CN117925557A

CN117925557A - Novel variant of pyruvate kinase 2 and method for producing L-aromatic amino acid using same

Info

Publication number: CN117925557A
Application number: CN202311381893.4A
Authority: CN
Inventors: 金贤英; 乔伊·车; 曹永一
Original assignee: Daesang Corp
Current assignee: Daesang Corp
Priority date: 2022-10-24
Filing date: 2023-10-24
Publication date: 2024-04-26

Abstract

The present invention relates to a novel variant of pyruvate kinase 2 in which protein activity is changed by substitution of at least one amino acid in an amino acid sequence constituting pyruvate kinase 2, and a method for producing an L-aromatic amino acid using the same, whereby a recombinant microorganism containing the variant can efficiently produce L-tryptophan, L-phenylalanine or L-tyrosine.

Description

Novel variant of pyruvate kinase 2 and method for producing L-aromatic amino acid using same

Technical Field

The present invention relates to a novel variant of pyruvate kinase 2 and a method for producing an L-aromatic amino acid using the same.

Background

Amino acids are classified into hydrophobic, hydrophilic, basic and acidic amino acids according to the nature of side chains, and amino acids having benzene rings therein are called aromatic amino acids. Among the aromatic amino acids, phenylalanine, tyrosine and tryptophan are essential amino acids that cannot be synthesized in living bodies, and belong to the high value-added industry that forms a market of $3000 million each year worldwide.

The production of aromatic amino acids can be carried out using wild-type strains obtained in a natural state or variant strains modified in such a manner as to enhance the amino acid productivity. In recent years, in order to improve the production efficiency of aromatic amino acids, genetic recombination techniques have been applied to microorganisms such as E.coli and coryneform bacteria which are used in many cases for producing useful substances such as L-amino acids, and various recombinant strains or variants having excellent L-aromatic amino acid productivity have been developed, and a method for producing L-aromatic amino acids using the same. In particular, the following attempts were made: the production of the corresponding amino acid is increased by targeting genes such as enzymes, transcription factors, transport proteins, etc. involved in the biosynthesis pathway of the L-aromatic amino acid, or inducing mutation in promoters regulating their expression. However, since the types of proteins such as enzymes, transcription factors, transport proteins, etc., which are directly or indirectly involved in the production of L-aromatic amino acids, are several tens of kinds, a great deal of research is actually required as to whether the L-aromatic amino acid production capacity is increased or not according to the activity change of such proteins.

Prior art literature

Patent literature

Korean patent No. 10-1830002

Disclosure of Invention

The object of the present invention is to provide novel pyruvate kinase 2 variants.

In addition, it is an object of the present invention to provide polynucleotides encoding the above variants.

In addition, it is an object of the present invention to provide a transformant comprising the above variant or polynucleotide.

The present invention also provides a method for producing an L-aromatic amino acid using the transformant.

In one embodiment of the present invention, there is provided a pyruvic acid kinase 2 (pyruvate kinase 2) variant comprising the amino acid sequence of SEQ ID NO.4, wherein glycine 15 (Gly) in the amino acid sequence of SEQ ID NO. 2 is replaced with aspartic acid (Asp).

As used herein, "pyruvate kinase 2" catalyzes the formation of pyruvate in the final step of the corresponding process, and the reaction is irreversible under physiological conditions. The pyruvate kinase 2 of the present invention may be a polypeptide encoded by the pykA gene and having pyruvate kinase 2 activity, but is not limited thereto.

The sequence information of the nucleic acid and protein of pyruvate kinase 2 can be obtained from a well-known sequence database (e.g., genBank, uniProt).

According to one embodiment of the present invention, the pyruvate kinase 2 may be encoded by the base sequence of SEQ ID NO.1, and may be constituted by the amino acid sequence of SEQ ID NO. 2.

The amino acid sequence of pyruvate kinase 2 or the base sequence encoding it according to the invention may comprise a base sequence or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity to the respective sequences. The term "homology" or "identity" as used herein refers to the percentage of identity (%) between two sequences when the base sequence or amino acid sequence to be used as a reference is aligned with any other base sequence or amino acid sequence so as to correspond to the maximum extent for analysis.

According to one embodiment of the present invention, the pyruvate kinase 2 or a gene encoding the same may be derived from wild-type Escherichia coli (ESCHERICHIA COLI).

As used herein, "variant" refers to a protein that differs from the original amino acid sequence of the protein due to variations in the base sequence of the gene encoding the protein. More specifically, a genetic sequence variation is a change in one or more bases or nucleotides in the sequence constituting a gene due to substitution (insertion), deletion (deletion), or the like, and therefore a translated polypeptide or protein as a protein variant has one or more amino acids in the N-terminal, C-terminal, and/or internal amino acid sequence conservatively substituted (conservative substitution) and/or altered (modification) so as to differ from the amino acid sequence before variation, but maintains functions (functions) or properties (properties). As used herein, "conservative substitutions" refer to the substitution of one amino acid for another that is structurally and/or chemically similar, with little or no effect on the activity of the protein or polypeptide. The amino acid is selected from alanine (Ala), isoleucine (Ile), valine (Val), leucine (Leu), methionine (Met), asparagine (Asn), cysteine (Cys), glutamine (Gln), serine (Ser), threonine (Thr), phenylalanine (Phe), tryptophan (Trp), tyrosine (Tyr), aspartic acid (Asp), glutamic acid (Glu), arginine (Arg), histidine (His), lysine (Lys), glycine (Gly) and proline (Pro).

In addition, variants include variants with more than one N-terminal leader sequence or a portion of the transmembrane domain (transmembrane domain) removed, or variants with a portion of the N-and/or C-terminal of the mature protein (protein) removed.

Such variants may have increased (enhanced) or unchanged or decreased (attenuated) ability compared to the protein prior to mutation. Herein, "adding or enhancing" includes the following cases: the activity of the protein itself is increased as compared with the protein before mutation; in the case where the overall intracellular enzyme activity level is high compared with that of the wild-type strain or the strain expressing the protein before mutation due to increased expression or increased translation of the gene encoding the protein, etc.; and combinations thereof. Furthermore, "reducing or weakening" includes the following: the activity of the protein itself is reduced as compared with the protein before mutation; the expression of a gene encoding a protein is inhibited, translation is inhibited, or the like, so that the overall intracellular enzymatic activity is lower than that of the wild-type strain or the strain expressing the protein before mutation; and combinations thereof. In the present invention, variants may be used in combination with variants, alterations, variant polypeptides, variant proteins, variants, and the like.

A pyruvate kinase 2 variant according to the invention may comprise an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity to the amino acid sequence of SEQ ID NO. 4.

Another aspect of the present invention provides a polynucleotide encoding the above pyruvate kinase 2 variant.

The "polynucleotide (polynucleotide)" used in the present invention is a polymer (polymer) of nucleotides in which nucleotide monomers (monomers) are linked in a chain form by covalent bonds, and is a DNA or RNA strand of a predetermined length or more, more specifically, a polynucleotide fragment encoding the variant.

According to one embodiment of the present invention, the polynucleotide comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO. 4, and may comprise, for example, the nucleotide sequence of SEQ ID NO. 3.

In another aspect, the invention provides a vector comprising a polynucleotide encoding a pyruvate kinase 2 variant as described above.

In addition, another embodiment of the present invention provides a transformant comprising the above-described pyruvate kinase 2 variant or polynucleotide.

The term "vector" as used herein refers to any type of nucleic acid sequence transport structure used as a means for delivering and expressing a target gene into a host cell. Unless otherwise indicated, such vectors may refer to the insertion of a supported nucleic acid sequence into a host cell gene for expression and/or expression separately. Such vectors include the necessary regulatory elements operably linked for expression of the gene insert, "operably linked (operably linked)" means that the gene of interest and its regulatory sequences are functionally bound to each other and linked in a manner that enables gene expression, "regulatory elements" include promoters for carrying out transcription, any operator sequences for regulating transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences that regulate termination of transcription and translation.

The vector used in the present invention is not particularly limited as long as it can replicate in a host cell, and any vector known in the art can be used. Examples of the vector include plasmids, cosmids, viruses, and phages in their natural or recombinant state. For example, as phage vectors or cosmid vectors, we15, M13, λmbl3, λmbl4, λ IXII, λ ASHII, λapii, λt10, λt11, charon4A, charon a, etc., and as plasmid vectors, pBR system, pUC system, pbluescript ii system, pGEM system, pTZ system, pCL system, pET system, etc., are available, but not limited thereto.

The above vectors may be representatively constructed as vectors for cloning or vectors for expression. The vector for expression may use a conventional vector used in the art for expressing a foreign gene or protein in a plant, animal or microorganism, and may be constructed by various methods well known in the art.

The "recombinant vector" used in the present invention may be constructed using a prokaryotic cell or a eukaryotic cell as a host, may replicate independently of the genome of the host cell, or may be sutured to the genome itself. The host cell can replicate the vector, and may include an origin of replication which is a specific base sequence for starting replication. For example, when the vector used is an expression vector and prokaryotic cells are used as a host, a strong promoter (e.g., plλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter) that allows transcription to proceed generally contains a ribosome binding site for translation initiation and transcription/translation termination sequences. When eukaryotic cells are used as hosts, the replication origins to be initiated in eukaryotic cells contained in the vector include, but are not limited to, f1 replication origins, SV40 replication origins, pMB1 replication origins, adenovirus replication origins, AAV replication origins, BBV replication origins, and the like. In addition, promoters derived from mammalian cell genomes (e.g., metallothionein promoters) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, tk promoter of HSV) may be utilized, and typically have polyadenylation sequences as transcription termination sequences.

The recombinant vector may include a selection marker for selecting transformants (host cells) transformed with the vector, and only cells expressing the selection marker may survive in the medium treated with the selection marker, thereby enabling selection of the transformed cells. The selection markers include, but are not limited to, ampicillin, kanamycin, streptomycin, and chloramphenicol, as typical examples.

By inserting the recombinant vector into a host cell, a transformant can be produced, which can be obtained by introducing the recombinant vector into an appropriate host cell. The host cell is a cell in which the above-described expression vector can be stably and continuously cloned or expressed, and any host cell known in the art can be used.

When a prokaryotic cell is transformed to produce a recombinant microorganism, a strain of Escherichia coli such as E.coli JM109、E.coli BL21、E.coli RR1、E.coli LE392、E.coli B、E.coli X 1776、E.coli W3110、E.coli XL1-Blue can be used as a host cell; a corynebacterium strain; bacillus strains such as bacillus subtilis and bacillus thuringiensis; various intestinal bacteria and strains such as Salmonella typhimurium, serratia marcescens and Pseudomonas species, etc., but are not limited thereto.

In the case of transforming eukaryotic cells for the production of recombinant microorganisms, yeasts (e.g., saccharomyces cerevisiae), insect cells, plant cells, and animal cells, for example, sp2/0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, hepG2, huh7, 3T3, RIN, MDCK cell lines, etc., can be used as host cells, but are not limited thereto.

The term "transformation" as used herein refers to a phenomenon in which a foreign DNA is introduced into a host cell to artificially cause a gene change, and the term "transformant (transformant)" refers to a host cell into which a foreign DNA is introduced and in which the expression of a target gene is stably maintained.

In the above transformation, an appropriate vector introduction technique is selected according to the host cell, so that the target gene or a recombinant vector comprising the same can be expressed in the host cell. For example, the vector introduction may be performed by electroporation (electroporation), thermal shock (heat-shock), calcium phosphate (CaPO ₄) precipitation, calcium chloride (CaCl ₂) precipitation, microinjection (microinjection), polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene may be included as long as it can be expressed in the host cell, and is not limited to insertion into the chromosome of the host cell or to being located extrachromosomally.

The above transformant includes a cell transfected, transformed or infected with the recombinant vector according to the present invention in an organism or in a test tube, and may be used as the same term as a recombinant host cell, a recombinant cell or a recombinant microorganism.

According to one embodiment of the present invention, the transformant may be an Escherichia strain or a Corynebacterium strain.

The strain of the genus Escherichia may be, but not limited to, escherichia coli (ESCHERICHIA COLI), escherichia ibutescens (ESCHERICHIA ALBERTII), escherichia blattae (ESCHERICHIA BLATTAE), escherichia fries (ESCHERICHIA FERGUSONII), escherichia hertz (ESCHERICHIA HERMANNII), or Escherichia wound (ESCHERICHIA VULNERIS).

The corynebacterium strain may be Corynebacterium glutamicum (Corynebacterium glutamicum), lactobacillus plantarum (Corynebacterium crudilactis), corynebacterium desert (Corynebacterium deserti), corynebacterium broom (Corynebacterium callunae), corynebacterium threonae (Corynebacterium suranareeae), corynebacterium oleae (Corynebacterium lubricantis), corynebacterium canal Sang Bangzhuang (Corynebacterium doosanense), corynebacterium hepaticum (Corynebacterium efficiens), corynebacterium Ubbelopsis (Corynebacterium uterequi), corynebacterium parvum (Corynebacterium stationis), corynebacterium parvum (Corynebacterium pacaense), corynebacterium mirabilis (Corynebacterium singulare), corynebacterium humicola (Corynebacterium humireducens), corynebacterium maritimum (Corynebacterium marinum), corynebacterium salt tolerance (Corynebacterium halotolerans), corynebacterium pterans (Corynebacterium spheniscorum), corynebacterium freudenreichii (Corynebacterium freiburgense), corynebacterium striatum (Corynebacterium striatum), corynebacterium canis (Corynebacterium canis), corynebacterium ammoniagenes (Corynebacterium ammoniagenes), corynebacterium renifolium (Corynebacterium renale), corynebacterium pollutes (Corynebacterium pollutisoli), corynebacterium hanensis (Corynebacterium imitans), corynebacterium reesei (Corynebacterium caspium), corynebacterium testiclae (Corynebacterium testudinoris), corynebacterium pseudolarium (Corynebacaterium pseudopelargi) or Corynebacterium flavum (Corynebacterium flavescens), but is not limited thereto.

The transformant of the present invention may be a strain comprising the above-mentioned pyruvate kinase 2 variant or a polynucleotide encoding the same, or a vector comprising the same; a strain expressing the above-described pyruvate kinase 2 variant or polynucleotide; or a strain having an activity against the pyruvate kinase 2 variant, but is not limited thereto.

The transformant of the present invention may include other protein variants or genetic variations in addition to the pyruvate kinase 2 variants described above.

According to one embodiment of the present invention, the transformant may have L-aromatic amino acid productivity.

The transformant may naturally have L-aromatic amino acid productivity or may be artificially provided with L-aromatic amino acid productivity.

According to one embodiment of the present invention, the transformant has an improved L-aromatic amino acid productivity because the activity of pyruvate kinase 2 is altered.

As used herein, "increased productivity" means that the productivity of L-aromatic amino acids is increased as compared to the parent strain. The parent strain refers to a wild-type strain or a mutant strain to be mutated, and includes a subject to be mutated directly or a subject to be transformed by a recombinant vector or the like. In the present invention, the parent strain may be a wild-type escherichia strain or a corynebacterium strain or an escherichia strain or a corynebacterium strain mutated from a wild-type.

The transformant according to the present invention shows an increased L-aromatic amino acid productivity as compared with a strain (parent strain) comprising a protein before mutation by introducing a pyruvate kinase 2 variant, whereby the activity of pyruvate kinase 2 is altered. More specifically, the above transformant may increase the L-aromatic amino acid production by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% as compared with the parent strain, or may increase it by 1.1-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold or 10-fold, but is not limited thereto. As an example, a transformant comprising the above-described pyruvate kinase 2 variant may have an increase in L-aromatic productivity of 5% or more, specifically, 5 to 50% (preferably 10 to 40%) as compared with the parent strain.

Another aspect of the present invention provides a method for producing an L-aromatic amino acid, comprising the steps of: a step of culturing the transformant in a medium; and recovering the L-aromatic amino acid from the transformant or a medium in which the transformant is cultured.

The above-mentioned culture may be carried out according to a suitable medium and culture conditions known in the art, and the medium and culture conditions may be easily adjusted and used by those skilled in the art. Specifically, the medium may be a liquid medium, but is not limited thereto. The cultivation method may include, for example, batch cultivation (batch cultivation), continuous cultivation (continuous culture), fed-batch cultivation (fed-batch cultivation), or a combination thereof, but is not limited thereto.

According to one embodiment of the invention, the above-mentioned culture medium must meet the requirements of the particular strain in a suitable manner, and can be suitably deformed by a person skilled in the art. For the culture medium of the strain of Escherichia or the strain of Corynebacterium, reference may be made to well-known document (Manual of Methods for General Bacteriology.American Society for Bacteriology.Washington D.C.,USA,1981),, but is not limited thereto.

According to one embodiment of the present invention, the medium may contain various carbon sources, nitrogen sources and trace element components. As the carbon source which can be used, there are included sugars such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose and the like and carbohydrates; oil and fat such as soybean oil, sunflower seed oil, castor seed oil, coconut oil and the like; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerin and ethanol; organic acids such as acetic acid. These substances may be used alone or in the form of a mixture, but are not limited thereto. As nitrogen sources that can be used, peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds, for example, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate can be included. The nitrogen source may also be used alone or in the form of a mixture, but is not limited thereto. As the supply source of phosphorus that can be used, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts may be included, but are not limited thereto. The medium may contain a metal salt such as magnesium sulfate or iron sulfate required for growth, but is not limited thereto. In addition, essential growth substances such as amino acids and vitamins may be contained. In addition, precursors suitable for the culture medium may be used. The above-mentioned medium or individual components may be added to the culture broth in batches or continuously by an appropriate means during the culture, but are not limited thereto.

According to an embodiment of the present invention, during the cultivation, a compound such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be added to the microorganism culture solution in an appropriate manner to adjust the pH of the culture solution. In addition, during the culture, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble generation. Further, in order to maintain the aerobic state of the culture, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture. The temperature of the culture solution may be generally 20℃to 45℃and, for example, may be 25℃to 40 ℃. The incubation time may be continued until the desired throughput of the useful substance is obtained, for example, may be 10 to 160 hours.

According to one embodiment of the present invention, in the above-mentioned step of recovering an L-aromatic amino acid from a transformant to be cultured or a medium in which the transformant is cultured, the produced L-aromatic amino acid may be collected or recovered from the medium according to a culture method and by using a suitable method known in the art. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion), and the like may be used, but are not limited thereto.

According to one embodiment of the present invention, in the step of recovering an L-aromatic amino acid, the medium may be centrifuged at a low speed to remove biomass, and the obtained supernatant may be separated by ion exchange chromatography.

According to one embodiment of the present invention, the step of recovering the L-aromatic amino acid may include a step of purifying the L-aromatic amino acid.

According to one embodiment of the present invention, the L-aromatic amino acid may be 1 or more selected from the group consisting of L-tryptophan, L-phenylalanine and L-tyrosine.

The variant of pyruvate kinase 2 according to the present invention changes protein activity by substitution of one or more amino acids constituting the amino acid sequence of pyruvate kinase 2, so that a recombinant microorganism comprising the same can efficiently produce L-tryptophan, L-phenylalanine or L-tyrosine.

Drawings

FIG. 1 shows the structure of a plasmid pDSG according to an embodiment of the present invention.

FIG. 2 shows the structure of plasmid pDS9 according to an embodiment of the present invention.

Detailed Description

The present invention will be described in more detail below. However, the description is merely illustrative for the purpose of facilitating understanding of the present invention, and the scope of the present invention is not limited to such illustrative description.

Example 1 preparation of strains expressing pyruvate kinase 2 variants

In order to confirm the effect of the variant (SEQ ID NO: 4) in which glycine 15 (Gly) in the amino acid sequence (SEQ ID NO: 2) of pyruvate kinase 2 was replaced with aspartic acid (Asp) on the production of L-aromatic amino acids, a vector expressing the above-mentioned pyruvate kinase 2 variant and a strain into which the above-mentioned vector was introduced were produced. For gene insertion of the pyruvate kinase 2 variant in the strain, plasmid pDSG and pDS9 were used and made as follows.

The above plasmid pDSG (SEQ ID NO: 23) has an origin of replication which functions only in E.coli, and has an ampicillin (ampicillin) resistance gene and a guide RNA (gRNA) expression mechanism. The above plasmid pDS9 (SEQ ID NO: 24) has an origin of replication which functions only in E.coli, has a kanamycin (kanamycin) resistance gene, a lambda Red gene (exo, bet and gam) expression system and a CAS9 expression mechanism derived from Streptococcus pyogenes (Streptococcus pyogenes).

1-1 Production of vector pDSG-pykA (Gly 15 Asp) for transformation

The upstream (upstream) fragment of pykA of amino acid variation No. 15 in the amino acid sequence of pyruvate kinase 2 was obtained by PCR using escherichia coli (ESCHERICHIA COLI) MG1655 (KCTC 14419 BP) gDNA as a template and primer pairs of primer 7 and primer 9 and primer 8 and primer 10. Then, a downstream (downstream) fragment of pykA having an amino acid sequence 15 of pyruvate kinase 2 was obtained by performing PCR using a primer set of primer 11 and primer 13 and a primer set of primer 12 and primer 14 with escherichia coli MG1655 (KCTC 14419 BP) gDNA as a template. The upstream (upstream) and downstream (downstream) fragments contain a codon sequence that translates Gly 15 in the amino acid sequence of pyruvate kinase 2 to Asp. Here, TAKARA PRIMESTAR Max DNA polymerase was used as a polymerase, and PCR was performed by repeating denaturation at 95℃for 10 seconds, annealing at 57℃for 15 seconds, and polymerization at 72℃for 10 seconds for 30 times.

PCR was performed using the plasmid pDSG as a template and the primer pair of primer 3 and primer 5, the primer pair of primer 4 and primer 6, the primer pair of primer 15 and primer 1, and the primer pair of primer 16 and primer 2, thereby obtaining 4 pDSG gene fragments. Each gene fragment contained a gRNA sequence targeted to Gly of pykA. The gRNA selects the NGG pre 20mer of the sequence to be mutated. Here, TAKARA PRIMESTAR Max DNA polymerase was used as a polymerase, and PCR was performed by repeating denaturation at 95℃for 10 seconds, annealing at 57℃for 15 seconds, and polymerization at 72℃for 15 seconds 30 times.

Then, the obtained upstream (upstream) and downstream (downstream) fragments of pykA and 4 pDSG fragments were cloned by a self-assembled cloning method (BioTechniques 51:55-56 (July 2011)), thereby obtaining a recombinant plasmid, which was named pDSG-pykA (Gly 15 Asp).

1-2 Preparation of L-tryptophan or L-phenylalanine producing Strain into which pyruvic acid kinase 2 variant pykA (Gly 15 Asp) was introduced

Coli (ESCHERICHIA COLI) KCCM13013P and KCCM10016 were used as parent strains for the production of L-tryptophan-producing strains and L-phenylalanine-producing strains, respectively.

PDS9 plasmid was transformed 1 time into each parent strain, and after culturing in LB-Km (LB liquid medium (Luria Bertani broth) containing 25g/L and kanamycin (kanamycin) containing 50 mg/L) solid medium, colonies resistant to kanamycin (kanamycin) were selected. The pDSG-pykA (Gly 15 Asp) plasmid was transformed 2 times into the selected transformant, cultured in LB-Amp & Km (LB liquid medium (Luria Bertani broth) containing 25g/L, 100mg/L ampicillin (ampicillin) and 50mg/L kanamycin (kanamycin)) solid medium, colonies resistant to ampicillin (ampicillin) and kanamycin (kanamycin) were selected, and fragments were obtained by colony PCR using the primer pair of primer 17 and primer 18. Here, TAKARA PRIMESTAR Max DNA polymerase was used as a polymerase, and PCR was performed by repeating denaturation at 95℃for 10 seconds, annealing at 57℃for 10 seconds, and polymerization at 72℃for 15 seconds for 30 times. The obtained fragment was sequenced by using the primer pair of the primer 17 and the primer 18 to confirm the sequence.

The 2 transformants were subjected to 7 subcultures in LB liquid medium, and colonies were selected in LB solid medium. Each colony was picked (picking) and cultured in LB, LB-Amp and LB-Km solid medium. Colonies that grew in LB solid medium and did not grow in LB-Amp and LB-Km solid medium were selected. The strains screened as described above were designated KCCM13013P_pykA (Gly 15 Asp) and KCCM10016_pykA (G1 y15 Asp), respectively.

The primer sequences used in example 1 are shown in Table 1 below.

[ Table 1]

Primer name	Sequence number	Primer sequence (5 '-3')
			Primer 1	SEQ ID NO：5	caattttattatagtaattgactattatac
Primer 2	SEQ ID NO：6	agcaacagatcaattttattatagtaattgactattatac
			Primer 3	SEQ ID NO：7	atctgttgctgggcctaacggttttagagctagaaatagc
Primer 4	SEQ ID NO：8	gggcctaacggttttagagctagaaatagc
			Primer 5	SEQ ID NO：9	gagcctgtcggcctacctgct
Primer 6	SEQ ID NO：10	cggccggcatgagcctgtcg
			Primer 7	SEQ ID NO：11	atgccggccgttgtagcgacggagacgtgg
Primer 8	SEQ ID NO：12	ttgtagcgacggagacgtgg
			Primer 9	SEQ ID NO：13	taacgatttttgttctgcga
Primer 10	SEQ ID NO：14	taacgatttttgttctgcgaagccttctgg
			Primer 11	SEQ ID No：15	ccacgttagacccagcaacagatcgcgata
Primer 12	SEQ ID NO：16	acccagcaacagatcgcgat
			Primer 13	SEQ ID NO：17	aacgccgcagtcttaatgtc
Primer 14	SEQ ID NO：18	tacgccaatcaacgccgcag
			Primer 15	SEQ ID NO：19	gattggcgtagagctcctgaaaatctcgataac
Primer 16	SEQ ID NO：20	gagctcctgaaaatctcgataac
			Primer 17	SEQ ID NO：21	aatgttccggtggtgtactc
Primer 18	SEQ ID NO：22	ttcgcatcacatcctgcatc

Experimental example 1 evaluation of L-aromatic amino acid production ability of Strain introduced with pyruvate kinase 2 variant

The L-tryptophan or L-phenylalanine producing ability of the parent strain (KCCM 13013P and KCCM 10016) and the strain (KCCM 13013P_pykA (G1 y15 Asp) and KCCM10016_pykA (G1 y15 Asp)) into which the pyruvate kinase 2 variant was introduced were compared.

Each strain (parent strain or variant strain) was inoculated 1% by volume and shake-cultured at 37℃for 72 hours at 200rpm in a flask containing 10ml of the tryptophan-producing medium or phenylalanine-producing medium of Table 2 below. After the completion of the culture, the concentration of L-tryptophan or L-phenylalanine in the medium was measured by HPLC (Agilent), and the results are shown in tables 3 and 4 below, respectively.

[ Table 2]

[ Table 3]

[ Table 4]

As shown in tables 3 and 4 above, it was confirmed that the variant strains KC CM13013P_pykA (Gly 15 Asp) and KCCM10016_pykA (Gly 15 Asp) into which the pyruvate kinase 2 variant was introduced had been substituted with aspartic acid due to glycine No. 15 in the amino acid sequence of pyruvate kinase 2, thereby improving the L-tryptophan and L-phenylalanine production amounts by 17.2% and 25.2%, respectively, as compared with the parent strain.

The present invention has been studied so far, focusing on its preferred embodiments. Those skilled in the art to which the invention pertains will appreciate that the invention may be practiced in modified forms without deviating from the essential characteristics of the invention. Accordingly, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is indicated in the claims rather than in the foregoing description and all differences within the scope equivalent thereto are intended to be included in the present invention.

[ PREPARATION METHOD ]

Preservation agency name: korean culture collection for classical cultures (KCTC)

Deposit number: KCTC14419BP

The preservation date: 20201228

Preservation agency name: korean microorganism collection center (KCCM)

Deposit number: KCCM13013P

The preservation date: 20210622

Preservation agency name: korean microorganism collection center (KCCM)

Deposit number: KCCM10016

The preservation date: 19921024.

Claims

1. A pyruvate kinase 2 variant comprising the amino acid sequence of SEQ ID No. 4 is obtained by substituting glycine 15 (Gly) in the amino acid sequence of SEQ ID No. 2 with aspartic acid (Asp).

2. A polynucleotide encoding the variant of claim 1.

3. A transformant comprising the variant of claim 1 or the polynucleotide of claim 2.

4. A transformant according to claim 3, wherein the transformant is an Escherichia strain or a Corynebacterium strain.

5. The transformant according to claim 3, wherein the transformant has L-aromatic amino acid productivity.

6. A method for producing an L-aromatic amino acid, comprising the steps of:

a step of culturing the transformant according to claim 3 in a medium; and

Recovering the L-aromatic amino acid from the transformant or a medium in which the transformant is cultured.

7. The method according to claim 6, wherein the L-aromatic amino acid is 1 or more selected from the group consisting of L-tryptophan, L-phenylalanine and L-tyrosine.