CN118048323A - Recombinant serum type 4 avian adenovirus expressing H10N3 avian influenza virus HA protein and construction method thereof - Google Patents
Recombinant serum type 4 avian adenovirus expressing H10N3 avian influenza virus HA protein and construction method thereof Download PDFInfo
- Publication number
- CN118048323A CN118048323A CN202410380705.4A CN202410380705A CN118048323A CN 118048323 A CN118048323 A CN 118048323A CN 202410380705 A CN202410380705 A CN 202410380705A CN 118048323 A CN118048323 A CN 118048323A
- Authority
- CN
- China
- Prior art keywords
- avian
- recombinant
- influenza virus
- protein
- type
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 48
- 241000712461 unidentified influenza virus Species 0.000 title claims abstract description 48
- 241000701792 avian adenovirus Species 0.000 title claims abstract description 47
- 210000002966 serum Anatomy 0.000 title claims abstract description 33
- 102000004169 proteins and genes Human genes 0.000 title claims abstract description 32
- 238000010276 construction Methods 0.000 title claims abstract description 12
- 238000001814 protein method Methods 0.000 title description 2
- 101150039660 HA gene Proteins 0.000 claims abstract description 8
- 238000005516 engineering process Methods 0.000 claims abstract description 7
- 238000010356 CRISPR-Cas9 genome editing Methods 0.000 claims abstract description 6
- 239000002773 nucleotide Substances 0.000 claims abstract description 3
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 3
- 238000006467 substitution reaction Methods 0.000 claims abstract description 3
- 241000700605 Viruses Species 0.000 claims description 42
- 108091027544 Subgenomic mRNA Proteins 0.000 claims description 16
- 239000013612 plasmid Substances 0.000 claims description 14
- 238000000034 method Methods 0.000 claims description 10
- 208000015181 infectious disease Diseases 0.000 claims description 8
- 238000001890 transfection Methods 0.000 claims description 8
- 108010051219 Cre recombinase Proteins 0.000 claims description 7
- 108010048367 enhanced green fluorescent protein Proteins 0.000 claims description 6
- 239000006228 supernatant Substances 0.000 claims description 5
- 238000013461 design Methods 0.000 claims description 4
- 239000012530 fluid Substances 0.000 claims description 4
- 230000006801 homologous recombination Effects 0.000 claims description 4
- 238000002744 homologous recombination Methods 0.000 claims description 4
- 238000012423 maintenance Methods 0.000 claims description 4
- 238000003113 dilution method Methods 0.000 claims description 3
- 239000001963 growth medium Substances 0.000 claims description 3
- 238000002360 preparation method Methods 0.000 claims description 3
- 238000000746 purification Methods 0.000 claims description 3
- 241001135572 Human adenovirus E4 Species 0.000 claims description 2
- 108010054624 red fluorescent protein Proteins 0.000 claims description 2
- 238000012360 testing method Methods 0.000 claims description 2
- 238000001262 western blot Methods 0.000 claims description 2
- 229940031416 bivalent vaccine Drugs 0.000 abstract description 3
- 238000001179 sorption measurement Methods 0.000 description 12
- 239000013598 vector Substances 0.000 description 8
- 239000007788 liquid Substances 0.000 description 6
- 239000002699 waste material Substances 0.000 description 5
- 239000000243 solution Substances 0.000 description 4
- 238000010586 diagram Methods 0.000 description 3
- 230000008774 maternal effect Effects 0.000 description 3
- 238000002156 mixing Methods 0.000 description 3
- 239000007853 buffer solution Substances 0.000 description 2
- 230000010261 cell growth Effects 0.000 description 2
- 239000012228 culture supernatant Substances 0.000 description 2
- 239000013604 expression vector Substances 0.000 description 2
- 239000003550 marker Substances 0.000 description 2
- 239000013642 negative control Substances 0.000 description 2
- 244000144977 poultry Species 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 108010067770 Endopeptidase K Proteins 0.000 description 1
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 1
- 241000282414 Homo sapiens Species 0.000 description 1
- 102220617446 Leucine-rich repeat-containing protein 34_H10N_mutation Human genes 0.000 description 1
- 241000124008 Mammalia Species 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000002354 daily effect Effects 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 239000012149 elution buffer Substances 0.000 description 1
- 230000003203 everyday effect Effects 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 238000010353 genetic engineering Methods 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 239000011259 mixed solution Substances 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 230000005180 public health Effects 0.000 description 1
- 238000011084 recovery Methods 0.000 description 1
- 239000012096 transfection reagent Substances 0.000 description 1
- 241000701161 unidentified adenovirus Species 0.000 description 1
- 229960005486 vaccine Drugs 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- 230000009385 viral infection Effects 0.000 description 1
- 230000003612 virological effect Effects 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a recombinant serum type 4 avian adenovirus for expressing H10N3 avian influenza virus HA protein and a construction method thereof, which are recombinant serum type 4 avian adenovirus for expressing H10N3 avian influenza virus HA protein based on CRISPR-Cas9 technology; the sequence of the H10N3 avian influenza virus HA protein is shown as SEQ ID NO. 1; the recombinant avian adenovirus type 4, wherein H10N3 avian influenza virus HA gene is used for replacing the avian adenovirus type 4 Fiber-2 gene, and the substitution is 253 to 1440 nucleotides of the avian adenovirus type 4 Fiber-2 gene. The recombinant serum type 4 avian adenovirus expressing the H10N3 avian influenza virus HA protein constructed by the invention lays a foundation for preparing a serum type 4 avian adenovirus and H10N3 avian influenza virus bivalent vaccine. Therefore, the invention has certain market application value.
Description
Technical Field
The invention relates to a recombinant serum type 4 avian adenovirus expressing H10N3 avian influenza virus HA protein and a construction method thereof, and the recombinant serum type 4 avian adenovirus expressing H10N3 avian influenza virus HA protein constructed by CRISPR-Cas9 technology belongs to the technical field of genetic engineering.
Background
Avian influenza virus infection severely restricts the continuous healthy development of domestic and foreign poultry industry. Meanwhile, part of subtype avian influenza viruses can cross-host infection of mammals, including human beings, and pose serious threat to public health safety. Both subtype H10 avian influenza virus and serotype 4 avian adenovirus are two important new viral diseases of poultry which are urgently needed to be immune-controlled in China. The invention uses the avian adenovirus of the serum 4 type as a vector, replaces the Fiber-2 gene of the avian adenovirus of the serum 4 type with the HA gene of the avian influenza virus H10N3, successfully constructs the recombinant avian adenovirus of the serum 4 type for expressing the HA protein of the avian influenza virus H10N3, and provides a bivalent candidate vaccine strain for the combined prevention and control of the avian adenovirus of the serum 4 type and the avian influenza virus H10N 3.
Disclosure of Invention
The invention aims to overcome the defects and provide a recombinant serum type 4 avian adenovirus expressing an H10N3 Avian Influenza Virus (AIV) avian influenza virus HA protein and a construction method thereof.
In order to achieve the above object, the present invention adopts the following technical scheme: recombinant serum type 4 avian adenovirus expressing H10N3 avian influenza virus HA protein; the method is characterized in that: recombinant serum type 4 avian adenovirus for expressing H10N3 avian influenza virus HA protein based on CRISPR-Cas9 technology;
the sequence of the H10N3 avian influenza virus HA protein is shown as SEQ ID NO. 1;
the recombinant avian adenovirus type 4, wherein H10N3 avian influenza virus HA gene is used for replacing the avian adenovirus type 4 Fiber-2 gene, and the substitution is 253 to 1440 nucleotides of the avian adenovirus type 4 Fiber-2 gene.
The construction method of the recombinant serum type 4 avian adenovirus expressing the H10N3 avian influenza virus and avian influenza virus HA protein comprises the following steps:
(1) Designing sgRNA aiming at serum type 4 avian adenovirus Fiber-2 gene by utilizing an sgRNA online design website, wherein the sequence of the sgRNA is shown in table 1;
TABLE 1 sgRNA sequences for Fiber-2 genes
(2) Constructing donor plasmids carrying H10N3 avian influenza virus HA genes and RFP expression cassettes by a PCR and homologous recombination method, wherein both ends of the RFP expression cassettes are provided with LoxP sites, and primer sequences used in the PCR are shown in Table 2;
TABLE 2 PCR primers used to construct donor plasmids
(3) LMH cells were inoculated in 6-well plates and cultured overnight, 3. Mu.g of sgRNA and donor plasmid were co-transfected, and after 6h of transfection, the transfection supernatant was removed and culture medium was added; infection of recombinant adenovirus type 4 (FA 4-EGFP) expressing EGFP 12h after transfection, and cell maintenance fluid change after infection for 2 h;
(4) Observing RFP red fluorescence after the FA4-EGFP is infected, and purifying the red fluorescence recombinant virus by using a plaque test and a limiting dilution method to obtain recombinant serum 4 type avian adenovirus with an RFP expression cassette for expressing the HA protein of the H10N3 avian influenza virus;
(5) Inoculating purified red fluorescent recombinant virus into LMH cells transfected with Cre recombinase, inoculating infected cell supernatant into LMH cells transfected with Cre recombinase again after 4d, and repeating the process until the red fluorescent virus completely disappears; recombinant serum 4 type avian adenovirus expressing H10N3 avian influenza virus HA protein with RFP expression cassette removed was identified by PCR, IFA and Western Blot.
The recombinant virus FA4-EGFP expressing the EGFP is characterized by being capable of expressing green fluorescent EGFP, is different from red fluorescent protein RFP of the recombinant virus, and is convenient for quickly purifying the recombinant virus, and the detailed construction method of the recombinant virus FA4-EGFP is shown in patent CN112877303A.
The method is advanced and scientific, the recombinant serum 4-type avian adenovirus for expressing the H10N3 avian influenza virus HA protein is constructed based on the CRISPR-Cas9 technology, the key technology of the invention is to insert the H10N3 avian influenza virus HA gene and the RFP expression cassette with LoxP site into the serum 4-type avian adenovirus by using the CRISPR-Cas9 technology, purify the virus by using the RFP protein, knock out the RFP expression cassette by using Cre recombinase after the purification is finished, and finally obtain the recombinant serum 4-type avian adenovirus capable of expressing the H10N3 avian influenza virus HA protein.
The invention uses the currently popular avian adenovirus of the serotype 4 as a vector to insert the HA gene of the avian influenza virus H10N3, and successfully obtains the recombinant avian adenovirus of the serotype 4 for expressing the HA protein of the avian influenza virus H10N3, and the recombinant adenovirus can be used as a bivalent vaccine candidate strain of the avian adenovirus of the type H10N3 and the avian influenza virus of the serotype 4.
The recombinant serum type 4 avian adenovirus expressing the H10N3 avian influenza virus HA protein constructed by the invention lays a foundation for preparing a serum type 4 avian adenovirus and H10N3 avian influenza virus bivalent vaccine. Therefore, the invention has certain market application value.
Drawings
FIG. 1 is a schematic diagram of the construction strategy of recombinant viruses expressing the HA protein of H10N3 avian influenza virus.
FIG. 2 is a fluorescent image of primary recombinant virus FAdV, HA (H10) -RFP;
a: maternal virus FA4-EGFP; b: recombinant virus FAdV-HA (H10) -RFP; c: negative control.
FIG. 3 is a diagram showing the PCR identification of the purity of recombinant virus FAdV-HA (H10);
M: DNA MARKER;1: wild type FAdV-4;2: maternal virus FA4-EGFP;3: purified recombinant virus; 4: negative control.
FIG. 4 is an identification of HA protein expression in recombinant virus FAdV, 4-HA (H10);
m: DNA MARKER;1: maternal virus FA4-EGFP;2: recombinant virus FAdV-HA (H10) -RFP;3: wild type FAdV-4;4: purified recombinant virus.
FIG. 5 is a diagram showing the expression of HA protein in WB-identified recombinant viruses;
1: purified recombinant virus; 2: wild type FAdV-4;3: negative LMH cell control.
Detailed Description
Examples:
1. Preparation of the serogroup 4 avian adenovirus genome: extracting according to genome extraction kit instruction of Tiangen corporation, placing 200 μl of serum 4-type avian adenovirus culture supernatant into a 1.5mL finger-shaped tube, adding 200 μl of protease K solution, mixing thoroughly, adding 200 μl of buffer solution GB, mixing uniformly, placing into 70 ℃ water bath for 10min, centrifuging instantaneously, adding 200 μl of absolute ethanol, shaking thoroughly, and mixing for 15sec. The well-mixed solution was added to the adsorption column CB3 (the adsorption column was placed in the collection tube), centrifuged at 12000rpm for 30sec, the waste liquid was poured off, and the adsorption column CB3 was placed back into the collection tube. To the adsorption column CB3, 500. Mu.L of the buffer solution GD was added, and the mixture was centrifuged at 12000rpm for 30sec, and the waste liquid was poured off, and the adsorption column CB3 was returned to the collection tube. 600. Mu.L of the rinse PW was added to the adsorption column CB3, centrifuged at 12000rpm for 30sec, the waste liquid was poured off, the adsorption column CB3 was put back into the collection tube, 600. Mu.L of the rinse PW was repeatedly added, centrifuged at 12000rpm for 30sec, the waste liquid was poured off, and the adsorption column CB3 was put back into the collection tube. Centrifuging at 12000rpm for 2min, pouring out the waste liquid, and standing the adsorption column CB3 at room temperature for several minutes to air-dry the rinse liquid in the adsorption material. Transferring the adsorption column CB3 into a 1.5mL finger-shaped tube, suspending and dripping 200 mu L of elution buffer TE into the middle part of the adsorption film, standing for 2min at room temperature, centrifuging at 12000rpm for 2min, and collecting the solution in a centrifuge tube to obtain the genome of the virus.
Construction of sgrna expression vector: the design of the sgRNA was carried out using the on-line design site for sgRNA (http:// crispor. Tefor. Net /) according to the Fiber-2 gene sequence of FAdV-4. The designed sgrnas were cloned to LENT ICRISPR V plasmid and verification of the sgRNA expression vector was performed by sequencing. Specific sgRNA sequences are shown in table 1 and were synthesized by the south kyoto biotechnology limited.
TABLE 1 sgRNA sequences for Fiber-2 genes
3. Construction of donor plasmid: pUC-57 vector with LoxP system was synthesized by Nanjing department Biotechnology Co., ltd, RFP expression cassette was inserted into the vector by homologous recombination, and the constructed pUC-57-LoxP-RFP vector was stored in the laboratory. Amplifying the RFP expression cassette with the LoxP system by taking the pUC-57-LoxP-RFP vector as a template; linearizing the pMD19-T vector by taking the pMD19-T vector as a template; amplifying a left homologous arm HR1 and a right homologous arm HR2 by taking a serum 4 type avian adenovirus genome as a template; the HA gene of H10N3 avian influenza virus is amplified by taking pDP2002-HA plasmid as a template. Agarose gel electrophoresis is followed by gel recovery, and the obtained donor plasmid is assembled on pMD19-T according to the sequence of HR1-Fiber-2-RFP-HR2 by homologous recombination, and the obtained donor plasmid is sent to Nanjing department of biotechnology limited company for sequencing and is stored in a laboratory. The primer sequences used to construct the donor plasmid are shown in Table 2.
TABLE 2 PCR primers used to construct donor plasmids
4. Rescue of red fluorescent recombinant virus: LMH cells were seeded in 6-well plates and cultured overnight. After the cell density grows to about 80%, transfection is carried out, 3 mu gsgRNA, 3 mu g donor plasmid and 6 mu L transfection reagent Mirus are added into 200 mu L of Opt i-MEM culture medium, the cells are incubated for 45min at room temperature, and then the cells are transfected for 6h, and then the cells are transformed into cell growth solution. After 12h of transfection, the cell growth fluid was discarded, and the FA4-EGFP virus was infected at 0.1MOI, and after 2h of infection, it was changed to a cell maintenance fluid. After 72h of infection, virus culture supernatants were taken and blinded and red fluorescent clusters were seen daily on LMH cells. The appearance of red fluorescent clusters indicated successful construction of recombinant viruses, as shown in FIG. 2.
5. Purification and identification of red fluorescent recombinant viruses: the rescued recombinant virus with red fluorescence was purified by plaque assay and limiting dilution method, and whether the virus was purified was identified by PCR, and the result is shown in FIG. 3. The results showed that pure recombinant virus FAdV-HA (H10) -RFP was successfully obtained. The primers used for PCR are shown in Table 3.
TABLE 3 primers for PCR identification of recombinant viruses
Knock-out of rfp expression cassette: the LMH cells transfected with Cre recombinase are infected with 0.1MOI of red fluorescent recombinant virus, the cells are changed into cell maintenance solution after 2 hours of infection, the number of the red fluorescent virus is observed every day, the infected cell supernatant is taken after 4 days, the LMH cells transfected with Cre recombinase are inoculated again, and the process is repeated until the red fluorescent virus completely disappears. The recombinant virus from which the RFP expression cassette was removed was identified by PCR as shown in FIG. 4.
7. Expression identification of HA protein in recombinant viruses: WB identification was performed using mab against H10N3 avian influenza virus HA protein and mab against FAdV-4. The results are shown in FIG. 5, which demonstrate that HA was successfully inserted into FAdV-4 and good expression was obtained.
SEQ ID NO.1
H10N3 avian influenza virus HA gene sequence:
ATGTACAAAATAGTAGTGATAATCGCGTTCCTTGGAACTGTGAAGGCTCTTGATAAGATCTGCCTGGGACATCATGCAGTGGCCAATGGGACCATTGTAAAGACTCTCACAAATGAACAGGAAGAGGTGACAAATGCTACTGAGACAGTGGAGAGCAAAGGCCTAAACAAATTATGTATGAAGGGAAGGAACCATAAAGACCTGGGCAACTGCCATCCAATAGGAATGCTAATAGGAACACCAGCTTGTGACCAGCACCTTACAGGGACATGGGACACTCTCATTGAACGAGAAAATGCTACTGCTTACTGCTACCCTGGAGCTACTATAAATGAAGAAGCACTGAGGCAGAAAATAATGGAAAGTGGGGGAATCAGCAAAATAAGCACCGGATTTACTTATGGATCTTCCATAAATTCAGCCGGGACCACTAATGCATGCATGAGAAATGGAGAAAATAGCTTTTATGCAGAACTTAAGTGGCTAGTATCAAAGAACAAGGGACAAAATTTCCCTCAGACCACGAACACTTACAGAAACACAGACACGGCTGAACATCTCATAATGTGGGGAATTCATCACCCCTCTAGCGTTCAAGAGAAGAATGACTTGTATGGGACACAATCACTGTCCATATCAGTCGGAAGTTCCACTTACTATAGCAATTTTGTACCAGTTGTTGGAGCAAGACCCCGGGTCAATGGACAGAGTAGCAGAATCGATTTTCACTGGACATTGGTACAGCCAGGTGATAATATCACCTTCTCACACAATGGGGGCCTGATAGCACCGAGCCGAGTTAGCAAATTAATCGGGAGAGGCTTGGGGATTCAATCTGATGCACCAATAGACAATAATTGTGAATCCAAATGTTTTTGGAGAGGAGGTTCCATAAACACAAGGCTTCCCTTTCAGAATTTGTCACCAAGAACAGTTGGCCAATGTCCTAAATATGTGAACAAAAAGAGCTTGATGCTTGCAACAGGGATGAGAAACGTGCCAGAGATAATACAGGGGAGAGGTCTATTGGGTGCAATAGCGGGGTTTATAGAGAATGGATGGGAAGGAATGGTAGATGGCTGGTATGGTTTCAGACACCAAAATGCTCAGGGCACAGGCCAAGCCGCTGATTACAAGAGTACCCAGGCAGCTATTGACCAAATCACTGGGAAACTGAATAGACTTATTGAAAAGACCAATACTGAGTTCGAGTCAATAGAATCTGAGTTCAGTGAAATTGAACACCAGATCGGTAACGTCATCAATTGGACTAAGGACTCAATAACCGACATTTGGACTTATCAAGCTGAGCTATTGGTAGCAATGGAGAACCAGCACACAATCGATATGGCTGATTCAGAAATGTTGAATCTATATGAAAGAGTGAGAAAACAACTCAGGCAAAATGCAGAAGAAGATGGGAAAGGATGTTTCGAAATATATCACACTTGTGATGATTCATGCATGGAGAGCATAAGAAACAACACATACGACCATTCACAGTACAGAGAAGAAGCTATTTTAAAAAGACTGAATATCAACCCAGTGACACTCTCTTCTGGCTATAAAGACATCATTCTCTGGTTTAGCTTCGGGGCATCATGTTTTGTTCTTTTAGCCGTTGTCATGGGTCTTGTCTTCTTTTGTTTGAAAAATGGAAACATGCGATGCACAATCTGTATTTAGTTAAAAACACCCTTGT
SEQ ID NO.2
Serum type 4 avian adenovirus F i ber-2 gene sequence:
ATGCTCCGGGCCCCTAAAAGAAGACATTCCGAAAACGGGAAGCCCGAGACCGAAGCGGGACCTTCCCCGGCTCCAATCAAGCGCGCCAAACGCATGGTGAGAGCATCCCAGCTTGACCTGGTTTATCCTTTCGATTACGTGGCCGACCCCGTCGGAGGGCTCAACCCGCCTTTTTTGGGAGGCTCAGGACCCCTAGTGGACCAGGGCGGACAGCTTACGCTCAACGTCACCGATCCCATCATCATCAAGAACAGATCGGTGGACTTGGCCCACGACCCCAGTCTCGATGTCAACGCCCAAGGTCAACTGGCGGTGGCCGTTGACCCCGAAGGGGCCCTGGACATCACCCCCGATGGACTGGACGTCAAGGTCGACGGAGTGACCGTAATGGTCAACGATGACTGGGAACTGGCCGTAAAAGTCGACCCGTCCGGCGGATTGGATtCCACCGCGGGTGGACTGGGGGTCAGCGTGGACGACACCTTGCTCGTGGATCAGGGAGAACTGGGCGTACACCTCAACCAACAAGGACCCATCACTGCCGATAGCAGTGGTATCGACCTCGAGATCAATCCTAACATGTTCACGGTCAACACCTCGACCGGAAGCGGAGTGCTGGAACTCAACCTAAAAGCGCAGGGAGGCATCCAAGCCGACAGTTCGGGAGTGGGCGTTTCCGTGGATGAAAGCCTACAGATTGTCAACAACACTCTGGAAGTGAAACCGGATCCCAGCGGACCGCTTACGGTCTCCGCCAATGGCCTAGGGCTGAAGTACGACACTAATACCCTAGCGGTGACCGCGGGCGCTTTAACCGTGGTCGGAGGGGGGAGCGTCTCCACACCCATCGCTACTTTTGTCTCGGGAAGTCCCAGCCTCAACACCTACAATGCCACGACCGTCAATTCCAGCGCGAACGCCTTCTCTTGCGCCTACTACCTTCAACAGTGGAACATACAGGGGCTCCTTGTTACCTCCCTCTACTTGAAATTGGACAGCGCCACCATGGGGAATCGCCCTGGGGACCTCAACTCCGCCAATGCCAAATGGTTCACCTTTTGGGTGTCCGCCTATCTCCAGCAATGCAACCCCTCCGGGATTCAAGCGGGAACGGTCAGCCCCTCCACCGCCACCCTCACGGACTTTGAACCCATGGCCAATAGGAGCGTGACCAGCCCATGGACGTACTCGGCCAATGGATACTATGAACCATCCATCGGGGAATTCCAAGTGTTCAGCCCGGTGGTAACAGGTGCCTGGAACCCGGGAAACATAGGGATCCGCGTCCTCCCCGTGCCGGTTTCGGCCTCCGGAGAGCGATACACCCTTCTATGCTATAGTCTGCAGTGCACGAACGCGAGCATTTTTAATCCAAACAACAGCGGAACCATGATCGTGGGACCCGTGCTCTACAGCTGTCCAGCGGCCTCCCTCCCGTAA .
Claims (3)
1. Recombinant serum type 4 avian adenovirus expressing H10N3 avian influenza virus HA protein; the method is characterized in that: recombinant serum type 4 avian adenovirus for expressing H10N3 avian influenza virus HA protein based on CRISPR-Cas9 technology;
the sequence of the H10N3 avian influenza virus HA protein is shown as SEQ ID NO. 1;
the recombinant avian adenovirus type 4, wherein H10N3 avian influenza virus HA gene is used for replacing the avian adenovirus type 4 Fiber-2 gene, and the substitution is 253 to 1440 nucleotides of the avian adenovirus type 4 Fiber-2 gene.
2. The construction method of the recombinant serum type 4 avian adenovirus expressing the H10N3 avian influenza virus HA protein according to claim 1, which is characterized in that: the preparation method comprises the following steps:
(1) Designing sgRNA aiming at serum type 4 avian adenovirus Fiber-2 gene by utilizing an sgRNA online design website, wherein the sequence of the sgRNA is shown in table 1;
TABLE 1 sgRNA sequences for Fiber-2 genes
(2) Constructing donor plasmids carrying H10N3 avian influenza virus HA genes and RFP expression cassettes by a PCR and homologous recombination method, wherein both ends of the RFP expression cassettes are provided with LoxP sites, and primer sequences used in the PCR are shown in Table 2;
TABLE 2 PCR primers used to construct donor plasmids
(3) LMH cells were inoculated in 6-well plates and cultured overnight, 3. Mu.g of sgRNA and donor plasmid were co-transfected, and after 6h of transfection, the transfection supernatant was removed and culture medium was added; infection of recombinant adenovirus type 4 (FA 4-EGFP) expressing EGFP 12h after transfection, and cell maintenance fluid change after infection for 2 h;
(4) Observing RFP red fluorescence after the FA4-EGFP is infected, and purifying the red fluorescence recombinant virus by using a plaque test and a limiting dilution method to obtain recombinant serum 4 type avian adenovirus with an RFP expression cassette for expressing the HA protein of the H10N3 avian influenza virus;
(5) Inoculating purified red fluorescent recombinant virus into LMH cells transfected with Cre recombinase, inoculating infected cell supernatant into LMH cells transfected with Cre recombinase again after 4d, and repeating the process until the red fluorescent virus completely disappears; recombinant serum 4 type avian adenovirus expressing H10N3 avian influenza virus HA protein with RFP expression cassette removed was identified using PCR, IFA and Western Blot methods.
3. The method of preparation as claimed in claim 2, characterized in that: the recombinant virus FA4-EGFP expressing EGFP is characterized by being capable of expressing green fluorescent EGFP, is different from red fluorescent protein RFP of the recombinant virus, and is convenient for rapid purification of the recombinant virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410380705.4A CN118048323A (en) | 2024-03-31 | 2024-03-31 | Recombinant serum type 4 avian adenovirus expressing H10N3 avian influenza virus HA protein and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410380705.4A CN118048323A (en) | 2024-03-31 | 2024-03-31 | Recombinant serum type 4 avian adenovirus expressing H10N3 avian influenza virus HA protein and construction method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN118048323A true CN118048323A (en) | 2024-05-17 |
Family
ID=91051881
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410380705.4A Pending CN118048323A (en) | 2024-03-31 | 2024-03-31 | Recombinant serum type 4 avian adenovirus expressing H10N3 avian influenza virus HA protein and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN118048323A (en) |
-
2024
- 2024-03-31 CN CN202410380705.4A patent/CN118048323A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107502608B (en) | Construction method and application of sgRNA and ALDH2 gene-deleted cell strain for knocking out human ALDH2 gene | |
| CN112080521B (en) | Recombinant pseudorabies virus vector construction for expressing foreign protein and preparation method of recombinant pseudorabies virus | |
| JPH07265085A (en) | Recombinant poxvirus | |
| CN113061586B (en) | Recombinant serum 4 type avian adenovirus for expressing serum 8 type avian adenovirus fiber protein and preparation method thereof | |
| CN116463297A (en) | Recombinant serum type 4 avian adenovirus expressing chicken infectious anemia virus VP1 protein and preparation method thereof | |
| CN112458064A (en) | Gatasavir full-length infectious clone, replicon system, preparation and application thereof | |
| CN117511888A (en) | Recombinant serum type 4 avian adenovirus expressing chicken infectious anemia virus T1P6 strain VP2 protein based on CRISPR-Cas9 technology and preparation method thereof | |
| WO2019214110A1 (en) | Marburg virus vaccine with human replication-deficient adenovirus as vector | |
| CN110669735A (en) | System for inducing formation of HBV cccDNA and construction method | |
| CN101979598A (en) | Method for constructing HSV-1 BAC system carrying luciferase report genes | |
| CN114836418A (en) | CRISPR-Cas13d system for knocking down porcine epidemic diarrhea virus | |
| CN118048323A (en) | Recombinant serum type 4 avian adenovirus expressing H10N3 avian influenza virus HA protein and construction method thereof | |
| CN113736799B (en) | Construction method and application of goat parainfluenza virus 3-type infectious cDNA clone | |
| CN116970575A (en) | Recombinant serum type 4 avian adenovirus for expressing H7N9 avian influenza virus HA protein based on CRISPR-Cas9 technology and preparation method thereof | |
| CN113584080A (en) | Construction and application of Nluc-labeled recombinant porcine delta coronavirus infectious clone plasmid | |
| CN107034232B (en) | Application of ATG16L1 gene in enhancing replication capacity of Newcastle disease virus | |
| CN114214338A (en) | Porcine PIV5 full-length infectious clone and preparation method and application thereof | |
| CN114395568A (en) | Porcine epidemic diarrhea virus infectious cDNA clone and construction method and application thereof | |
| CN106893732A (en) | A kind of rescue method of Goose Parvovirus clone | |
| CN113061585A (en) | Recombinant serum type 4 avian adenovirus based on CRISPR-Cas9 technology and preparation method thereof | |
| CN116286685A (en) | Recombinant serum type 4 avian adenovirus expressing H9N2 avian influenza virus XZ491 strain HA protein based on CRISPR-Cas9 technology and preparation method thereof | |
| CN115786282A (en) | Construction of recombinant serum type 4 avian adenovirus of expressing duck type 3 adenovirus Fiber-2 protein | |
| CN114836392B (en) | PRRSV (porcine reproductive and respiratory syndrome virus) weak virus and preparation method and application thereof | |
| CN116426489A (en) | CRISPR-Cas9 technology-based recombinant serum 4-type avian adenovirus expressing novel goose astrovirus ORF2 protein C end and preparation method thereof | |
| CN109679952A (en) | A kind of pig source miR-c89 of anti-PRRSV infection and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination |