protein belonging to Claudins (CLDNs) family and is an important component of cell tight junctions.

Molecular probes

As used herein, the terms "molecular probe", "molecular probe of the invention", "molecular beacon", "molecular probe for detecting CLDN18.2 non-coding region RNA", "CLDN18.2 non-coding region RNA molecular probe" are used interchangeably and refer to the molecular probe for detecting CLDN18.2 non-coding region RNA according to the first aspect of the invention.

The structure of the probe sequentially has the structure of the following formula (I) from the 5 'end to the 3' end:

Z0-Z1-Z2-Z3-Z4(I)

Wherein "-" are each independently a bond;

z0 is a fluorescent group;

z1 is N1 nucleotides, N1 is a positive integer from 2 to 6;

Z4 is a quenching group;

The molecular probes of the present invention include DNA or RNA probes.

The molecular probes of the present invention can be prepared by chemical synthesis. The preferred synthesis is shown in example 1.

Detection system

The present invention provides a detection system for detecting CLDN18.2 RNA, the detection system comprising:

(a) The molecular probe according to the first aspect of the present invention;

(b) A target nucleic acid molecule to be detected;

In a preferred embodiment, the detection system further comprises a buffer.

In a preferred embodiment, the concentration of the target nucleic acid molecule to be detected is in the range of 0-400nM, preferably 0-200nM, most preferably 1-100nM.

In a preferred embodiment, the molecular probe is a single-stranded DNA or a single-stranded nucleic acid probe comprising a partial DNA sequence.

In a preferred embodiment, the detection system is used for fluorescent quantitative detection.

In a preferred embodiment, the detection system is visualized using a detection platform selected from the group consisting of: fluorescent quantitative PCR instrument, fluorescent spectrophotometer, fluorescent multifunctional enzyme-labeled instrument, fluorescent microscope, cell/tissue scanning system capable of recognizing fluorescence, fluorescent imaging system, and flow cytometer.

In a preferred embodiment, the detection system is carried out in a microassay sample tank.

In a preferred embodiment, the micro-detection sample tank comprises a 98-well plate, a 384-well plate, a cell slide glass and a microfluidic chip.

In a preferred embodiment, the detection system is carried out at conventional temperatures, preferably 25-40 ℃.

Detection method

The invention also provides a method for detecting the expression level of the RNA of the CLDN18.2 non-coding region, which comprises the following steps:

(a) Providing a sample to be tested;

Application of

The invention provides the use of the molecular probe of the invention, for example for the preparation of a kit, in particular for the detection of CLDN18.2 RNA in tumor cells.

Representative tumor cells include (but are not limited to): gastric cancer MKN45 cells, gastric cancer SNU16 cells, gastric cancer KATO cells, circulating epithelial cells in the peripheral blood of gastric cancer patients.

Kit for detecting a substance in a sample

The invention provides a kit for detecting CLDN18.2 RNA in tumor cells, which contains the molecular probe according to the first aspect of the invention.

In a preferred embodiment, the kit further comprises reagents for detecting tumor cell phenotypes (such as CD45 antibody, CK antibody and Hoechst 33342), reagents for detecting CLDN18.2 RNA in peripheral circulating epithelial cells (such as a stain, a detergent, a buffer solution and the like), a container and the like.

The main advantages of the invention include:

The invention provides a method for detecting human tumor cell markers, in particular to a marker CLDN18.2 RNA of gastric cancer, which takes a molecular probe (molecular beacon) as a basic skeleton, and can be used for single-cell level CLDN18.2 specific and qualitative detection of a patient blood sample based on a circulating tumor cell detection method.

The molecular beacon provided by the invention has a target recognition effect on CLDN18.2 positive cells, and has the characteristics of high efficiency, sensitivity and strong specificity.

And thirdly, the molecular beacon provided by the invention has a recognition effect on the CLDN18.2 in circulating tumor cells in blood, and can be used for classifying and quantifying the expression intensity of the CLDN18.2 by utilizing a fluorescence value. The obtained detection result has certain guiding significance in the aspects of patient typing, clinical medication and the like.

The molecular beacon provided by the invention is obviously different from the specific sequence related to the probe described in the contrast patent KHP191113237.8, wherein the specific sequence is an mRNA translation region, and the specific sequence is not in the translation region, but can be related to CLDN18.2 RNA expression.

The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions, such as, for example, sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. Percentages and parts are weight percentages and parts unless otherwise indicated.

Example 1 design and Synthesis of molecular probes

The molecular beacon provided in this example uses RNA as a basic skeleton, cy5 fluorescence is modified at the 5 'end, BHQ quencher is modified at the 3' end, and the structure is as follows:

5′-Texas-/i2OMeG//i2OMeC//i2OMeG//i2OMeU//i2OMeC/*/i2OMeG/*/i2OMeA/*/i2OMeC/*/i2OMeA/*/i2OMeC/*/i2OMeA/*/i2OMeG/*/i2OMeA/*/i2OMeG/*/i2OMeC/*/i2OMeC/*/i2OMeA/*/i2OMeC/*/i2OMeA/*/i2OMeC/*/i2OM eG/*/i2OMeA/*/i2OMeC/*/i2OMeA/*/i2OMeA/*/i2OMeG/*/i2OMeU/*/i2OMe G//i2OMeA//i2OMeC//i2OMeG//i2OMeC/-BHQ-3′

Wherein,/i 2OMeG/,/i 2OMeC/,/i 2OMeU/,/i 2 OMeA/G, C, U, A nucleotides each having a methylation modification of the-OH group at position 2C. "" is a phosphorothioate modification of a phosphate group.

The nucleotide sequences near the 5 'end and near the 3' end are complementary, so that the whole molecule is combined with the 5 'end and the 3' end in a hydrogen bond mode in a conventional environment to form a stem-loop structure, the hydroxyl groups on all 2-position carbon atoms of the RNA molecule are subjected to methylation modification, and the phosphosites of the loop region are subjected to thiosulfate modification.

The molecular probe chemical nature is nucleotide, the synthesis is usually carried out by adopting a beta-acetonitrile phosphoramidite chemical synthesis method, the synthesis is carried out from the 3 '. Fwdarw.5 ' direction, usually, the first base of the 3' end is combined with a microporous glass bead, for example, DMT modified nucleotide G modified by BHQ2 is firstly combined with the microporous glass bead, deprotection is firstly carried out, DMT protectant on five-carbon sugar hydroxyl is removed by using TCA reagent, then activation is carried out, nitrogen of phosphonite in the next DMT and phosphonite pre-modified nucleotide is activated, then coupling is carried out with the nucleotide modified on the microporous glass bead, then unreacted nucleotide C is blocked by acetic anhydride, and finally, the nucleoside phosphite is oxidized into more stable nucleoside phosphate, and thiosulfate can be synthesized by adopting substitution reaction. At this time, one nucleotide has been successfully added, and thus, the molecular probe can be synthesized by repeating this process.

The above reactions can be synthesized by an automated nucleotide synthesizer and can be processed by the reagent manufacturer instead. Purifying the synthesized molecular probe by High Performance Liquid Chromatography (HPLC).

The structural formula of the molecular probe prepared in the embodiment is shown in figure 1.

Example 2 evaluation of Properties of molecular probes

The evaluation includes several criteria including binding speed, linearity, temperature durability, specificity, and minimum detection limit.

1. Binding analysis of molecular probes and molecular samples with different concentrations

The specific method comprises the following steps: the method is carried out in a fluorescence multifunctional enzyme-labeled instrument, 50 mu L of molecular probes with the concentration of 100nM are placed in a 96-well plate, molecular probes with different concentrations are added for incubation at room temperature (25 ℃) for 30min, then fluorescence values are detected, and 550nM excitation light wavelength and 580nM emission light wavelength are set by taking Cy3 as an example.

Target sequence list:

alternatively, the detection capability of the molecular probe can be effectively improved by adopting a micro detection sample groove such as a 384-well plate, a micro-fluidic chip and the like, or adopting a method for improving fluorescence detection capability by adopting multiple exposure, long-time exposure and the like.

Results

The sequence of the molecular probe of the invention is shown in FIG. 3, and the probe of the invention can specifically recognize the 5' untranslated region of CLDN18.2 RNA.

The results of the performance evaluation of the molecular probe are shown in FIG. 4. In the experiment, the concentration of the CLDN18.2 RNA sample ranges from 0 to 120nM, and 100nM can effectively distinguish the CLDN18.1 from the CLDN18.2 RNA.

On the other hand, the recognition of the mutant sequence of the target sequence by CLDN18.2 RNA was greatly reduced, indicating that the molecular probe was bound to the target single-stranded target sequence.

2. Temperature durability analysis the ability of the agent to bind to target RNA at different temperatures was evaluated

The specific method comprises the following steps: the method is carried out in a fluorescent quantitative PCR instrument, molecular probes are fully mixed with a CLDN18.1 cDNA/CLDN18.2 cDNA/binding buffer solution (binding buffer) respectively in a PCR tube, the PCR tube is put into the instrument, the set temperature is gradually increased from 20 ℃ to 40 ℃, and the fluorescent intensity is recorded at each temperature.

Results

The results are shown in FIG. 5. The practical result shows that in the single molecular beacon environment, the fluorescence intensity is irrelevant to the temperature in the conventional environment (below 35 ℃), when the temperature rises to a certain degree, the molecular beacon and the CLDN18.1 RNA result show the same binding buffer result as the fluorescence intensity is increased due to the fact that the molecular beacon and the CLDN18.1 RNA result show that the molecular beacon does not bind with non-targeted RNA, CLDN18.2RNA shows high-intensity fluorescence at low temperature, and the fluorescence value is greatly reduced along with the temperature rise. The normal operation of the detection reagent can be ensured at the normal use temperature.

3. Molecular probe cell detection capability assessment

Since the molecular probe is mainly applied to CTCs level detection, namely detection needs to be carried out at a cell level, the detection capability of the molecular probe at the cell level needs to be evaluated.

The specific method comprises the following steps: and (3) transfecting the molecular probes into cells, incubating for 10-30min, removing residual molecular probes in the culture medium, and then continuously culturing for 1h to obtain the detection.

Preferably, tris (2-carboxyethyl) phosphine (Tris (2-carboxyethyl) phosphine, TCEP) pre-activated SLO is adopted for cell perforation so as to transfect an exogenous molecular probe into cells, thus effectively avoiding the endocytic pathway mediated by the traditional transfection reagent, reducing the distribution of the molecular probe in degradation cell organelles such as lysosomes and the like, and further reducing the background noise.

As an alternative to the preferred method, cells may be permeabilized by selecting Triton X-100 reagent, and treating the cells with 0.05% Triton X-100 (PBS system) for 5min at a temperature set to 4 ℃. And then washing the cells for 3 times by using PBS, and adding the molecular probes for subsequent staining.

The fluorescence intensity carried on the intracellular molecular probes was read using a fluorescence microscope, and cells included in this test were found to be:

CLDN18.2 positive cells: SNU16, PMA-induced MKN45, KATO3

CLDN18.2 negative cells: PBMC, jurkat, SKBR3, SNU5, HGC27, MKN45

The ratio of positive signals to total signals in the cells is taken as the cell staining rate phi, the positive cell score is phi, and the negative cell score is 1-phi.

Results

The results of cell level detection and cell level statistics of CLDN18.2 non-coding region RNA molecular probes are shown in figures 6 and 7, respectively.

FIG. 6 is a graph showing the results of cell level detection of RNA molecular probes in the non-coding region of CLDN18.2, wherein each row is the detection result of a cell in different fluorescent channels, namely Bright field (Bright), cell nucleus (DAPI), CLDN18.2 molecular probes (MB), full-image superposition (Merge), and the result shows that the fluorescence in MB channels in PBMC, jurkat, SNU, HGC27 and MKN45 cells is extremely weak and less than 500; and PMA as a CLDN18.2 positive expression cell induces extremely strong fluorescence in MB channels shown by MKN45, SNU16 and KATO cells, which is more than 1000. The molecular probe shown in the patent has extremely strong distinguishing capability on CLDN18.2 negative and positive cells.

FIG. 7 shows the statistical results of the experiment shown in FIG. 6, wherein 1000 data points are randomly selected to draw box plots, each row is a group of cells, the column height is the mean value of fluorescence intensity, and if 1000 is taken as a positive judgment standard, the results are consistent with those shown in FIG. 6. PBMC, jurkat, SNU5, HGC27, MKN45 cells showed low fluorescence in MB channel and PMA induced MKN45, SNU16, KATO cells showed high fluorescence in MB channel. Again, the discussion shown in fig. 6 is demonstrated.

All cell results were plotted and the results are shown in figure 8. The result shows that compared with the probe (sequence: 5'cy5-CGUAUGCCCGCAAUCCCAAUCAGUUACGBHQ2-3' and sequence region shown in figure 2) of the KHP191113237.8 patent, the detection result of the molecular probe shown in the patent has greatly improved detection sensitivity and specificity.

In addition, the molecular probe has higher positive cell detection fluorescence intensity and lower negative cell detection fluorescence intensity for high-expression cells and low-expression cells.

Example 3 preparation of CLDN18.2 RNA detection kit in peripheral circulating epithelial cells

Molecular beacons are used for peripheral circulation epithelial cell detection, and combined methods are used for CLDN18.2 RNA expression determination and classification in tumor cells.

The composition of the specific kit is shown in the following table:

Wherein the reagent 1, the reagent 2 and the reagent 4 are used for identifying the circulating epithelial cells, and the molecular phenotype of the circulating epithelial cells is Hoechst33342+, CK+, CD45-. The "+" represents positive, and the corresponding fluorescence intensity exceeds a preset value; "-" represents negative, and indicates that the corresponding fluorescence intensity is lower than a preset value. Reagent 3 was a CLDN18.2 molecular probe at a concentration of 10 μm and used at a concentration of 50nM. The reagent 5-13 is used for the pretreatment steps of dyeing, washing and the like of the reagent 1-4.

The reagent is preserved for 3 months at 1-4deg.C, the reagent is preserved for 6 months at 5-12deg.C, and the reagent is preserved for 3 years at normal temperature.

Example 4 CLDN18.2RNA detection in peripheral circulation epithelial cells in gastric cancer patients

Two patients with advanced gastric cancer were taken together for sampling peripheral blood, and according to the tissue information of the patients, patient 1 was expressed negative for CLDN18.2 and patient 2 was expressed positive.

1. Coated glass slide

Dripping 200 mu L of coating liquid into the center of a slide sample area, standing at room temperature for more than 60 minutes, or standing at 4 ℃ overnight; after the coating was completed, the coating solution was removed by suction, and 200. Mu.L of PBS was added dropwise thereto. And preserving moisture for standby.

2. EpCAM positive screening in human peripheral blood

Peripheral blood of patients with gastric cancer and healthy people was collected, and EpCAM positive cells were collected. Preferably, the EpCAM positive selection is performed using TumorFisher kit from the midwife biotechnology company.

3. Preparation of peripheral blood captured product sample sheet

And (3) dripping the collected EpCAM positive expression cells into a sample area of the glass slide, slowly adding cell fixing liquid into the sample area, standing at room temperature for 30 minutes, and slowly sucking out redundant liquid. 100. Mu.L of absolute ethanol was slowly added dropwise to the sample area, and immediately removed by pipetting. And (5) airing at room temperature.

4. Sealing the sample

200. Mu.L of reagent 5 was added dropwise to the sample area, and the mixture was allowed to stand at room temperature for 30 minutes and then removed by pipetting.

5. Antibody incubation and washing

Preparing a mixed antibody working solution [ CD45 antibody ] by using a reagent 7: 1:50 (v/v), CK antibody: 1:50 (v/v), CLDN18.2 molecular probe: 1:100 (v/v), i.e., 1. Mu.L of reagent 1 and 1. Mu.L of reagent 2 and 0.5. Mu.L of reagent 2 are contained in each 50. Mu.L of mixed antibody working solution, and the mixture is thoroughly mixed. 50. Mu.L of diluted working fluid was added dropwise to each sample piece. The wet box with the sample pieces was covered and placed on a horizontal shaker at the lowest speed and incubated for 30 minutes at room temperature. After the incubation, the incubation liquid was aspirated. 200. Mu.L of reagent 13 was added dropwise to the sample area, left to stand for 5 minutes and then sucked off, and this step was repeated three times.

6. Cell nucleus staining and washing

Reagent 4 was diluted 1:100 (v/v) with PBS. 100. Mu.L of diluted working solution was added dropwise to each sample piece, and incubated at room temperature for 1 minute. After the incubation, the working fluid was aspirated. 200. Mu.L of PBS was added dropwise to the sample area, and the mixture was allowed to stand for 5 minutes and then removed by pipetting, and repeated three times.

7. Sealing sheet

To the sample area 20. Mu.L of reagent 9 was added dropwise. The cover glass was carefully covered to avoid air bubbles. The solution was aspirated except for the overflow coverslip.

8. Sample slice preservation

The sample piece after immunofluorescence staining is flatly placed in a light-proof sample wet box for microscopic observation and recording.

Results

The detection results are shown in FIGS. 9-12. FIG. 9 shows the result of peripheral circulation epithelial cells detection of the RNA molecular probe with the non-coding region of CLDN18.2 in peripheral blood of healthy subjects, and the result shows that the cell phenotype is DAPI+/CK-/CD45+, obvious leukocyte characteristics are presented, and the signal (MB channel) of the molecular probe is not detected in the leukocytes, which is consistent with experimental expectation, because the healthy subjects have no peripheral circulation epithelial cells, and therefore, only the expression of the CLDN18.2 of the leucocytes in the peripheral blood can be detected, and the probe has good specificity. Fig. 10 shows statistics of molecular probe staining, each column of data is a test result of a healthy subject, and the results are consistent with the experiment shown in fig. 9, and CLDN18.2 molecular probe does not reflect peripheral blood cells of healthy people, so that good specificity is achieved. FIG. 11 shows the expression of CLDN18.2 in peripheral blood circulating tumor cells of a patient negative for CLDN18.2, wherein the fluorescent intensity of the CLDN18.2 molecular probe is well below 500, and is negative. FIG. 12 shows the expression of CLDN18.2 in peripheral blood circulating tumor cells of a patient positive for CLDN18.2, wherein the fluorescent intensity of the CLDN18.2 molecular probe is far higher than 700, and the expression is positive.

In conclusion, the molecular probe provided by the invention can be used for quantitative research of the level of the CLDN18.2 RNA and also can be used for qualitative analysis of the level of the CLDN18.2 RNA at the cell level. The invention relates to a detection reagent, reagent optimization, a molecular level detection method and a cell level detection method, wherein the application is CLDN18.2 RNA quantitative detection, and the detection reagent can be added into the circulating tumor cell detection to carry out joint detection on the basis of the quantitative detection, so that the CLDN18.2 RNA in the circulating tumor cell can be identified. The method is simple and quick, and utilizes fluorescence quantitative detection, so that no equipment is required to be added on the basis of a CTCs standard detection method, and the detection cost and the analysis difficulty are greatly reduced. The method is highly adaptable to CTCs standard methods.

All documents mentioned in this disclosure are incorporated by reference in this disclosure as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the application as defined in the appended claims.

Claims

1. A molecular probe for detecting CLDN18.2 non-coding region RNA, characterized in that the probe has the structure of the following formula (I) in order from 5 'end to 3' end:

Z0-Z1-Z2-Z3-Z4(I)

Wherein "-" are each independently a bond;

z0 is a fluorescent group;

z1 is N1 nucleotides, N1 is a positive integer from 2 to 6;

Z4 is a quenching group;

2. The molecular probe of claim 1, wherein the length of the molecular probe is 20 to 40nt, preferably 21 to 30nt.

3. The molecular probe of claim 1, wherein all of the hydroxyl groups on the carbon atoms at position 2 of the probe are subjected to methylation modification and the phosphosites of the cyclic region are subjected to thiosulfate modification.

4. The molecular probe of claim 1, wherein the molecular probe is an RNA probe, and the probe sequence is: 5'-GCGUCGACACAGAGCCACACGACAAGUGACAC-3', wherein the italic region spontaneously forms a "stem-loop" like structure due to the reverse complement pairing.

5. The molecular probe of claim 1, wherein the molecular probe has a fluorescent group at one end and a quenching group at the other end, and the fluorescent group and the quenching group are matched with each other.

6. A detection system for detecting RNA in a CLDN18.2 non-coding region, the detection system comprising:

(a) The molecular probe of claim 1;

(b) A target nucleic acid molecule to be detected;

7. The detection system according to claim 6, wherein the concentration of the target nucleic acid molecule to be detected is in the range of 0-400nM, preferably 0-200nM, most preferably 1-100nM.

8. A method of detecting the expression level of an RNA in a CLDN18.2 non-coding region, the method comprising:

(a) Providing a sample to be tested;

(b) Binding the molecular probe of claim 1 to a test sample, thereby detecting the expression level of CLDN18.2 in the sample.

9. Use of a molecular probe according to claim 1 for the preparation of a detection reagent or kit for the detection of CLDN18.2 non-coding region RNA.

10. A kit for detecting RNA in a CLDN18.2 non-coding region of a tumor cell, comprising the molecular probe of claim 1.