CN118086364A - Use of OsFE protein or coding gene thereof in plant breeding for regulating starch synthesis - Google Patents

Abstract

The invention discloses an application of OsFE protein or coding gene thereof in plant breeding for regulating starch synthesis. The invention also discloses a method for cultivating transgenic plants with normal starch synthesis. The invention also discloses OsFE4 mutant genes and application of mutant proteins thereof in plant breeding for regulating and controlling starch synthesis. The protein can influence the synthesis of starch in plant endosperm, and the encoding gene of the protein is introduced into plants with abnormal starch synthesis, so that transgenic plants with normal starch synthesis can be cultivated. The protein and the coding gene thereof can be applied to plant genetic improvement.

Description

Use of OsFE protein or coding gene thereof in plant breeding for regulating starch synthesis

Technical Field

The invention belongs to the application field of the technical field of agricultural science, and particularly relates to application of OsFE < 4 > protein or a coding gene thereof in plant breeding for regulating and controlling starch synthesis.

Background

Rice is one of important grain crops, and the improvement of the yield of the rice plays an extremely important role in guaranteeing the grain safety. Starch is the highest content component in rice grains, and has a decisive influence on the yield and quality of rice. Therefore, the key genes for starch synthesis are excavated, molecular mechanisms of rice starch synthesis are researched, and important theoretical value and practical significance are provided for improving rice yield and rice quality.

Starch biosynthesis is the final conversion of the starch synthesis precursor ADP-glucose (ADPG) into starch by a complex series of enzymatic reactions. ADP-glucose pyrophosphorylase is responsible for providing the glucose chain extension precursor ADPG, involved in amylose and amylopectin synthesis. The granule-bound starch synthase GBSS is mainly responsible for the synthesis of amylose. Starch synthases, starch branching enzymes and starch debranching enzymes are mainly responsible for the synthesis of amylopectin. In addition to the above-described enzymes involved in starch biosynthesis, scientists have identified a range of other factors involved, such as glucose metabolism, mitochondrial homeostasis, amyloplast development regulatory factors, and the like. Thus, starch synthesis is a very complex and elaborate biological process requiring a large number of regulatory factors to participate.

Screening rice endosperm starch mutants (waxy, sugar, pink, shrunken, dark, white heart, etc.) is an important method for mining new starch synthesis key genes. With the rapid development of molecular biology and molecular genetic methods and techniques, research on molecular mechanisms of rice starch synthesis has been advanced to some extent, but the molecular regulatory network is still unclear, and more novel regulatory factors need to be identified.

Disclosure of Invention

The invention aims to: the invention aims to solve the technical problem of providing an application of OsFE protein or a coding gene thereof in plant breeding for regulating and controlling starch synthesis.

The invention also solves the technical problem of providing OsFE4 mutant genes and mutant proteins thereof and application thereof in plant breeding for regulating and controlling starch synthesis.

The technical scheme is as follows: in order to solve the technical problems, the invention provides OsFE gene, a recombinant expression vector containing OsFE gene, an expression cassette, a transgenic cell line or application of recombinant bacteria in plant breeding for regulating starch synthesis, wherein OsFE gene comprises any one of the following:

1) A DNA molecule shown in SEQ ID No. 1;

2) A DNA molecule shown in SEQ ID No. 2;

3) A DNA molecule which hybridizes under stringent conditions to the DNA sequence defined in 1) or 2) and which encodes said protein;

4) A DNA molecule which has more than 90% homology with the DNA sequence defined in 1) or 2) or 3) and which codes for a protein associated with starch synthesis in plants.

Wherein SEQ ID NO.1 in the sequence table consists of 3951 nucleotides;

Primer pairs for amplifying the full length or any fragment of the gene (OsFE 4) are also within the scope of the present invention, wherein the Primer pairs are preferably Primer1/Primer2 and Primer3/Primer4, and the positioning primers involved in the process of fine positioning the gene (see table 1) are all self-designed primers required for the experiment, and the self-designed primers are also within the scope of the present invention.

Wherein the recombinant expression vector is a plant expression vector, and preferably, the plant expression vector comprises a binary agrobacterium vector. The recombinant overexpression vector may be a recombinant plasmid obtained by inserting the gene (OsFE 4) into the recombinant site of the pCAMBIA1390 vector by double restriction enzymes KpnI and BamHI. pCAMBIA1390 containing OsFE4 was designated pCAMBIA 1390-OsFE.

In order to facilitate the identification and selection of transgenic plant cells or plants, the plant expression vectors used may be processed, for example, by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin markers, kanamycin markers, etc.), or anti-chemical marker genes (e.g., anti-herbicide genes), etc., which may be expressed in plants. From the safety of transgenic plants, transformed plants can be screened directly in stress without adding any selectable marker gene.

The invention also comprises application of OsFE protein in plant breeding for regulating starch synthesis, wherein the OsFE protein comprises any one of the following components:

(a) A protein consisting of the amino acid sequence shown in SEQ ID NO. 3;

(b) And (b) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence of SEQ ID NO.3, is related to starch synthesis and is derived from the SEQ ID NO. 3.

The invention also discloses a method for cultivating transgenic plants with normal starch synthesis, which comprises the step of introducing OsFE4 wild type genes into plants with abnormal starch synthesis to obtain transgenic plants with normal starch synthesis, wherein the nucleotide sequence of the OsFE wild type genes is shown as SEQ ID NO.1 or SEQ ID NO. 2.

Wherein the method comprises introducing a recombinant vector containing OsFE4 wild-type gene into a plant having abnormal starch synthesis.

Wherein the recombinant vector is pCAMBIA1390-OsFE4.

The invention also includes a OsFE4 mutant gene, the OsFE mutant gene including:

(a) Deletion of 442-450 bases in the coding region of the wild OsFE gene; the nucleotide sequence of the coding region of the wild OsFE gene is shown as SEQ ID NO. 2; further, the nucleotide sequence of the OsFE4 mutant gene is shown as SEQ ID NO. 10;

(b) OsFE4 missense mutant gene, osFE nonsense mutant gene, other OsFE deletion mutant gene except (a), osFE frame shift mutant gene or OsFE insertion mutant gene.

The invention also comprises OsFE < 4 > mutant protein, wherein the OsFE < 4 > mutant protein is deleted from 148 th amino acid to 150 th amino acid of the amino acid sequence of wild type OsFE < 4 > protein, the amino acid sequence of the wild type protein is shown as SEQ ID NO.3, and the amino acid sequence of the OsFE < 4 > mutant protein is shown as SEQ ID NO. 11.

The invention also includes an expression cassette, recombinant vector or recombinant strain comprising the OsFE mutant gene.

The invention also comprises the application of OsFE mutant genes, mutant proteins, expression cassettes, recombinant vectors or recombinant strains or transgenic plant tissues or transgenic plants containing OsFE mutant genes or wild type genes or tissue cultures or protoplasts produced by renewable cells of the transgenic plants in regulating starch synthesis of plants.

Wherein the starch content in the plant is reduced by a method of reducing the expression level and/or activity of OsFE4 protein in the plant; and/or increasing the starch content in plants by increasing the amount and/or activity of OsFE protein expressed in plants.

Wherein, the method for improving the expression level of OsFE protein in the plant is to over-express OsFE gene in the plant, preferably, over-expression cassette, over-expression recombinant vector and over-expression recombinant bacteria of OsFE gene are introduced into the plant so as to over-express OsFE gene in the plant.

The beneficial effects are that: compared with the prior art, the invention has the following advantages: the invention discovers, locates and clones a new gene OsFE4 of plant starch synthesis related protein for the first time. The plant starch synthesis related protein of the invention affects the starch synthesis process of plants. Inhibition of expression of the protein-encoding gene can lead to a disruption of starch synthesis in plant seeds, thereby allowing for the cultivation of transgenic plants with endosperm variation and transgenic plants with reduced starch content in the plant. The coding gene of the protein is introduced into plants with reduced starch content, so that plants with normal starch content can be cultivated. The protein and the coding gene thereof can be applied to plant genetic improvement.

Drawings

FIG. 1 shows endosperm phenotypes of wild type Nipponbare and mutant fe 4.

FIG. 2 shows the scanning electron microscope observation of wild type Japanese sunny and mutant fe4 endosperm.

FIG. 3 shows the measurement of total starch content in wild type Japanese sunny and mutant fe4 endosperm.

FIG. 4 shows the measurement of total starch content in wild type Japanese sunny and mutant fe4 endosperm.

Fig. 5 is a fine positioning schematic.

FIG. 6 shows the T ₁ seed phenotype of the pCAMBIA1390-OsFE4 transgenic plants.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

Example 1 discovery of Rice starch Synthesis-related sites and genes encoding the same

1. Starch content analysis and genetic analysis of rice starch mutant fe4

Among the mutants of Nipponbare produced by irradiation mutagenesis, one endosperm flour mutant was selected and designated fe4. In comparison to the wild type, the fe4 endosperm exhibited an opaque phenotype (fig. 1). Scanning Electron Microscopy (SEM) of cross sections of wild type and mutant fe4 seeds revealed that the wild type seeds had closely aligned starch particles and the mutant fe4 seeds had loose alignment of starch particles. Physicochemical analysis showed that the mutant endosperm had very significantly reduced total starch and amylose content compared to the wild type (figures 3 and 4).

1. Localization of mutant genes

The mutant fe4 and indica rice variety 9311 are prepared into hybrid combination F ₁, and F ₂ seeds are obtained after the first generation of selfing. 10 extreme individuals of phenotype opaque endosperm are selected from F ₂ seeds for gene linkage analysis, and the target gene is determined on the 1 st chromosome long arm of rice. Further, 795 extreme individuals were used for fine localization, and the mutant gene was located between the molecular markers P93 and P97 with a physical distance of about 227kb. (FIG. 5).

The method for SSR marker analysis is as follows:

(1) Extracting the total DNA of the selected single plant by using a CTAB method

Cutting a small amount of single plant leaves of the selected mutant fe4, indica rice variety 9311, japanese sunny and F ₂ seeds respectively, placing the single plant leaves in a 2.0mL centrifuge tube, and adding small steel balls for sample grinding; adding 300 mu L of CTAB into a centrifuge tube, and treating for 30min in a 65 ℃ oven; adding 300 μl of chloroform into the centrifuge tube, mixing, and centrifuging at 12000x rpn min; sucking 200 μl of supernatant into 1.5mL centrifuge tube, adding 400 μl of alcohol, treating with negative 20deg.C refrigerator for 30min, centrifuging 12000x rpn for 5min, pouring supernatant, and air drying overnight; add 100. Mu.L ddH ₂ O for solubilization.

(2) Diluting the extracted DNA to about 20 ng/. Mu.L, and performing PCR amplification by using the diluted DNA as a template;

PCR reaction System (10. Mu.L): 1. Mu.L of DNA (20 ng/. Mu.L), 1. Mu.L of upstream primer (2 pmol/. Mu.L), 1. Mu.L of downstream primer (2 pmol/. Mu.L), 7.5. Mu.L of PCR mix, and 4.5. Mu.L of ddH ₂ O, 15. Mu.L in total.

PCR reaction procedure: denaturation at 94.0℃for 5min; denaturation at 94.0 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 1min, and total circulation for 35 times; extending at 72 ℃ for 7min; preserving at 10 ℃. The PCR reaction was performed in a Bio-Rad T100 PCR instrument.

(3) PCR product detection of SSR markers

The amplified products were analyzed by 8% non-denaturing polyacrylamide gel electrophoresis. The molecular weight of the amplified product was compared with that of a 50bp DNA LADDER control, and silver staining was performed.

The primer development process is as follows:

(1) SSR marker development

The sequence of the localization interval was downloaded at the NCBI website, SSR primers were designed using PRIMER PREMIER 5.0.0 software and synthesized by the south kyo bioengineering company, inc. The SSR pair primers designed by self are mixed in equal proportion, the polymorphism between Japanese sunny and 9311 is detected, and the polymorphism is used as a molecular marker for fine localization. The molecular markers used for fine localization are shown in Table 1.

TABLE 1 molecular markers for Fine localization

2. Acquisition of starch Synthesis-related Gene

Through sequencing in a 227kb interval, it is found that the OsFE gene 4 exon of the mutant fe4 has 9 base deletion mutation, namely, the 442-450 base deletion in the wild-type OsFE gene coding region, the nucleotide sequence of the OsFE4 mutant gene is shown as SEQ ID NO.10, the OsFE mutant protein has 148-150 amino acids deletion in the amino acid sequence of the wild-type OsFE4 protein, and the amino acid sequence of the OsFE mutant protein is shown as SEQ ID NO. 11.

Primers were designed based on the OsFE gene sequences published on the net, as follows:

primer1：5'GGTAGGGCGATAGGCGGGTA 3'(SEQ ID NO.4)；

primer2：5'ACGTCCCAATGCCAACTATA 3'(SEQ ID NO.5)。

PCR amplification was performed using primer1 and primer2 as primers and Japanese developing endosperm cDNA as a template to obtain the target gene. The PCR amplification system is as follows: 3.4. Mu.L of cDNA, 3. Mu.L of upstream primer (2 pmol/. Mu.L), 3. Mu.L of downstream primer (2 pmol/. Mu.L), 5. Mu.L of dNTP, 15. Mu.L of KOD buffer and 0.6. Mu.L of KOD enzyme (1.0U/. Mu.L). Amplification reactions were performed on a Bio-Rad T100 PCR instrument: 94 ℃ for 3min;94℃30sec,60℃1.5min,72℃10min,33 cycles; and at 72℃for 5min. The PCR product was recovered and purified, and then was connected to pEASY-Blunt (full gold biosciences Co., ltd.) to transform E.coli Trans10 competent cells (full gold biosciences Co., ltd.), and positive clones were selected and sequenced.

The sequence determination result shows that the fragment obtained by PCR reaction has the nucleotide sequence shown as SEQ ID NO.2, and codes protein consisting of 429 amino acid residues (see SEQ ID NO.3 of the sequence table). The protein shown in SEQ ID NO.3 is named FE4, and the encoding gene of the protein shown in SEQ ID NO.3 is named OsFE4.

Example 2 acquisition and identification of transgenic plants

1. Recombinant expression vector construction

PCR amplification (amplification system and amplification conditions are described in example 1) was performed using cDNA of the endosperm in Nippon Temminck development as a template to obtain OsFE gene, and the PCR primer sequences were as follows:

primer3：

5'TTACTTCTGCACTAGGTACCATGGCGGGCGCGGTGTCGGC 3'(SEQ ID NO.6)；

primer4：

5'GAATTCCCGGGGATCCTCATATAAGTCTCAGTTCGT 3'(SEQ ID NO.7)。

The primers are positioned at the 5 'and 3' ends of the gene shown in SEQ ID NO.2, and the PCR product is recovered and purified. The PCR product was cloned into vector pCAMBIA1390 using ClonExpress IIOne Step Cloning Kit recombinant kit (Northenan Biotechnology Co., ltd.). Recombination reaction system (10 μl): 2.0. Mu.L of PCR product, 6.0. Mu.L of pCAMBIA1390, 1.0. Mu.L of 5 XCE II buffer, exnase II. Mu.L. After brief centrifugation, the mixture was subjected to a 37℃water bath for 15 minutes. Sequencing results show that the recombinant expression vector containing the gene shown in SEQ ID NO.1 is obtained, and pCAMBIA1390 containing OsFE4 is named pCAMBIA 1390-OsFE.

2. Acquisition of recombinant Agrobacterium

The recombinant strain is obtained by transforming the Agrobacterium EHA105 strain with pCAMBIA1390-OsFE4 by freeze thawing transformation. The method specifically comprises the following steps: adding 1-2 mu L of pCAMBIA1390-OsFE4 transformed plasmid into agrobacterium EHA105, and quick freezing in liquid nitrogen for 5min; then placing in a water bath kettle at 37 ℃ for heat shock for 5min; adding 1mL of LB culture solution, and placing in a shaking table at 28 ℃ for 3-4h; coating the bacterial liquid on an LB culture medium, and placing the LB plate in a 28 ℃ incubator for culturing for 2-3 days.

3. Acquisition of transgenic plants

The pCAMBIA1390-OsFE4 strain is transformed into rice starch synthesis abnormal mutant fe4, and the specific method is as follows:

(1) Culturing pCAMBIA1390-OsFE strain at 28deg.C for 16 hr, collecting thallus, and diluting into N6 liquid culture medium (Sigma Co., C1416) until the concentration is OD600 ≡0.5 to obtain bacterial liquid;

(2) Mixing and infecting the fe4 rice mature embryo embryogenic callus cultured for one month with the bacterial liquid in the step (1) for 30min, sucking the bacterial liquid by filter paper, transferring into a co-culture medium (N6 solid co-culture medium, sigma company), and co-culturing for 3 days at 24 ℃;

(3) Inoculating the callus treated in the step (2) on N6 solid screening culture medium containing 100mg/L hygromycin for the first time (16 days);

(4) Selecting healthy calli, transferring the healthy calli into an N6 solid screening culture medium containing 100mg/L hygromycin for second screening, and carrying out secondary transfer every 15 days;

(5) Selecting healthy calli, transferring the healthy calli into an N6 solid screening culture medium containing 50mg/L hygromycin for third screening, and carrying out secondary once every 15 days;

(6) Selecting the resistant callus, transferring the resistant callus into a differentiation medium for differentiation; and obtaining T ₀ -generation positive plants differentiated into seedlings.

4. Identification of transgenic plants

1. PCR molecular characterization

In the invention, hygromycin marks are used for identifying transgenic plants. Extracting genome DNA from the T ₀ generation plant obtained in the step three, and amplifying by using the genome DNA as a template and using a Primer5 and a Primer6 as primers.

PCR reaction system for label analysis: t ₀ generation transgenic plant DNA (20 ng/. Mu.L) 2. Mu.L, primer5 (10 pmoL/. Mu.L) 2. Mu.L, primer6 (10 pmol/. Mu.L) 2. Mu.L, PCR mix 7.5. Mu.L, ddH ₂ O1.5. Mu.L, total volume 15. Mu.L. Amplification reactions were performed on a Bio-Rad T100 PCR instrument: 94 ℃ for 3min;94℃30sec,55℃1min,72℃2.5min,33 cycles; and at 72℃for 5min.

Primer5：5'ACGCACAATCCCACTATCCT 3'(SEQ ID NO.8)；

Primer6：5'ACAGCCATCGGTCCAGAC 3'(SEQ ID NO.9)；

And (3) performing gel running analysis on the PCR product by agarose gel electrophoresis to determine the transgenic positive plants.

2. Phenotypic identification

T ₀ generation is transformed into pCAMBIA1390-OsFE4 positive plants, mutant fe4 and Nipponbare are planted in a rice breeding base respectively. After seed harvest, the seed of the pCAMBIA1390-OsFE4 plants was found to resume the transparent phenotype (fig. 6, where L1, L2, L3 are three different transgenic lines). Thus demonstrating that the mutant phenotype in fe4 is caused by the mutation described above for OsFE 4. pCAMBIA1390-OsFE4 can restore starch synthesis of the fe4 strain to normal levels.

Claims (10)

1. Application of an OsFE4 gene, a recombinant expression vector containing OsFE gene, an expression cassette, a transgenic cell line or recombinant bacteria in plant breeding for regulating starch synthesis, wherein the OsFE gene comprises any one of the following:

   1) A DNA molecule shown in SEQ ID No. 1;

   2) A DNA molecule shown in SEQ ID No. 2;

   3) A DNA molecule which hybridizes under stringent conditions to the DNA sequence defined in 1) or 2) and which encodes said protein;

   4) A DNA molecule which has more than 90% homology with the DNA sequence defined in 1) or 2) or 3) and which codes for a protein associated with starch synthesis in plants.
2. 2. Use according to claim 1, wherein the recombinant expression vector is a plant expression vector, preferably comprising a binary agrobacterium vector.
3. An application of an osfe4 protein in plant breeding for regulating starch synthesis, wherein the OsFE protein comprises any one of the following:

   (a) A protein consisting of the amino acid sequence shown in SEQ ID NO. 3;

   (b) And (b) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence of SEQ ID NO.3, is related to starch synthesis and is derived from the SEQ ID NO. 3.
4. 4. A method for cultivating a transgenic plant with normal starch synthesis, which is characterized in that the method comprises introducing OsFE4 wild type gene into a plant with abnormal starch synthesis to obtain a transgenic plant with normal starch synthesis, wherein the nucleotide sequence of OsFE4 wild type gene is shown as SEQ ID NO.1 or SEQ ID NO. 2.
5. 5. The method for growing a transgenic plant having normal starch synthesis according to claim 4, which comprises introducing a recombinant vector comprising OsFE a wild type gene into a plant having abnormal starch synthesis.
6. 6. The method for growing transgenic plants with normal starch synthesis according to claim 5, wherein the recombinant vector is pCAMBIA 1390-OsFE 4.
7. 7. A OsFE4 mutant gene, wherein said OsFE mutant gene comprises:

   (a) Deletion of 442-450 base in the coding region of the wild OsFE gene; the nucleotide sequence of the coding region of the wild OsFE gene is shown as SEQ ID NO. 2;

   (b) OsFE4 missense mutant gene, osFE nonsense mutant gene, other OsFE deletion mutant gene except (a), osFE frame shift mutant gene or OsFE insertion mutant gene.
8. 8. The OsFE4 mutant protein is characterized in that the OsFE mutant protein is deleted from 148 th amino acid to 150 th amino acid of the amino acid sequence of a wild type OsFE protein, and the amino acid sequence of the wild type protein is shown as SEQ ID NO. 3.
9. 9. An expression cassette, recombinant vector or recombinant strain comprising the OsFE mutant gene of claim 7.
10. 10. Use of OsFE of the OsFE mutant gene of claim 7, the mutant protein of claim 8, the expression cassette, recombinant vector or recombinant strain of claim 9, or a transgenic plant tissue or transgenic plant containing the OsFE mutant gene or wild type gene of claim 7, or a tissue culture or protoplast produced by a regenerable cell of said transgenic plant, for regulating starch synthesis in a plant.