CN118126142A

CN118126142A - Novel variant of H+ symporter PheP of phenylalanine and method for producing L-aromatic amino acid using the same

Info

Publication number: CN118126142A
Application number: CN202311382179.7A
Authority: CN
Inventors: 金贤英; 乔伊·车; 曹永一
Original assignee: Daesang Corp
Current assignee: Daesang Corp
Priority date: 2022-10-24
Filing date: 2023-10-24
Publication date: 2024-06-04

Abstract

The present invention relates to a novel variant of phenylalanine H+ symporter PheP and a method for producing an L-aromatic amino acid using the same, wherein the variant of phenylalanine H+ symporter PheP changes the protein activity by substituting at least one amino acid in the amino acid sequence constituting phenylalanine H+ symporter PheP, and L-tryptophan, L-phenylalanine or L-tyrosine can be produced efficiently by a recombinant microorganism comprising the variant.

Description

Novel variant of H+ symporter PheP of phenylalanine and method for producing L-aromatic amino acid using the same

Technical Field

The invention relates to a novel variant of phenylalanine H+ symporter PheP and a method for producing L-aromatic amino acid by using the same.

Background

Amino acids are classified into hydrophobic, hydrophilic, basic and acidic amino acids according to the nature of side chains, and amino acids having benzene rings therein are called aromatic amino acids. Among the aromatic amino acids, phenylalanine, tyrosine and tryptophan are essential amino acids that cannot be synthesized in living bodies, and belong to the high value-added industry that forms a market of $3000 million each year worldwide.

The production of aromatic amino acids can be carried out using wild-type strains obtained in a natural state or variant strains modified in such a manner as to enhance the amino acid productivity. In recent years, in order to improve the production efficiency of aromatic amino acids, genetic recombination techniques have been applied to microorganisms such as E.coli and coryneform bacteria which are used in many cases for producing useful substances such as L-amino acids, and various recombinant strains or variants having excellent L-aromatic amino acid productivity have been developed, and a method for producing L-aromatic amino acids using the same. In particular, the following attempts were made: the production of the corresponding amino acid is increased by targeting genes such as enzymes, transcription factors, transport proteins, etc. involved in the biosynthesis pathway of the L-aromatic amino acid, or inducing mutation in promoters regulating their expression. However, since the types of proteins such as enzymes, transcription factors, transport proteins, etc., which are directly or indirectly involved in the production of L-aromatic amino acids, are several tens of kinds, a great deal of research is actually required as to whether the L-aromatic amino acid production capacity is increased or not according to the activity change of such proteins.

Prior art literature

Patent literature

Korean patent No. 10-1830002

Disclosure of Invention

The object of the present invention is to provide phenylalanine H+ symporter PheP variants.

In addition, it is an object of the present invention to provide polynucleotides encoding the above variants.

In addition, it is an object of the present invention to provide a transformant comprising the above variant or polynucleotide.

The present invention also provides a method for producing an L-aromatic amino acid using the transformant.

In one embodiment of the present invention, there is provided a phenylalanine H+ symporter PheP variant comprising the amino acid sequence of SEQ ID NO. 4, wherein glutamic acid (Glu) No. 272 in the amino acid sequence of SEQ ID NO. 2 is replaced with lysine (Lys).

As used herein, "phenylalanine: H+ symporter PheP (phenalane: H+ symporter PheP)" is also referred to as phenylalanine-specific permease (phenalane-SPECIFIC PERMEASE) and serves to transport phenylalanine across the cytoplasmic membrane. The phenylalanine: H+ symporter PheP in the present invention may be a polypeptide encoded by pheP gene and having an activity of phenylalanine: H+ symporter PheP, but is not limited thereto.

The sequence information of the nucleic acid and protein of the phenylalanine H+ symporter PheP can be obtained by a known sequence database (for example, genBank, uniProt).

According to one embodiment of the present invention, the phenylalanine H+ symporter PheP may be encoded by the base sequence of SEQ ID NO.1 or may be constituted by the amino acid sequence of SEQ ID NO. 2.

The amino acid sequence of H+ symporter PheP or the base sequence encoding it according to the present invention may include a base sequence or amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity to each sequence. The term "homology" or "identity" as used herein refers to the percentage of identity (%) between two sequences when the base sequence or amino acid sequence to be used as a reference is aligned with any other base sequence or amino acid sequence so as to correspond to the maximum extent for analysis.

According to an embodiment of the present invention, the phenylalanine H+ symporter PheP or a gene encoding the same may be derived from wild-type Escherichia coli (ESCHERICHIA COLI).

As used herein, "variant" refers to a protein that differs from the original amino acid sequence of the protein due to variations in the base sequence of the gene encoding the protein. More specifically, a genetic sequence variation is a change in one or more bases or nucleotides in the sequence constituting a gene due to substitution (insertion), deletion (deletion), or the like, and therefore a translated polypeptide or protein as a protein variant has one or more amino acids in the N-terminal, C-terminal, and/or internal amino acid sequence conservatively substituted (conservative substitution) and/or altered (modification) so as to differ from the amino acid sequence before variation, but maintains functions (functions) or properties (properties). As used herein, "conservative substitutions" refer to the substitution of one amino acid for another that is structurally and/or chemically similar, with little or no effect on the activity of the protein or polypeptide. The amino acid is selected from alanine (Ala), isoleucine (Ile), valine (Val), leucine (Leu), methionine (Met), asparagine (Asn), cysteine (Cys), glutamine (Gln), serine (Ser), threonine (Thr), phenylalanine (Phe), tryptophan (Trp), tyrosine (Tyr), aspartic acid (Asp), glutamic acid (Glu), arginine (Arg), histidine (His), lysine (Lys), glycine (Gly) and proline (Pro).

In addition, variants include variants with more than one N-terminal leader sequence or a portion of the transmembrane domain (transmembrane domain) removed, or variants with a portion of the N-and/or C-terminal of the mature protein (protein) removed.

Such variants may have increased (enhanced) or unchanged or decreased (attenuated) ability compared to the protein prior to mutation. Herein, "adding or enhancing" includes the following cases: the activity of the protein itself is increased as compared with the protein before mutation; in the case where the overall intracellular enzyme activity level is high compared with that of the wild-type strain or the strain expressing the protein before mutation due to increased expression or increased translation of the gene encoding the protein, etc.; and combinations thereof. Furthermore, "reducing or weakening" includes the following: the activity of the protein itself is reduced as compared with the protein before mutation; the expression of a gene encoding a protein is inhibited, translation is inhibited, or the like, so that the overall intracellular enzymatic activity is lower than that of the wild-type strain or the strain expressing the protein before mutation; and combinations thereof. In the present invention, variants may be used in combination with variants, alterations, variant polypeptides, variant proteins, variants, and the like.

The phenylalanine: H+ symporter PheP variant according to the present invention may comprise an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity to the amino acid sequence of SEQ ID NO. 4, provided that the amino acid sequence maintains the function or property of the variant described above, may be included without limitation.

Another aspect of the invention provides a polynucleotide encoding a variant of the above phenylalanine H+ symporter PheP.

The "polynucleotide (polynucleotide)" used in the present invention is a polymer (polymer) of nucleotides in which nucleotide monomers (monomers) are linked in a chain form by covalent bonds, and is a DNA or RNA strand of a predetermined length or more, more specifically, a polynucleotide fragment encoding the protein variant.

According to one embodiment of the present invention, the polynucleotide comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO. 4, and may comprise, for example, the nucleotide sequence of SEQ ID NO. 3.

Another aspect of the invention provides a vector comprising a polynucleotide encoding a variant of the above phenylalanine H+ symporter PheP.

In addition, another embodiment of the present invention provides a transformant comprising the above-mentioned phenylalanine H+ symporter PheP variant or polynucleotide.

The term "vector" as used herein refers to any type of nucleic acid sequence transport structure used as a means for delivering and expressing a target gene into a host cell. Unless otherwise indicated, such vectors may refer to the insertion of a supported nucleic acid sequence into a host cell gene for expression and/or expression separately. Such vectors include the necessary regulatory elements operably linked for expression of the gene insert, "operably linked (operably linked)" means that the gene of interest and its regulatory sequences are functionally bound to each other and linked in a manner that enables gene expression, "regulatory elements" include promoters for carrying out transcription, any operator sequences for regulating transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences that regulate termination of transcription and translation.

The vector used in the present invention is not particularly limited as long as it can replicate in a host cell, and any vector known in the art can be used. Examples of the vector include plasmids, cosmids, viruses, and phages in their natural or recombinant state. For example, as phage vectors or cosmid vectors, we15, M13, λmbl3, λmbl4, λ IXII, λ ASHII, λapii, λt10, λt11, charon4A, charon a, etc., and as plasmid vectors, pBR system, pUC system, pbluescript ii system, pGEM system, pTZ system, pCL system, pET system, etc., are available, but not limited thereto.

The above vectors may be representatively constructed as vectors for cloning or vectors for expression. The vector for expression may use a conventional vector used in the art for expressing a foreign gene or protein in a plant, animal or microorganism, and may be constructed by various methods well known in the art.

The "recombinant vector" used in the present invention may be constructed using a prokaryotic cell or a eukaryotic cell as a host, may replicate independently of the genome of the host cell, or may be sutured to the genome itself. The host cell can replicate the vector, and may include an origin of replication which is a specific base sequence for starting replication. For example, when the vector used is an expression vector and prokaryotic cells are used as a host, a strong promoter (e.g., plλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter) that allows transcription to proceed generally contains a ribosome binding site for translation initiation and transcription/translation termination sequences. When eukaryotic cells are used as hosts, the replication origins to be initiated in eukaryotic cells contained in the vector include, but are not limited to, f1 replication origins, SV40 replication origins, pMB1 replication origins, adenovirus replication origins, AAV replication origins, BBV replication origins, and the like. In addition, promoters derived from mammalian cell genomes (e.g., metallothionein promoters) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, tk promoter of HSV) may be utilized, and typically have polyadenylation sequences as transcription termination sequences.

The recombinant vector may include a selection marker for selecting transformants (host cells) transformed with the vector, and only cells expressing the selection marker may survive in the medium treated with the selection marker, thereby enabling selection of the transformed cells. The selection markers include, but are not limited to, ampicillin, kanamycin, streptomycin, and chloramphenicol, as typical examples.

By inserting the recombinant vector into a host cell, a transformant can be produced, which can be obtained by introducing the recombinant vector into an appropriate host cell. The host cell is a cell in which the above-described expression vector can be stably and continuously cloned or expressed, and any host cell known in the art can be used.

When a prokaryotic cell is transformed to produce a recombinant microorganism, a strain of Escherichia coli such as E.coli JM109、E.coli BL21、E.coli RR1、E.coli LE392、E.coli B、E.coli X 1776、E.coli W3110、E.coli XL1-Blue can be used as a host cell; a corynebacterium strain; bacillus strains such as bacillus subtilis and bacillus thuringiensis; various intestinal bacteria and strains such as Salmonella typhimurium, serratia marcescens and Pseudomonas species, etc., but are not limited thereto.

In the case of transforming eukaryotic cells for the production of recombinant microorganisms, yeasts (e.g., saccharomyces cerevisiae), insect cells, plant cells, and animal cells, for example, sp2/0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, hepG2, huh7, 3T3, RIN, MDCK cell lines, etc., can be used as host cells, but are not limited thereto.

The term "transformation" as used herein refers to a phenomenon in which a foreign DNA is introduced into a host cell to artificially cause a gene change, and the term "transformant (transformant)" refers to a host cell into which a foreign DNA is introduced and in which the expression of a target gene is stably maintained.

In the above transformation, an appropriate vector introduction technique is selected according to the host cell, so that the target gene or a recombinant vector comprising the same can be expressed in the host cell. For example, the vector introduction may be performed by electroporation (electroporation), thermal shock (heat-shock), calcium phosphate (CaPO ₄) precipitation, calcium chloride (CaCl ₂) precipitation, microinjection (microinjection), polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene may be included as long as it can be expressed in the host cell, and is not limited to insertion into the chromosome of the host cell or to being located extrachromosomally.

The above transformant includes a cell transfected, transformed or infected with the recombinant vector according to the present invention in an organism or in a test tube, and may be used as the same term as a recombinant host cell, a recombinant cell or a recombinant microorganism.

According to one embodiment of the present invention, the transformant may be an Escherichia strain or a Corynebacterium strain.

The strain of the genus Escherichia may be, but not limited to, escherichia coli (ESCHERICHIA COLI), escherichia ibutescens (ESCHERICHIA ALBERTII), escherichia blattae (ESCHERICHIA BLATTAE), escherichia fries (ESCHERICHIA FERGUSONII), escherichia hertz (ESCHERICHIA HERMANNII), or Escherichia wound (ESCHERICHIA VULNERIS).

The corynebacterium strain may be Corynebacterium glutamicum (Corynebacterium glutamicum), lactobacillus plantarum (Corynebacterium crudilactis), corynebacterium desert (Corynebacterium deserti), corynebacterium broom (Corynebacterium callunae), corynebacterium threonae (Corynebacterium suranareeae), corynebacterium oleae (Corynebacterium lubricantis), corynebacterium canal Sang Bangzhuang (Corynebacterium doosanense), corynebacterium hepaticum (Corynebacterium efficiens), corynebacterium Ubbelopsis (Corynebacterium uterequi), corynebacterium parvum (Corynebacterium stationis), corynebacterium parvum (Corynebacterium pacaense), corynebacterium mirabilis (Corynebacterium singulare), corynebacterium humicola (Corynebacterium humireducens), corynebacterium maritimum (Corynebacterium marinum), corynebacterium salt tolerance (Corynebacterium halotolerans), corynebacterium pterans (Corynebacterium spheniscorum), corynebacterium freudenreichii (Corynebacterium freiburgense), corynebacterium striatum (Corynebacterium striatum), corynebacterium canis (Corynebacterium canis), corynebacterium ammoniagenes (Corynebacterium ammoniagenes), corynebacterium renifolium (Corynebacterium renale), corynebacterium pollutes (Corynebacterium pollutisoli), corynebacterium hanensis (Corynebacterium imitans), corynebacterium reesei (Corynebacterium caspium), corynebacterium testiclae (Corynebacterium testudinoris), corynebacterium pseudolarium (Corynebacaterium pseudopelargi) or Corynebacterium flavum (Corynebacterium flavescens), but is not limited thereto.

The transformant of the present invention may be a strain comprising the above-mentioned phenylalanine H+ symporter PheP variant or polynucleotide encoding it, or a vector containing the same; a strain expressing the above phenylalanine H+ symporter PheP variant or polynucleotide; or a strain having an activity to the phenylalanine H+ symporter PheP variant, but is not limited thereto.

The transformant of the present invention may include other protein variants or genetic variations in addition to the phenylalanine H+ symporter PheP variant described above.

According to one embodiment of the present invention, the transformant may have L-aromatic amino acid productivity.

The transformant may naturally have L-aromatic amino acid productivity or may be artificially provided with L-aromatic amino acid productivity.

According to one embodiment of the present invention, the transformant has an improved L-aromatic amino acid productivity because the activity of phenylalanine H+ symporter PheP is changed.

As used herein, "increased productivity" means that the productivity of L-aromatic amino acids is increased as compared to the parent strain. The parent strain refers to a wild-type strain or a mutant strain to be mutated, and includes a subject to be mutated directly or a subject to be transformed by a recombinant vector or the like. In the present invention, the parent strain may be a wild-type escherichia strain or a corynebacterium strain or an escherichia strain or a corynebacterium strain mutated from a wild-type.

The transformant according to the present invention shows an increased L-aromatic amino acid productivity as compared with a strain (parent strain) comprising a protein before mutation by introducing a phenylalanine: H+ symporter PheP variant so that the activity of phenylalanine: H+ symporter PheP is altered. More specifically, the above transformant may increase the L-aromatic amino acid production by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% as compared with the parent strain, or may increase it by 1.1-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold or 10-fold, but is not limited thereto. As an example, a transformant comprising the above-described phenylalanine H+ symporter PheP variant may increase L-aromatic productivity by more than 5% compared to the parent strain, specifically, may increase by 5 to 50% (preferably 7 to 40%).

The composition comprising the transformant according to the present invention can be used as a composition for producing an L-aromatic amino acid.

Another aspect of the present invention provides a method for producing an L-aromatic amino acid, comprising the steps of: a step of culturing the transformant in a medium; and recovering the L-aromatic amino acid from the transformant or a medium in which the transformant is cultured.

The above-mentioned culture may be carried out according to a suitable medium and culture conditions known in the art, and the medium and culture conditions may be easily adjusted and used by those skilled in the art. Specifically, the medium may be a liquid medium, but is not limited thereto. The cultivation method may include, for example, batch cultivation (batch cultivation), continuous cultivation (continuous culture), fed-batch cultivation (fed-batch cultivation), or a combination thereof, but is not limited thereto.

According to one embodiment of the invention, the above-mentioned culture medium must meet the requirements of the particular strain in a suitable manner, and can be suitably deformed by a person skilled in the art. For the culture medium of the strain of Escherichia or the strain of Corynebacterium, reference may be made to well-known document (Manual ofMethods for General Bacteriology.American Society for Bacteriology.Washington D.C.,USA,1981),, but is not limited thereto.

According to one embodiment of the present invention, the medium may contain various carbon sources, nitrogen sources and trace element components. As the carbon source which can be used, there are included sugars such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose and the like and carbohydrates; oil and fat such as soybean oil, sunflower seed oil, castor seed oil, coconut oil and the like; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerin and ethanol; organic acids such as acetic acid. These substances may be used alone or in the form of a mixture, but are not limited thereto. As nitrogen sources that can be used, peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds, for example, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate can be included. The nitrogen source may also be used alone or in the form of a mixture, but is not limited thereto. As the supply source of phosphorus that can be used, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts may be included, but are not limited thereto. The medium may contain a metal salt such as magnesium sulfate or iron sulfate required for growth, but is not limited thereto. In addition, essential growth substances such as amino acids and vitamins may be contained. In addition, precursors suitable for the culture medium may be used. The above-mentioned medium or individual components may be added to the culture broth in batches or continuously by an appropriate means during the culture, but are not limited thereto.

According to an embodiment of the present invention, during the cultivation, a compound such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be added to the microorganism culture solution in an appropriate manner to adjust the pH of the culture solution. In addition, during the culture, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble generation. Further, in order to maintain the aerobic state of the culture, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture. The temperature of the culture solution may be generally 20℃to 45℃and, for example, may be 25℃to 40 ℃. The incubation time may be continued until the desired throughput of the useful substance is obtained, for example, may be 10 to 160 hours.

According to one embodiment of the present invention, in the above-mentioned step of recovering an L-aromatic amino acid from a transformant to be cultured or a medium in which the transformant is cultured, the produced L-aromatic amino acid may be collected or recovered from the medium according to a culture method and by using a suitable method known in the art. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion), and the like may be used, but are not limited thereto.

According to one embodiment of the present invention, in the step of recovering an L-aromatic amino acid, the medium may be centrifuged at a low speed to remove biomass, and the obtained supernatant may be separated by ion exchange chromatography.

According to one embodiment of the present invention, the step of recovering the L-aromatic amino acid may include a step of purifying the L-aromatic amino acid.

According to one embodiment of the present invention, the L-aromatic amino acid may be 1 or more selected from the group consisting of L-tryptophan, L-phenylalanine and L-tyrosine.

The variant of H+ symporter PheP of phenylalanine according to the present invention changes the protein activity by substitution of one or more amino acids in the amino acid sequence constituting the H+ symporter PheP, so that L-tryptophan, L-phenylalanine or L-tyrosine can be efficiently produced by a recombinant microorganism comprising the above variant.

Drawings

FIG. 1 shows the structure of a plasmid pDSG according to an embodiment of the present invention.

FIG. 2 shows the structure of plasmid pDS9 according to an embodiment of the present invention.

Detailed Description

The present invention will be described in more detail below. However, the description is merely illustrative for the purpose of facilitating understanding of the present invention, and the scope of the present invention is not limited to such illustrative description.

Example 1 preparation of strains expressing phenylalanine H+ symporter PheP variants

In order to confirm the effect of a variant (SEQ ID NO: 4) in which glutamic acid (Glu) at 272 th in the amino acid sequence (SEQ ID NO: 2) of phenylalanine: H+ symporter PheP was replaced with lysine (Lys) on the production of L-aromatic amino acid, a vector expressing the above phenylalanine: H+ symporter PheP variant and a strain into which the above vector was introduced were produced. For gene insertion of the phenylalanine H+ symporter PheP variant in the strain, plasmid pDSG and pDS9 were used and made as follows.

The above plasmid pDSG (SEQ ID NO: 23) has an origin of replication which functions only in E.coli, and has an ampicillin (ampicillin) resistance gene and a guide RNA (gRNA) expression mechanism. The above plasmid pDS9 (SEQ ID NO: 24) has an origin of replication which functions only in E.coli, has a kanamycin (kanamycin) resistance gene, a lambda Red gene (exo, bet and gam) expression system and a CAS9 expression mechanism derived from Streptococcus pyogenes (Streptococcus pyogenes).

1-1 Preparation of vector pDSG-pheP for transformation (Glu 272 Lys)

PCR was performed using E.coli (ESCHERICHIA COLI) MG1655 (KCTC 14419 BP) gDNA as a template and using the primer set of primer 7 and primer 9 and the primer set of primer 8 and primer 10, thereby obtaining an upstream (upstream) fragment of pheP of the 272 th amino acid variation in the amino acid sequence of phenylalanine: H+ symporter PheP. Then, PCR was performed using the E.coli MG1655 (KCTC 14419 BP) gDNA as a template and the primer set of the primer 11 and the primer 13 and the primer set of the primer 12 and the primer 14, to obtain a pheP downstream (downstream) fragment of the 272 th amino acid mutation in the amino acid sequence of the phenylalanine H+ co-transporter PheP. The upstream (upstream) and downstream (downstream) fragments contain a codon sequence that translates Glu 272 of the amino acid sequence of phenylalanine: H+ symporter PheP to Lys. Here, TAKARA PRIMESTAR Max DNApolymerase, PCR was used as the polymerase, and the denaturation at 95℃for 10 seconds, annealing at 57℃for 15 seconds and polymerization at 72℃for 10 seconds were repeated 30 times.

PCR was performed using the plasmid pDSG as a template and the primer pair of primer 3 and primer 5, the primer pair of primer 4 and primer 6, the primer pair of primer 15 and primer1, and the primer pair of primer 16 and primer 2, thereby obtaining 4 pDSG gene fragments. Each gene fragment contains a gRNA sequence targeted to Glu pheP. The gRNA selects the NGG pre 20mer of the sequence to be mutated. Here, TAKARA PRIMESTAR Max DNApolymerase, PCR was used as the polymerase, and the denaturation at 95℃for 10 seconds, annealing at 57℃for 15 seconds and polymerization at 72℃for 15 seconds were repeated 30 times.

Then, the obtained upstream (upstream) and downstream (downstream) fragments of pheP and 4 fragments of pDSG were cloned by a self-assembled cloning method (BioTechniques 51:55-56 (July 2011)), to obtain a recombinant plasmid, which was named pDSG-pheP (Glu 272 Lys).

1-2 Production of L-tryptophan or L-phenylalanine producing Strain into which phenylalanine H+ symporter PheP variant pheP (Glu 272 Lys) is introduced

Coli (ESCHERICHIA COLI) KCCM13013P and KCCM10016 were used as parent strains for the production of L-tryptophan-producing strains and L-phenylalanine-producing strains, respectively.

PDS9 plasmid was transformed 1 time into each parent strain, and after culturing in LB-Km (LB liquid medium (Luria Bertani broth) containing 25g/L and kanamycin (kanamycin) containing 50 mg/L) solid medium, colonies resistant to kanamycin (kanamycin) were selected. The pDSG-pheP (Glu 272 Lys) plasmid was transformed 2 times into the selected transformant, which was cultured in LB-Amp & Km (LB liquid medium (Luria Bertani broth) containing 25g/L, 100mg/L ampicillin (ampicillin) and 50mg/L kanamycin (kanamycin)) solid medium, colonies resistant to ampicillin (ampicillin) and kanamycin (kanamycin) were selected, and fragments were obtained by colony PCR using the primer pair of primer 17 and primer 18. Here, TAKARA PRIMESTAR Max DNApolymerase, PCR was used as the polymerase, and the denaturation at 95℃for 10 seconds, annealing at 57℃for 10 seconds, and polymerization at 72℃for 15 seconds were repeated 30 times. The obtained fragment was sequenced by using the primer pair of the primer 17 and the primer 18 to confirm the sequence.

The 2 transformants were subjected to 7 subcultures in LB liquid medium, and colonies were selected in LB solid medium. Each colony was picked (picking) and cultured in LB, LB-Amp and LB-Km solid medium. Colonies that grew in LB solid medium and did not grow in LB-Amp and LB-Km solid medium were selected. The strains selected as described above were designated as KCCM13013P_ pheP (Glu 272 Lys) and KCCM10016_ pheP (Glu 272 Lys), respectively.

The primer sequences used in example 1 are shown in Table 1 below.

[ Table 1]

Primer name	Sequence number	Primer sequence (5 '-3')
			Primer 1	SEQ ID NO：5	caattttattatagtaattgactattatac
Primer 2	SEQ ID NO：6	TGAAATCCAAcaattttattatagtaattgactattatac
			Primer 3	SEQ ID NO：7	TTGGATTTCACTTTCACCCAgttttagagctagaaatagc
Primer 4	SEQ ID NO：8	CTTTCACCCAgttttagagctagaaatagc
			Primer 5	SEQ ID NO：9	gagcctgtcggcctacctgct
Primer 6	SEQ ID NO：10	cggccggcatgagcctgtcg
			Primer 7	SEQ ID NO：11	atgccggccgCGCTTATATGGCGAAACCGA
Primer 8	SEQ ID NO：12	CGCTTATATGGCGAAACCGAGTTCT
			Primer 9	SEQ ID NO：13	TAGAGCGCCAGTAAAACCACCAGTG
Primer 10	SEQ ID NO：14	CACCCACGGATAGAGCGCCAGTAAA
			Primer 11	SEQ ID NO：15	TCCGTGGGTGGAAGTGAAATCCAACAGTAG
Primer 12	SEQ ID NO：16	GAAGTGAAATCCAACAGTAGCCCGT
			Primer 13	SEQ ID NO：17	GATCATAATCCAGTTCAACAGCAGC
Primer 14	SEQ ID NO：18	GCGCCAGACAGATCATAATCCAGTT
			Primer 15	SEQ ID NO：19	TGTCTGGCGCgagctcctgaaaatctcgataac
Primer 16	SEQ ID NO：20	gagctcctgaaaatctcgataac
			Primer 17	SEQ ID NO：21	ATATGCAGTACTGGTTCCCG
Primer 18	SEQ ID NO：22	AACTGTGTTTCACGCCCCTG

Experimental example 1. Phenylalanine was introduced: evaluation of L-aromatic amino acid production ability of H+ symporter PheP variant strain

The parental strains (KCCM 13013P and KCCM 10016) and the introduced phenylalanine were compared: l-tryptophan or L-phenylalanine producing ability of strains (KCCM 13013P_ pheP (Glu 272 Lys) and KCCM10016_ pheP (Glu 272 Lys)) of H+ symporter PheP variant.

Each strain (parent strain or variant strain) was inoculated 1% by volume and shake-cultured at 37℃for 72 hours at 200rpm in a flask containing 10ml of the tryptophan-producing medium or phenylalanine-producing medium of Table 2 below. After the completion of the culture, the concentration of L-tryptophan or L-phenylalanine in the medium was measured by HPLC (Agilent), and the results are shown in tables 3 and 4 below, respectively.

[ Table 2]

[ Table 3]

[ Table 4]

As shown in tables 3 and 4 above, it was confirmed that the variant strains KCCM 13013P-pheP (Glu 272 Lys) and KCCM 10016-pheP (Glu 272 Lys) into which phenylalanine H+ symporter PheP variant was introduced had been substituted with lysine by the 272 th glutamic acid in the amino acid sequence of phenylalanine H+ symporter PheP, thereby increasing the L-tryptophan and L-phenylalanine production amounts by 11.3% and 8.3%, respectively, compared with the parent strain.

The present invention has been studied so far, focusing on its preferred embodiments. Those skilled in the art to which the invention pertains will appreciate that the invention may be practiced in modified forms without deviating from the essential characteristics of the invention. Accordingly, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is indicated in the claims rather than in the foregoing description and all differences within the scope equivalent thereto are intended to be included in the present invention.

[ PREPARATION METHOD ]

Preservation agency name: korean culture collection for classical cultures (KCTC)

Deposit number: KCTC14419BP

The preservation date: 20201228

Preservation agency name: korean microorganism collection center (KCCM)

Deposit number: KCCM13013P

The preservation date: 20210622

Preservation agency name: korean microorganism collection center (KCCM)

Deposit number: KCCM10016

The preservation date: 19921024.

Claims

1. A phenylalanine H+ symporter PheP variant composed of the amino acid sequence of SEQ ID NO. 4 is obtained by replacing Glu which is 272 rd glutamic acid in the amino acid sequence of SEQ ID NO. 2 with Lys which is lysine.

2. A polynucleotide encoding the variant of claim 1.

3. A transformant comprising the variant of claim 1 or the polynucleotide of claim 2.

4. The transformant according to claim 3, wherein the transformant is an Escherichia (ES CHERICHIA) genus strain or a Corynebacterium (Corynebacterium) genus strain.

5. The transformant according to claim 3, wherein the transformant has L-aromatic amino acid productivity.

6. A method for producing an L-aromatic amino acid, comprising the steps of:

A step of culturing the transformant according to claim 3 in a medium; and

Recovering the L-aromatic amino acid from the transformant or a medium in which the transformant is cultured.

7. The method according to claim 6, wherein the L-aromatic amino acid is 1 or more selected from the group consisting of L-tryptophan, L-phenylalanine and L-tyrosine.