CN118109446A

CN118109446A - Aldohexose-2-epimerase mutants and uses thereof

Info

Publication number: CN118109446A
Application number: CN202410323978.5A
Authority: CN
Inventors: 贾黾泽; 东刚; 高润香; 蔡侠; 姚宏伟
Original assignee: Chengzhi Life Sci & Tech Co ltd; Beijing Chengzhi High Tech Biotechnology Co ltd
Current assignee: Chengzhi Life Sci & Tech Co ltd; Beijing Chengzhi High Tech Biotechnology Co ltd
Priority date: 2024-03-20
Filing date: 2024-03-20
Publication date: 2024-05-31

Abstract

The application provides a hexanal sugar-2-epimerase mutant and application thereof, wherein the hexanal sugar-2-epimerase mutant comprises one or more than two mutations based on a reference sequence, the amino acid sequence of the reference sequence is shown as SEQ ID NO. 1, hexanal sugar can be converted, for example, D-glucose can be converted into D-mannose or D-mannose can be converted into D-glucose, and the specific enzyme activity is higher, and compared with a wild type, the specific enzyme activity of the hexanal sugar-2-epimerase mutant can be improved by about 2.2 times.

Description

Aldohexose-2-epimerase mutants and uses thereof

Technical Field

The application relates to the technical field of enzyme engineering, in particular to a aldohexose-2-epimerase mutant and application thereof.

Background

The functional sugar is used as a sucrose substitute, and has wide prospect in the fields of food, pharmacy, health care and the like due to the unique physiological function. D-mannose is one of functional sugar, has prebiotic function, and can enhance wound healing and avoid bacterial infection. D-mannose can be directly combined with pili of escherichia coli, enterococcus faecalis and staphylococcus causing urinary tract infection to fall off from the urethral wall, so that the recurrence probability of urinary tract infection is effectively reduced.

At present, the preparation of D-mannose mainly comprises a chemical synthesis method and a biological enzyme method. The chemical synthesis method has higher production cost, a large amount of acid waste liquid is easy to generate in the production process to pollute the environment, and the reaction byproducts make the separation and preparation of the high-purity D-mannose difficult. The biological enzyme method has mild reaction condition, less byproducts, easy separation and purification, no environmental pollution and low cost. Therefore, the use of the bioenzyme method for preparing D-mannose has become a future research trend.

In particular, for the bioenzyme method, mannose isomerase is generally used for acting on fructose, aldose-ketose isomerase (Aldose-ketose isomerase) is used for acting on glucose or fructose, and cellobiose-2-epimerase (Cellobiose-epimerase) is used for acting on glucose through side reaction to prepare mannose, but fructose can be used as a substrate residue or a byproduct to bring adverse effects to subsequent mannose separation and purification. Therefore, the bioenzyme method for preparing the D-mannose with low cost and high efficiency is still to be further developed.

Disclosure of Invention

Aiming at the technical problems in the prior art, the application provides a aldohexose-2-epimerase mutant and application thereof, and the aldohexose-2-epimerase mutant provided by the application can convert aldohexose, for example, D-glucose can be converted into D-mannose or D-mannose can be converted into D-glucose.

The specific technical scheme of the application is as follows:

1. A aldohexose-2-epimerase mutant, wherein the aldohexose-2-epimerase mutant comprises one or more than two mutations based on a reference sequence having an amino acid sequence shown in SEQ ID No. 1.

2. The aldohexose-2-epimerase mutant according to item 1, wherein the amino acid sequence of the mutant comprises an amino acid mutation corresponding to at least one of positions G354 and T355 of SEQ ID No. 1, preferably comprises an amino acid mutation corresponding to positions G354 and T355 of SEQ ID No. 1.

3. A aldohexose-2-epimerase mutant comprising the amino acid sequence of any one of SEQ ID NOs 2 to 4 or the amino acid sequence of any one of SEQ ID NOs 2 to 4.

4. The aldohexose-2-epimerase mutant according to any one of claims 1 to 3, wherein the aldohexose is glucose or mannose.

5. A nucleic acid molecule encoding the aldohexose-2-epimerase mutant according to any one of claims 1 to 4.

6. The nucleic acid molecule of item 5, wherein the nucleic acid molecule comprises the sequence of SEQ ID NO:5-7 or a sequence as set forth in any one of SEQ ID NOs: 5-7.

7. An expression vector comprising the nucleic acid molecule of claim 5 or 6.

8. The expression vector according to item 7, wherein the expression vector is a plasmid, cosmid, phage or viral vector, preferably a plasmid.

9. A host cell comprising the expression vector of claim 7 or 8;

preferably, the host cell is a eukaryotic cell, a prokaryotic cell or a bacterial cell, preferably a prokaryotic cell, further preferably E.coli.

10. Use of the aldohexose-2-epimerase mutant according to any one of claims 1 to 4 in aldohexose conversion.

11. A method for converting aldohexose comprising converting aldohexose using the aldohexose-2-epimerase mutant of any one of claims 1 to 4 to catalyze aldohexose reaction.

12. The process according to item 11, wherein the temperature of the reaction is 20-55 ℃, preferably 30-45 ℃; and/or

The pH value of the reaction is 6.5-10, preferably 7.5-8.5; and/or

The reaction time is 0.5 to 10 hours, preferably 0.5 to 6 hours.

ADVANTAGEOUS EFFECTS OF INVENTION

The hexanal sugar-2-epimerase mutant disclosed by the application can convert hexanal sugar, for example, D-glucose can be converted into D-mannose or D-mannose can be converted into D-glucose, and the D-epimerase mutant has high specificity and good stability, so that relatively cheap raw material D-glucose can be converted into D-mannose, the production cost of D-mannose is obviously reduced, meanwhile, the green production of emission reduction and consumption reduction is realized, compared with a wild type, the specific enzyme activity of converting D-glucose into D-mannose is improved by about 2.2 times, and the conversion rate of converting D-glucose into D-mannose is improved by about 3.6 times under the same condition, so that 22.6% is achieved.

Drawings

FIG. 1 is a schematic representation of the conversion of glucose to mannose using the aldohexose-2-epimerase wild-type and mutants.

FIG. 2 is a graph showing the change in glucose conversion with time of reaction when glucose was converted to mannose using the aldohexose-2-epimerase mutant.

Detailed Description

The application is described in detail below in connection with the embodiments described. While specific embodiments of the application are shown, it should be understood that the application may be embodied in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the application to those skilled in the art.

It should be noted that certain terms are used throughout the description and claims to refer to particular components. Those of skill in the art will understand that a person may refer to the same component by different names. The specification and claims do not identify differences in terms of components, but rather differences in terms of the functionality of the components. As referred to throughout the specification and claims, the terms "include" or "comprising" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description hereinafter sets forth a preferred embodiment for practicing the application, but is not intended to limit the scope of the application, as the description proceeds with reference to the general principles of the description. The scope of the application is defined by the appended claims.

Definition of the definition

As used herein, the term "epimerase" refers to an enzyme that catalyzes a conformational change of one of the asymmetric carbon atoms in a monosaccharide molecule (containing 2 or more asymmetric carbon atoms), in the present application, the term "epimerase" refers to an enzyme that isomerizes aldohexose, in the present application, glucose or mannose, and the term "epimerase" according to the present application can convert glucose to mannose or mannose to glucose.

As used herein, the terms "homology", "identity" and "similarity" refer to sequence similarity between 2 nucleic acid molecules. The positions in each sequence can be compared to determine "homology", "identity" or "similarity", and the sequences can be aligned for comparison purposes. When an equivalent position in the compared sequences is occupied by the same base, the molecules are identical at that position; when an equivalent site is occupied by the same or a similar amino acid (e.g., similar in steric or charged properties) residue, the molecule may be said to be homologous (similar) at that position. Expression of homology/similarity or percent identity refers to a function of the number of identical or similar amino acids at positions shared by the compared sequences. "unrelated" or "non-homologous" sequences share less than 40% identity, preferably less than 25% identity, with the sequences of the present application. The absence of residues (amino acids or nucleic acids) or the presence of redundant residues also reduces identity and homology/similarity when comparing 2 sequences. In specific embodiments, for two or more sequences or subsequences, as determined using BLAST or BLAST 2.0 sequence comparison algorithms having default parameters described below, or as determined by manual alignment and visual inspection provided on-line, e.g., by the national center for Biotechnology information (National Center for Biotechnology Information (NCBI)), when compared and aligned for maximum correspondence over a comparison window or designated region, if their sequences are about 60% identical over the designated region, or about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, may be considered substantially or significantly homologous, similar or identical. The definition also relates to or can be used to test the complement of a sequence. Thus, for example, if a nucleotide sequence can be predicted to occur naturally in a DNA duplex, or can occur naturally in the form of one or both of the complementary strands, the nucleotide sequence that is complementary to a specified target sequence or variant thereof is itself considered "similar" to the target sequence, and when reference is made to a "similar" nucleic acid sequence, includes single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences capable of encoding the same or similar polypeptide products, and any permissible variants of any of the foregoing, to the extent permitted by the context herein. The circumstances in which similarity must be limited to analysis of a single nucleic acid strand sequence may include, for example, detection and quantification of expression of a particular RNA sequence or coding sequence in a cell. The definition also includes sequences with deletions and/or additions, as well as sequences with substitutions. In embodiments, identity or similarity may be over a region of at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23, 24, 25 or more nucleotides in length, or over a region of more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or more than about 100 nucleotides in length.

As used herein, the term "nucleotide" refers to naturally occurring nucleotides, as well as synthetic nucleotide analogs that are recognized by cellular enzymes.

As used herein, the term "expression vector" refers to any naturally or artificially constructed expression vector comprising a nucleic acid molecule, wherein the nucleic acid molecule is catalyzed by a cellular transcriptase and/or a translator. Exemplary expression vectors include: plasmids, viruses (including phages), cosmids, artificial chromosomes or transposons, and the like. In some embodiments, the expression vector is a plasmid.

As used herein, the term "host cell" refers to any biological cell that can be cultured in a medium and used to express a recombinant gene. These host cells may be eukaryotic or prokaryotic cells, may be microbial such as bacterial cells, or may be cells derived from a cell line (e.g., a mammalian immortal cell line), etc. In some embodiments, the host cell is a prokaryotic cell, such as e.coli.

As used herein, the term "recombinant" refers to a nucleic acid molecule or polypeptide that is located in a non-naturally occurring environment and is prepared by human intervention.

Aldohexose-2-epimerase mutants

The application provides a aldohexose-2-epimerase mutant, wherein the aldohexose-2-epimerase mutant comprises one or more than two mutations based on a reference sequence, and the amino acid sequence of the reference sequence is shown as SEQ ID NO. 1.

The sequence of SEQ ID NO. 1 is as follows:

MDRFARENLTEWKRILAYWEKFSPDYQRGGFHGQVNYDNQPVLDASRSIILISRILWTFSLAYRHFHRRRYLVLADRAYHYLYNHFRDTKNGGVYWSVTAAGVPLETRKQLYGHAFAIYGLSEYYAASKFKPALDFAQELFQTVDKHGYDAEKGGYFEAFGPSWETVDDLILSKMPWNKSQNTHLHIIEAFTNLYRVWPDALLKKRVVHLTDAFMEKLVSPETYRLRLFFDRDWQPKDETISYGHDIEASWLLWETAEVLNDHERSQKVKQLCIKMAEAACTGLGEDGALDYEFDPAANHRNHERSWWVLAEQMVGFYNAYELTGESHYKDKSLKSWEFIKKYVMDTQKGDWFGTVKPDLTPVRNAKVSFWKCPYHNSRACYEIVRRLEK

The sequence is a protein encoded by Runella slithyformis source gene Runsl _4586, designated RsAE (Runella slithyformis aldohexose 2-epimerase), which is categorized in the database as the N-acylglucosamine 2-EPIMERASE (AGE) protein family.

In some embodiments, the amino acid sequence of the mutant comprises an amino acid mutation corresponding to at least one of the positions G354 and T355 of SEQ ID NO. 1, preferably comprises an amino acid mutation corresponding to the positions G354 and T355 of SEQ ID NO. 1.

In the present application, for the above-mentioned sites, counting from the N-terminus, for example, for G354, it means that the 354 th amino acid from the N-terminus of SEQ ID NO. 1 is subjected to an amino acid mutation.

Corresponding to what is commonly understood by those of ordinary skill in the art. Specifically, "corresponding to" means that two sequences are aligned by homology or sequence identity, and that one sequence corresponds to a specified position in the other sequence.

In the present application, glycine G at position 354 may be mutated to glutamine Q or threonine T at position 355 may be mutated to glutamic acid E or glycine G at position 354 may be mutated to glutamine Q and threonine T at position 355 may be mutated to glutamic acid E; preferably glycine G at position 354 is mutated to glutamine Q and threonine T at position 355 is mutated to glutamic acid E.

Wherein, the amino acid sequence of mutating 354 glycine G into glutamine Q is shown as SEQ ID NO. 2;

the amino acid sequence of mutation of 355 threonine T into glutamic acid E is shown in SEQ ID NO. 3;

The amino acid sequence of mutating glycine G at position 354 into glutamine Q and mutating threonine T at position 355 into glutamic acid E is shown in SEQ ID NO. 4.

The sequence of SEQ ID NO.2 is as follows:

MDRFARENLTEWKRILAYWEKFSPDYQRGGFHGQVNYDNQPVLDASRSIILISRILWTFSLAYRHFHRRRYLVLADRAYHYLYNHFRDTKNGGVYWSVTAAGVPLETRKQLYGHAFAIYGLSEYYAASKFKPALDFAQELFQTVDKHGYDAEKGGYFEAFGPSWETVDDLILSKMPWNKSQNTHLHIIEAFTNLYRVWPDALLKKRVVHLTDAFMEKLVSPETYRLRLFFDRDWQPKDETISYGHDIEASWLLWETAEVLNDHERSQKVKQLCIKMAEAACTGLGEDGALDYEFDPAANHRNHERSWWVLAEQMVGFYNAYELTGESHYKDKSLKSWEFIKKYVMDTQKGDWFQTVKPDLTPVRNAKVSFWKCPYHNSRACYEIVRRLEK

The sequence of SEQ ID NO. 3 is as follows:

MDRFARENLTEWKRILAYWEKFSPDYQRGGFHGQVNYDNQPVLDASRSIILISRILWTFSLAYRHFHRRRYLVLADRAYHYLYNHFRDTKNGGVYWSVTAAGVPLETRKQLYGHAFAIYGLSEYYAASKFKPALDFAQELFQTVDKHGYDAEKGGYFEAFGPSWETVDDLILSKMPWNKSQNTHLHIIEAFTNLYRVWPDALLKKRVVHLTDAFMEKLVSPETYRLRLFFDRDWQPKDETISYGHDIEASWLLWETAEVLNDHERSQKVKQLCIKMAEAACTGLGEDGALDYEFDPAANHRNHERSWWVLAEQMVGFYNAYELTGESHYKDKSLKSWEFIKKYVMDTQKGDWFGEVKPDLTPVRNAKVSFWKCPYHNSRACYEIVRRLEK

the sequence of SEQ ID NO. 4 is as follows:

MDRFARENLTEWKRILAYWEKFSPDYQRGGFHGQVNYDNQPVLDASRSIILISRILWTFSLAYRHFHRRRYLVLADRAYHYLYNHFRDTKNGGVYWSVTAAGVPLETRKQLYGHAFAIYGLSEYYAASKFKPALDFAQELFQTVDKHGYDAEKGGYFEAFGPSWETVDDLILSKMPWNKSQNTHLHIIEAFTNLYRVWPDALLKKRVVHLTDAFMEKLVSPETYRLRLFFDRDWQPKDETISYGHDIEASWLLWETAEVLNDHERSQKVKQLCIKMAEAACTGLGEDGALDYEFDPAANHRNHERSWWVLAEQMVGFYNAYELTGESHYKDKSLKSWEFIKKYVMDTQKGDWFQEVKPDLTPVRNAKVSFWKCPYHNSRACYEIVRRLEK

It will also be appreciated by those skilled in the art that the mutants are not limited to the specific sequences listed above. The sequence of the mutant should encompass sequences comprising one or two or more nucleotide mutations compared to the sequence shown in any of SEQ ID NOs 2-4, but which are substantially functionally identical thereto, as well as sequences having 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence shown in any of SEQ ID NOs 2-4.

The method for preparing the mutant is not limited in any way, and the mutant can be obtained by mutating according to a method conventional in the art, for example, by constructing a directional mutagenesis, a random mutagenesis or a synthetic oligonucleotide, and expressing the DNA sequence obtained by the mutation in a host cell to obtain a mutant in which substitution, insertion and/or deletion of the amino acid sequence occurs. In the application, mutation is performed by adopting a site-directed mutagenesis method based on 3D structure and function analysis of enzyme.

The application provides aldohexose-2-epimerase mutants comprising an amino acid sequence as set forth in any one of SEQ ID NO:2-4 or an amino acid sequence as set forth in any one of SEQ ID NO: 2-4. In some embodiments, the aldohexose is glucose or mannose.

Nucleic acid molecules, expression vectors and host cells

The present application provides a nucleic acid molecule comprising a mutant encoding a aldohexose-2-epimerase according to any one of the above. In some embodiments, the nucleic acid molecule comprises SEQ ID NO:5-7 or a sequence as set forth in any one of SEQ ID NOs: 5-7.

In some embodiments, the nucleotide sequence encoding the aldohexose-2-epimerase mutant described above is codon optimized. In general, codon optimization involves balancing the percentage of selected codons with the abundance of published human transfer RNAs such that none is overloaded or limited. In some cases, this may be necessary because most amino acids are encoded by more than one codon, and the codon usage varies from organism to organism. Codon usage differences between the transfected gene and the host cell may affect protein expression and immunogenicity of the nucleic acid construct. Typically, for codon optimization, codons are selected to select those codons that are balanced with human usage frequency. Typically, the redundancy of amino acid codons is such that the different codons encode one amino acid. In some embodiments, when selecting codons for substitution, it may be desirable that the resulting mutation be a silent mutation such that the codon changes do not affect the amino acid sequence. Typically, the last nucleotide of a codon can remain unchanged without affecting the amino acid sequence.

SEQ ID NO:5 is as follows:

ATGGACCGTTTCGCCCGTGAAAACCTGACGGAATGGAAACGCATCCTGGCTTACTGGGAGAAATTCAGCCCGGATTACCAGCGTGGTGGTTTCCACGGCCAGGTCAACTATGATAACCAGCCGGTTCTGGATGCTTCTCGTTCCATCATTCTGATCTCTCGTATTCTGTGGACTTTCTCTCTGGCTTACCGTCATTTCCATCGTCGTCGTTACCTGGTTCTGGCGGATCGCGCGTATCACTACCTGTACAATCACTTCCGCGATACCAAAAACGGTGGTGTTTACTGGTCTGTGACGGCCGCGGGTGTTCCGCTGGAAACCCGTAAACAACTGTACGGCCACGCATTTGCCATCTACGGCCTGTCCGAATACTATGCAGCTTCCAAATTCAAACCGGCGCTGGATTTCGCACAAGAACTGTTTCAGACTGTTGACAAACACGGCTACGATGCTGAGAAAGGTGGTTACTTTGAAGCGTTCGGCCCGTCTTGGGAAACCGTCGATGATCTGATTCTGAGCAAAATGCCGTGGAACAAATCTCAGAACACTCATCTGCACATCATCGAAGCCTTCACGAACCTGTATCGTGTTTGGCCGGACGCGCTGCTGAAAAAACGCGTGGTACACCTGACCGACGCCTTCATGGAAAAACTGGTGAGCCCGGAAACCTATCGTCTGCGTCTGTTCTTCGATCGCGACTGGCAGCCGAAAGATGAAACGATTTCTTATGGCCACGACATCGAAGCCTCCTGGCTGCTGTGGGAGACCGCTGAAGTACTGAACGACCATGAACGTTCCCAGAAGGTGAAGCAGCTGTGCATTAAAATGGCGGAAGCGGCTTGCACTGGCCTGGGTGAAGATGGTGCGCTGGACTACGAATTTGACCCGGCTGCTAACCACCGTAACCACGAACGTAGCTGGTGGGTGCTGGCGGAGCAGATGGTTGGCTTCTACAACGCTTACGAACTGACCGGTGAATCCCATTACAAAGACAAGTCCCTGAAATCCTGGGAATTCATTAAGAAGTACGTCATGGATACTCAGAAAGGCGACTGGTTCCAGACCGTAAAACCGGATCTGACTCCGGTTCGCAACGCGAAAGTCTCTTTCTGGAAATGCCCGTACCATAACTCTCGTGCTTGCTATGAAATTGTGCGTCGCCTGGAAAAA

SEQ ID NO:6 is as follows:

ATGGACCGTTTCGCCCGTGAAAACCTGACGGAATGGAAACGCATCCTGGCTTACTGGGAGAAATTCAGCCCGGATTACCAGCGTGGTGGTTTCCACGGCCAGGTCAACTATGATAACCAGCCGGTTCTGGATGCTTCTCGTTCCATCATTCTGATCTCTCGTATTCTGTGGACTTTCTCTCTGGCTTACCGTCATTTCCATCGTCGTCGTTACCTGGTTCTGGCGGATCGCGCGTATCACTACCTGTACAATCACTTCCGCGATACCAAAAACGGTGGTGTTTACTGGTCTGTGACGGCCGCGGGTGTTCCGCTGGAAACCCGTAAACAACTGTACGGCCACGCATTTGCCATCTACGGCCTGTCCGAATACTATGCAGCTTCCAAATTCAAACCGGCGCTGGATTTCGCACAAGAACTGTTTCAGACTGTTGACAAACACGGCTACGATGCTGAGAAAGGTGGTTACTTTGAAGCGTTCGGCCCGTCTTGGGAAACCGTCGATGATCTGATTCTGAGCAAAATGCCGTGGAACAAATCTCAGAACACTCATCTGCACATCATCGAAGCCTTCACGAACCTGTATCGTGTTTGGCCGGACGCGCTGCTGAAAAAACGCGTGGTACACCTGACCGACGCCTTCATGGAAAAACTGGTGAGCCCGGAAACCTATCGTCTGCGTCTGTTCTTCGATCGCGACTGGCAGCCGAAAGATGAAACGATTTCTTATGGCCACGACATCGAAGCCTCCTGGCTGCTGTGGGAGACCGCTGAAGTACTGAACGACCATGAACGTTCCCAGAAGGTGAAGCAGCTGTGCATTAAAATGGCGGAAGCGGCTTGCACTGGCCTGGGTGAAGATGGTGCGCTGGACTACGAATTTGACCCGGCTGCTAACCACCGTAACCACGAACGTAGCTGGTGGGTGCTGGCGGAGCAGATGGTTGGCTTCTACAACGCTTACGAACTGACCGGTGAATCCCATTACAAAGACAAGTCCCTGAAATCCTGGGAATTCATTAAGAAGTACGTCATGGATACTCAGAAAGGCGACTGGTTCGGTGAAGTAAAACCGGATCTGACTCCGGTTCGCAACGCGAAAGTCTCTTTCTGGAAATGCCCGTACCATAACTCTCGTGCTTGCTATGAAATTGTGCGTCGCCTGGAAAAA

SEQ ID NO:7 is as follows:

ATGGACCGTTTCGCCCGTGAAAACCTGACGGAATGGAAACGCATCCTGGCTTACTGGGAGAAATTCAGCCCGGATTACCAGCGTGGTGGTTTCCACGGCCAGGTCAACTATGATAACCAGCCGGTTCTGGATGCTTCTCGTTCCATCATTCTGATCTCTCGTATTCTGTGGACTTTCTCTCTGGCTTACCGTCATTTCCATCGTCGTCGTTACCTGGTTCTGGCGGATCGCGCGTATCACTACCTGTACAATCACTTCCGCGATACCAAAAACGGTGGTGTTTACTGGTCTGTGACGGCCGCGGGTGTTCCGCTGGAAACCCGTAAACAACTGTACGGCCACGCATTTGCCATCTACGGCCTGTCCGAATACTATGCAGCTTCCAAATTCAAACCGGCGCTGGATTTCGCACAAGAACTGTTTCAGACTGTTGACAAACACGGCTACGATGCTGAGAAAGGTGGTTACTTTGAAGCGTTCGGCCCGTCTTGGGAAACCGTCGATGATCTGATTCTGAGCAAAATGCCGTGGAACAAATCTCAGAACACTCATCTGCACATCATCGAAGCCTTCACGAACCTGTATCGTGTTTGGCCGGACGCGCTGCTGAAAAAACGCGTGGTACACCTGACCGACGCCTTCATGGAAAAACTGGTGAGCCCGGAAACCTATCGTCTGCGTCTGTTCTTCGATCGCGACTGGCAGCCGAAAGATGAAACGATTTCTTATGGCCACGACATCGAAGCCTCCTGGCTGCTGTGGGAGACCGCTGAAGTACTGAACGACCATGAACGTTCCCAGAAGGTGAAGCAGCTGTGCATTAAAATGGCGGAAGCGGCTTGCACTGGCCTGGGTGAAGATGGTGCGCTGGACTACGAATTTGACCCGGCTGCTAACCACCGTAACCACGAACGTAGCTGGTGGGTGCTGGCGGAGCAGATGGTTGGCTTCTACAACGCTTACGAACTGACCGGTGAATCCCATTACAAAGACAAGTCCCTGAAATCCTGGGAATTCATTAAGAAGTACGTCATGGATACTCAGAAAGGCGACTGGTTCCAGGAAGTAAAACCGGATCTGACTCCGGTTCGCAACGCGAAAGTCTCTTTCTGGAAATGCCCGTACCATAACTCTCGTGCTTGCTATGAAATTGTGCGTCGCCTGGAAAAA

the present application provides an expression vector comprising the nucleic acid molecule described above. In some embodiments, the expression vector is a plasmid, cosmid, phage, or viral vector, preferably a plasmid or the like.

For example, the nucleic acid molecule encoding the aldohexose-2-epimerase mutant described above can be cloned into a suitable expression vector, which can be any suitable recombinant expression vector, and can be used to transform or transfect any suitable host. Suitable vectors include those designed for propagation and amplification or for expression or both, such as plasmids and viruses. In some embodiments, the expression vector is a plasmid.

In the present application, the expression vector may contain regulatory sequences (such as transcription and translation initiation and termination codons) which are specific for the type of host (e.g., bacterial, fungal, plant or animal) to be introduced into the vector, and whether the vector is DNA-based or RNA-based as appropriate and considered. The vector may also contain a non-native promoter operably linked to the nucleotide sequence encoding the TCR. The promoter may be a non-viral or viral promoter such as the Cytomegalovirus (CMV) promoter, the SV40 promoter, the RSV promoter and promoters found in the long terminal repeat of murine stem cell viruses, as well as other promoters known to the skilled artisan are contemplated.

The present application provides a host cell comprising the expression vector described above.

In the present application, the expression vector is transformed into a host cell for further expression or cloning in the host cell. In some embodiments, a method of making an aldohexose-2-epimerase mutant is provided, the method comprising culturing a host cell comprising a nucleic acid encoding an aldohexose-2-epimerase mutant as provided above under conditions suitable for expression of the aldohexose-2-epimerase mutant, and optionally recovering the aldohexose-2-epimerase mutant from the host cell (or host cell culture medium). In some embodiments, the host cell is a eukaryotic cell, a prokaryotic cell, or a bacterial cell, preferably a prokaryotic cell, further preferably E.coli.

The host cell refers to a cell into which exogenous nucleic acid has been introduced, including the progeny of such a cell. Host cells include transformants and transformed cells, including primary transformed cells and progeny derived therefrom, regardless of the number of passages. The offspring may not be identical in nucleic acid content to the parent cell, but may contain mutations.

Use of aldohexose-2-epimerase mutants and methods of converting aldohexose

The application provides the use of the aldohexose-2-epimerase mutant according to any one of the above in aldohexose conversion.

In the present application, the conversion refers to a conversion between aldohexoses, for example, when aldohexoses are D-glucose, they may be converted to D-mannose, and when aldohexoses are D-mannose, they may be converted to D-glucose.

The present application provides a method for converting aldohexoses comprising converting aldohexoses using the aldohexose-2-epimerase mutant as described in any one of the above to catalyze aldohexose reaction. In some embodiments, the temperature of the reaction is 20-55deg.C, preferably 30-45deg.C; and/or

The pH value of the reaction is 6.5-10, preferably 7.5-8.5; and/or

The reaction time is 0.5 to 10 hours, preferably 0.5 to 6 hours.

For example, the reaction temperature is 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, etc.;

The pH of the reaction may be 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, etc.;

the reaction time may be 0.5 hours, 1 hour, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours, 7 hours, 7.5 hours, 8 hours, 8.5 hours, 9 hours, 9.5 hours, 10 hours, etc.

In some embodiments, the concentration of aldohexoses is from 10 to 100g/L.

For example, the concentration of aldohexoses may be 10g/L, 20g/L, 30g/L, 40g/L, 50g/L, 60g/L, 70g/L, 80g/L, 90g/L, 100g/L, etc.

The aldohexose-2-epimerase mutant has high specificity, can convert glucose into mannose when the aldohexose is glucose, can convert mannose into glucose when the aldohexose is mannose, has high enzyme activity, and has about 13 enzyme activity units in 1mg of aldohexose-2-epimerase mutant (G354 Q+T355E) compared with a wild type, and the specific enzyme activity is improved by about 2.2 times through calculation and analysis; and the mutant can increase the conversion rate of D-glucose to D-mannose, for example, the mutant (G354 Q+T355E) can increase by about 3.6 times.

Examples

The materials used in the test and the test methods are described generally and/or specifically in the examples which follow,% represents wt%, i.e. weight percent, unless otherwise specified. The reagents or apparatus used were conventional reagent products commercially available without the manufacturer's knowledge.

Example 1RsAE (Runsl-4586) preparation of Gene cloning and expression of wild type and mutant

The r.slithyformis (DSM 19594) gene fragment Runsl _4586, which codes for the protein of the full 390 amino acid sequence, is numbered AEI50906.1 in GenBank. The Runsl _4586 gene fragment (wild type) and the mutant gene fragment were synthesized by Beijing, the Biotech Co., ltd.) and inserted between restriction sites NdeI and NotI of pET22b plasmid, and finally the expression plasmid was transferred into E.coli BL21.

Recombinant E.coli was inoculated into a tube containing 5mL of LB liquid medium and cultured overnight at 25℃and 150 rpm. The next day, the seed solution is transferred into a 500mL shaking flask filled with 90mL of fresh LB liquid medium with 10% of inoculation amount, the shaking table is cultured at 37 ℃ and at 150rpm, when the concentration of the thalli OD600 reaches 0.6-0.8, the temperature of the shaking table is regulated to 28 ℃, IPTG with the final concentration of 0.5mM is added, and the enzyme production is induced and expressed for 5hr under the conditions of 28 ℃ and 150 rpm.

The collected cells were reconstituted and crushed under high pressure using phosphate buffer (pH 7.8), and the supernatant was collected by centrifugation, and then RsAE enzymes (wild type and mutant) were purified by Ni column affinity adsorption.

Example 2 identification of enzyme Activity of RsAE wild type and mutant

1Ml of the reaction system (50 mM phosphate buffer (pH 7.8)), substrate glucose concentration was 10G/L, and 0.15mg of the enzyme (RsAE wild-type (WT), mutant (W198H), mutant (G354Q) and mutant (G354 Q+T355E)) prepared in example 1 was added, respectively, and reacted at 37℃for 120 minutes, and after completion of the reaction, the reaction was terminated in a boiling water bath for 10 minutes. Centrifuging the catalytic liquid after termination of the reaction at 13000rpm for 1min, taking the supernatant to prepare a high-pressure liquid chromatography test sample, and determining the mannose production in the reaction system, wherein the chromatographic conditions of the high-pressure liquid chromatography are as follows: agilent1260 high performance liquid chromatograph, fei Royle MARS Mca 5u 300X 7.8mm chromatographic column, detector temperature 35 ℃, column temperature 80 ℃, mobile phase pure water; the flow rate was 0.5ml/min and the sample injection amount was 10. Mu.l, and the results are shown in FIG. 1.

As can be seen from FIG. 1, under the above reaction conditions, the conversion rates of RsAE Wild Type (WT), mutant (W198H), mutant (G354Q) and mutant (G354 Q+T355E) to D-mannose by converting D-glucose substrate were 6.3%, 4.8%, 19.5% and 22.6%, respectively, indicating that the introduction of the mutation W198H reduced the enzymatic activity of RsAE converting D-glucose substrate to D-mannose, and the introduction of the mutations G354Q and T355E significantly improved the enzymatic activity.

Example 3 determination of the enzymatic Activity of the D-mannose production reaction by conversion of D-glucose by RsAE mutant (G354 Q+T355E)

1Ml of the reaction system (50 mM phosphate buffer (pH 7.8)), the substrate glucose concentration was 10g/L, 0.03mg of the RsAE mutant produced in example 1 was added, and the reaction was terminated by boiling water bath for 10 minutes after the completion of the reaction at 37℃for 0.5hr, 1hr, 2hr, 3hr, 4hr, 5hr and 6hr, respectively. HPLC test sample preparation and HPLC conditions were the same as in example 2, and the reaction progress curve of RsAE mutant (G354 Q+T355E) for converting D-glucose to D-mannose is shown in FIG. 2. The definition of enzyme activity is: the amount of enzyme required to produce 1. Mu. Mol mannose at 37℃for 1min was 1U.

From FIG. 2 and by computational analysis, 1 mg RsAE mutant (G354 Q+T355E) contained about 13 enzyme activity units, i.e.13U/mg enzyme.

Example 4 enzymatic kinetic study of the D-mannose reaction by converting D-glucose into D-mannose by the RsAE mutant (G354 Q+T355E)

1Ml of the reaction system (50 mM phosphate buffer (pH 7.8)), the substrate glucose concentrations were 10G/L, 20G/L, 40G/L, 60G/L, 80G/L and 100G/L, respectively, 0.03mg of RsAE mutant (G354 Q+T355E) prepared in example 1 was added, the reaction was carried out at 37℃for 60 minutes, and after the completion of the reaction, the reaction was terminated in a boiling water bath for 10 minutes. HPLC test sample preparation and high pressure liquid chromatography conditions were the same as in example 2. The data obtained were analyzed by the Lineweaver-Burk equation (double reciprocal mapping) to give RsAE mutant (G354 Q+T355E) with a Km of about 440mM and a kcat of about 10s ^-1 for the conversion of D-glucose to D-mannose.

The above description is only a preferred embodiment of the present application, and is not intended to limit the application in any way, and any person skilled in the art may make modifications or alterations to the disclosed technical content to the equivalent embodiments. However, any simple modification, equivalent variation and variation of the above embodiments according to the technical substance of the present application still fall within the protection scope of the technical solution of the present application.

Claims

2. The aldohexose-2-epimerase mutant according to claim 1, wherein the amino acid sequence of the mutant comprises an amino acid mutation corresponding to at least one of G354 and T355 of SEQ ID No. 1, preferably comprises an amino acid mutation corresponding to G354 and T355 of SEQ ID No. 1.

4. A aldohexose-2-epimerase mutant according to any one of claims 1 to 3, wherein the aldohexose is glucose or mannose.

6. The nucleic acid molecule of claim 5, wherein the nucleic acid molecule comprises SEQ ID NO:5-7 or a sequence as set forth in any one of SEQ ID NOs: 5-7.

7. An expression vector comprising the nucleic acid molecule of claim 5 or 6.

8. The expression vector according to claim 7, wherein the expression vector is a plasmid, cosmid, phage or viral vector, preferably a plasmid.

9. A host cell comprising the expression vector of claim 7 or 8;

10. Use of the aldohexose-2-epimerase mutant according to any one of claims 1 to 4 for aldohexose conversion.

11. A method of converting aldohexose comprising converting aldohexose using the aldohexose-2-epimerase mutant of any one of claims 1 to 4 to catalyze a aldohexose reaction.

12. A process according to claim 11, wherein the temperature of the reaction is 20-55 ℃, preferably 30-45 ℃; and/or

The pH value of the reaction is 6.5-10, preferably 7.5-8.5; and/or

The reaction time is 0.5 to 10 hours, preferably 0.5 to 6 hours.