CN106893732A - A kind of rescue method of Goose Parvovirus clone - Google Patents

Abstract

The present invention relates to biological technical field, more particularly to a kind of rescue method of goose parvovirus (Goose parvovirus, GPV) infection clones.The method is that the complete genome group of GPV is cloned into vector plasmid pBSKNB, obtains recombinant plasmid；After recombinant plasmid is mixed with transfection reagent, nonimmune goose embryo is inoculated with by CAM approach, recombinant plasmid is saved in goose embryo；The pBSKNB carriers, are to replace original EcoRV and HindIII restriction enzyme sites on pBluescript II (SK) plasmid with NcoI and BclI sites respectively and obtain.The infectious virus that the present invention is produced can lethal goose embryo, Revive virus have consistent biological characteristics with parental virus.The rescue method is easy to operate efficiently, it is to avoid the cumbersome and inefficiency problem that transfectional cell brings, and has potential using value in the research of GPV reverse geneticses and vaccine initiative.

Description

A kind of rescue method of Goose Parvovirus clone

Technical field

The invention belongs to biological technical field, it is related to a kind of GPV infective cloned plasmids to transfect the letter of goose embryo Revive virus Just high efficiency method.

Background technology

The foster goose industry of China occupy first place in the world, is also goose consumption big country.Goose parvovirus is of young goose in 1 monthly age Important epidemic disease is planted, the death rate may be up to 90%, and the disease is popular at home from the last century 50, sixties.Though have developed at present weak Malicious vaccine is used for kind of goose or young goose, but the disease does not disappear from field, and still continuation causes economic loss to supporting goose industry.

Reverse Genetics are a kind of useful platforms for carrying out virus research, are illustrating viral pathogenesis mechanism and vaccine development In can play a significant role.Equally, Goose Parvovirus molecular cloning is built, based on this can be to the spy of GPV Determine gene and launch more efficiently research, be also a useful platform of GPV vaccine developments.

Virus rescue is the important ring on reverse genetic manipulation, is mostly that the plasmid or rna transcription product that will be built turn The approach of cell is contaminated to realize saving purpose.The goose embryo fibroblast of Transfected primary is saved infectivity GPV and is also had been reported that, for For parvovirus, cell is just most suitable for virus replication when being in division stage, therefore cell status are saved to transfection during transfection Rescue result influence very big.All in all, transfected on cell it is not only bothersome, rescue efficiency it is also not high.Therefore, if can set up One kind is easy, efficiently save method, will greatly facilitate and promote carrying out in a deep going way for GPV related basic researches.

The content of the invention

It is an object of the invention to provide a kind of goose parvovirus of simple and effective (Goose parvovirus, GPV) infection The rescue method of property cloned plasmids.

The rescue method of Goose Parvovirus cloned plasmids of the present invention, is by the complete genome group gram of GPV It is grand enter vector plasmid pBSKNB, obtain recombinant plasmid, after recombinant plasmid is mixed with transfection reagent, by CAM approach Nonimmune goose embryo is inoculated with, recombinant plasmid is saved in goose embryo；The pBSKNB carriers, are by commercialization Original EcoRV and HindIII restriction enzyme sites are replaced with NcoI and BclI sites respectively on pBluescript II (SK) plasmid And obtain.

Specifically：By recombinant plasmid and transfection reagent Lipofectamine 2000 according to a certain percentage 1:2.5(μg/μl) After ratio mixing, the nonimmune goose embryo of 11 ages in days is inoculated with by CAM approach.Goose embryo is after inoculation between 120h~192h Death, idiosome has typical GPV infection characteristics, shows as idiosome bleeding, the characteristic feature of CAM oedema.Save out Virus have the biological characteristics close with parental virus.

Further, in order to exclude the possibility that parent GPV strains pollute during transfection is saved, can be by overlap PCR method, introduces two synonymous base mutations as genetic marker inside the colone genome of recombinant plasmid, and what is obtained carries The recombinant plasmid of genetic marker imposes transfection and rescue process again.More specifically, can draw in the VP1 genes of recombinant plasmid Enter two mutating alkali yls as genetic marker.

In the present invention, described recombinant plasmid is insertion LH plants of complete genome group pLH plasmid of GPV, or inserts GPV LH plants of complete genome group simultaneously introduces the pLH Δ plasmids of genetic marker, but, rescue method of the invention is applied to but is not limited only to Insert the pLH plasmids or pLH Δ plasmids of LH plants of complete genome group of GPV.To the strong poison separation strains of other GPV or the weak poison of goose embryoization Strain, its full-length genome is cloned with identical construction method disclosed in present invention, obtains recombinant plasmid, the rescue side of recombinant plasmid Method is with pLH plasmids or pLH Δ plasmids.

Plasmid pLH of the present invention, its construction method is：Ultracentrifugation concentrates GPV LH strain virus, extracts disease The genome single stranded DNA of poison, distrand DNA is generated after external annealing.Sub-gene is generated from BclI and NcoI digestions genomic DNA Pack section, is cloned into the corresponding restriction enzyme site of the pBSKNB carriers of self reliant rebuilding respectively, then by the common molecular of digestion-connection Operation, splicing obtains the plasmid pLH containing complete genome group.

Further, by overlap PCR methods, two same sense mutation bases are introduced in the VP1 genes of pLH plasmids As genetic marker, plasmid pLH Δs are obtained.

Heretofore described close biological characteristics refers in goose embryo median lethal dose (ELD₅₀) and infection experiment in On young the two key indexs of the goose death rate, Revive virus have the numerical value close with parental virus.

The invention discloses LH plants of complete genomic sequence.LH pnca genes group is by 5047 base composition (SEQ IB NO.5), LH plants of ITR is by 414 base compositions, wherein 375 bases form palindrome, remaining 39 base constitutes D areas Sequence.The D region sequences of the ITR on the left of genome and the D ' sequence reverse complementals of right side ITR, this characteristic will cause gene component Son can form a larger range of palindrome.

As a specific operation, the invention discloses a kind of construction method of GPV genome clonings, the method pair Other GPV strains are equally applicable, and it comprises the following steps：

(1) extraction of GPV nucleic acid

GPVLH plants is bred in goose embryo, and the allantoic fluid of collection is concentrated to original volume through differential and ultracentrifugation respectively 1/50.Viral nucleic acid is extracted using SDS- RNA extraction based on proteinase K digestion.Through 95 DEG C of denaturation 10min, 65 DEG C of annealing are slowly cooled to, made Single-stranded DNA forms distrand DNA, through 0.8% agarose gel electrophoresis, about 5.1kb genomic DNAs can be observed.

(2) structure of genome cloning

The GPV LH pnca gene group distrand DNAs of extraction are carried out into double digestion with NcoI and BclI restriction enzymes, is produced The clip size of left, center, right three be respectively 0.6kb, 3.2kb and 1.3kb, each fragment gel extraction.By the left fragment gram of 0.6kb It is grand enter vector plasmid pBSKNB HincII-BclI between, produce pBSKNB-L plasmids.The intermediate segment of 3.2kb is inserted into matter Between the BclI-NcoI of grain pBSKNB, pBSKNB-M plasmids are produced.The right fragment of 1.3kb is inserted the NcoI-SmaI of pBSKNB Between site, pBSKNB-R plasmids are obtained.

On the basis of successful clone sub-genomic fragment and sequencing, by conventional digestion-attended operation, by each subunit Because of the correct splicing of pack section, so as to obtain comprising the LH plants of cloned plasmids pLH of complete genome group.

The invention also discloses the method that genetic marker in pLH plasmids is introduced, in order to by Revive virus and parental virus LH plants distinguishes (see accompanying drawing 5).

Two mutating alkali yls are introduced in the VP1 genes of pLH plasmids as genetic marker, amino acid composition is not changed, obtained Obtain plasmid pLH Δs.Using inside LH pnca gene groups single SexAI and NcoI sites are respectively present in plan mutational site both sides Condition, devises one group of overlap PCR primer, and primer code name and sequence are respectively：

overlap-1:GCAGGAACAATTACCAGGTACG(SexAI)(SEQ IB NO.1)

overlap-2:GTGGTCGGTAGTTCCCTGT(SEQ IB NO.2)

overlap-3:ACAGGGAACTACCGACCAC(SEQ IB NO.3)

overlap-4:CGGCCCATGGTGCCATAAGC(NcoI)(SEQ IB NO.4)

Square frame inside is mutating alkali yl, and two mutating alkali yls are respectively G → A mutation and T → C mutation, mutating alkali yl side Frame is represented.Contain SexAI and NcoI sites inside Overlap-1 primers and Overlap-4 primers respectively.

By overlap PCR, with reference to digestion attended operation, 2 mutating alkali yls can be introduced pLH plasmids, obtain matter Grain pLH Δs.

The invention also discloses the specific method that pLH Δs plasmid transfects goose embryo Revive virus by CAM：

Using Lipofectamine 2000 as transfection reagent.The ratio of plasmid and transfection reagent is according to 1：2.5(μg：μ L) carry out.Draw in 16 μ g pLH Δs plasmid solutions to 1 1.5ml centrifuge tube of sterilizing, use opti-DMEM nutrient solutions (Invitrogen, the U.S.) is diluted to 1ml；The transfection reagents of 40 μ l Lipofectamine 2000 are added in another centrifuge tube, 960 μ l Opti-DMEM nutrient solutions are added to mix.It is soft to mix after plasmid after dilution and transfection reagent are stood into 5min, room Temperature can be transfected after standing 20min.Every goose embryo passes through allantocherion vaccination 0.25ml, wherein comprising 2.0 μ g plasmids. Goose embryo starts death occur after inoculation on the 5th day, and to after transfecting the 8th day, the death rate reaches 75%.Revive virus energy on goose embryo It is enough successfully to pass on.

The present invention is determined to the biological characteristic of Revive virus.Result shows：The goose embryo half of Revive virus is caused Dead amount (ELD₅₀) reach every milliliter 5 × 10^4.77, the ELD of the latter very much like with parent LH plants₅₀It is every milliliter 5 × 10^4.36。1 Age in days young bird goose is vaccinated with the Revive virus and parental virus for carrying genetic marker respectively, within the observation period of 15 days, is inoculated with parent Virus organizes young goose and started death occur at the 3rd day, and Revive virus group death occurs on the 4th day after poison is attacked.To the 9th attacked after poison My god, two groups of young goose death rates have all reached 93.8%.And being inoculated with the control group young bird goose equal healthy growth of physiological saline, none is dead. Revive virus are attacked the dead young bird goose of poison group and equally show " gosling plague " characteristic lesion, including the formation of typical intestines bolt, intestinal mucosa The pathological change (see accompanying drawing 7) such as come off.Experiment shows that Revive virus have the biological characteristics close with parental virus.The rescue Method is easy to operate efficiently, it is to avoid the cumbersome and inefficiency problem that transfectional cell brings, in the research of GPV reverse geneticses and vaccine There is potential using value in initiative.

Brief description of the drawings

The genome dna electrophoresis analysis .M that LH plants of Fig. 1 .GPV：λ DNA/HindIII molecular weight markers.1：Extract Viral nucleic acid.

LH plants of construction strategy of full-length genome of Fig. 2 .GPV.

Fig. 3 is pLH plasmid maps.

The digestion identification .M of Fig. 4 .pLH plasmids：1kb ladder DNA molecular amount standard .1.NcoI digestions；2.XhoI and BamHI double digestions；3.SphI digestions.

The differentiation of Fig. 5 .pLH Δ plasmid transfection Revive virus and parent's velogen strain.The amplification target fragment of parent's velogen strain is used HindIII digestions, generate 0.9kb and the bar segments of 0.7kb two；And Revive virus are due to the base mutation for introducing, same 1.6kb Target fragment can not cut for HindIII.

Fig. 6 Revive virus and the challenge test of parental virus strain.There is death on the 3rd day after poison is attacked in parental virus, There is death on the 4th day after poison is attacked in Revive virus, and the 9th day after poison is attacked, two groups of survival rates all drop to 6.2%.

The intestinal lesion (A) of dead young bird goose and disease is extracted in Fig. 7 .pLH Δ Revive virus challenge tests from internal organs Malicious DNA is the sequencing results (B) of the pcr amplified fragment of template.

Specific embodiment

GPV LH plants of (Wang J, et al., Arch Virol, 2015,160 (3) that following methods for us separate: 711-718) launch, but described method is equally applicable other GPV strains.

The structure of 1.GPV genome cloning plasmids pLH

1.1. virus amplification

The GPV LH plants of 2nd generation goose embryo allantoic liquid that will be preserved, 1 is pressed with sterile saline:10 dilution proportions, addition green grass or young crops, Streptomysin being put and be inoculated with goose embryo after be incubated in 37 DEG C of incubators 30min to each 2000 μ g or IU/ml of final concentration.By diluted disease Venom is inoculated with 12 age in days goose embryos, every 0.2ml through allantoic cavity approach.It is put into after paraffin sealing in 37 DEG C of incubators, is shone every 8h Egg 1 time, dead goose embryo before rejecting 48 hours.Dead goose embryo after collecting 48 hours, is placed in 4 DEG C of refrigerators and places aseptic after 4~6h Allantoic fluid is collected, is stored in alternative in -40 DEG C of refrigerators.

1.2. viral purification

The about 400ml that will be collected into contains viral allantoic fluid and 20min is centrifuged by 11,000g, and 1/3 volume is added after taking supernatant Chloroform, acutely concussion, 20min is centrifuged with same centrifugal force rotating speed again, collects upper strata aqueous phase again through 150,000g centrifugal force Ultracentrifugation 3h (SW32Ti rotors, Beckman).Supernatant discarded, viral pellet 5ml TE buffer solutions (50mM Tris, 20mM EDTA, pH 8.0) to dissolve, -70 DEG C of preservations are stand-by.

1.3 viral DNAs are extracted

500 μ l concentrating virus liquid are taken, SDS and Proteinase K to final concentration of 1% and 400 μ g/ml is separately added into.45 DEG C of water Bath 2 hours.With phenol chloroform-isoamyl alcohol (25:24:1) with chloroform-isoamyl alcohol (24:1) each extracting 1 time.Supernatant adds 2.5 The absolute ethyl alcohol and the sodium acetate (pH 5.2) of 1/10th volumes of times volume, -70 DEG C of precipitates overnights.Next day 15,000rpm/ Min, is centrifuged 20min, removes supernatant, and nucleic acid precipitation uses 70% ethanol wash, and 15,000rpm/min, centrifugation 10min, go again Clearly, after precipitation airing, dissolved with 30 μ L STE buffer solutions (10mM Tris, 1mM EDTA, 100mM NaCL, pH 8.0).To carry The nucleic acid for taking is placed in 95 DEG C of water-bath 10min, makes single-stranded DNA that thermal denaturation to occur, and is then slowly cooled to 65 DEG C, now single-stranded DNA Can anneal to form double-strand.Take 10 μ L and analyze DNA through 0.8% agarose gel electrophoresis, see accompanying drawing 1.

1.4 genomic clones

For the ease of clone, our restriction enzyme sites to pBluescriptII (SK) plasmid (Agilent companies, the U.S.) Transformed, original EcoRV and HindIII restriction enzyme sites on plasmid are replaced with NcoI and BclI sites respectively, transformation Plasmid afterwards is named as pBSKNB.

The GPV LH pnca gene group distrand DNAs of extraction are carried out into double digestion with NcoI and BclI restriction enzymes, is produced The clip size of left, center, right three be respectively 0.6kb, 3.2kb and 1.3kb, each fragment gel extraction.By the left fragment gram of 0.6kb It is grand enter vector plasmid pBSKNB HincII-BclI between, produce pBSKNB-L plasmids.The intermediate segment of 3.2kb is inserted into matter Between the BclI-NcoI of grain pBSKNB, pBSKNB-M plasmids are produced.The right fragment of 1.3kb is inserted the NcoI-SmaI of pBSKNB Between site, pBSKNB-R plasmids are obtained, construction strategy is shown in accompanying drawing 2.

On the basis of completing that each subfragrnent is cloned and is sequenced, pBSKNB-L plasmids are carried out with XhoI and BclI double Digestion, by internal 0.6kb fragment gel extractions, after pBSKNB-M plasmids are equally linearized with XhoI and BclI double digestions, with 0.6kb fragments are attached generation recombinant plasmid pBSKNB-LM.Then further by pBSKNB-R plasmids NcoI and BamHI The 1.3kb fragments for generated after double digestion are inserted between the NcoI-BamHI sites of pBSKNB-LM plasmids, final to produce bag Containing the LH plants of cloned plasmids pLH of full-length genome, plasmid pLH collection of illustrative plates is shown in accompanying drawing 3.Fig. 4 is shown in the digestion identification of pLH plasmids.Build Recombinant plasmid converts DH5 α competent escherichia coli cells and is expanded.

1.5 genomic sequence analysis

Each sub-genomic fragment clone send Hua Da gene Shanghai Co., Ltd to be sequenced.Due to doing for ITR secondary structures Disturb and Bubble region sequences have the characteristics of inverting, therefore ITR sequences can not be measured directly.Exist using ITR loop areas single SphI restriction enzyme sites the fact, therefore the subcloned fragment comprising ITR fragments is carried out with SphI and XhoI or BamHI respectively double Digestion, the subfragrnent of generation is cloned into the corresponding site of pUC18 or pBSK plasmids respectively, converts DH5 α competent cells, positive Consistent ITR sequences can be obtained after cloning and sequencing.Using the SeqManII programs in DNASTAR software kits to surveyed fragment sequence Carry out splicing and obtain complete genome sequence, sequence homology analysis are carried out using MegAlign programs.

The introducing of 2.pLH plasmid genetic markers

Parental virus or the possibility of GPV street strains pollution in process of the test are may be from order to exclude Revive virus, is adopted With overlap PCR methods, the HindIII sites in VP1 genes introduce base mutation inside pLH plasmids, but do not change The composition of amino acid.

2.1 overlap PCR primers are designed

Using the bar for being respectively present single SexAI and NcoI sites inside LH pnca gene groups in plan mutational site both sides Part, devises one group of overlapping PCR primers, and primer is synthesized by the precious biology Co., Ltd in Dalian, and primer code name and sequence are respectively：

overlap-1:GCAGGAACAATTACCAGGTACG(SexAI)

overlap-2:GTGGTCGGTAGTTCCCTGT

overlap-3:ACAGGGAACTACCGACCAC

overlap-4:CGGCCCATGGTGCCATAAGC(NcoI)

Square frame inside is mutating alkali yl, and two mutating alkali yls are respectively G → A mutation and T → C mutation, mutating alkali yl side Frame is represented.Contain SexAI and NcoI sites inside Overlap-1 primers and Overlap-4 primers respectively.

2.2 overlap PCR are expanded

Using Pfu high-fidelity DNA polymerases (Takara, Dalian), expanded with overlap-1 primers and overlap-2 primers Increase the A fragments of 0.7kb, overlap-3 primers and overlap-4 primers expand the B fragments of 0.9kb.A, B amplified fragments are through 1% After agarose gel electrophoresis is separated, gel reclaims kit (Tiangeng bio tech ltd) gel extraction purpose is respectively adopted Fragment.

A, B product of recovery respectively take the template as second step pcr amplification reaction after 1 μ l mix.With overlap-1 and Overlap-4 is upstream and downstream primer.Reaction system is：The μ l of 10 × buffer 5, each 1 μ l of upstream and downstream primer, template 1 μ l, dNTP The μ l of 4 μ l, pfu high-fidelity DNA polymerase 0.5, ultra-pure water is mended to 50 μ l systems.Response procedures are set as：95 DEG C, 2min denaturation； Then 94 DEG C, 30s are performed；53 DEG C, 30s, 72 DEG C, 1min, 40s, totally 25 circulations；72 DEG C extend 5min and terminate.Expected amplification Fragment is 1.6kb.

After reaction terminates, after 50 μ l PCR product are separated through 0.8% agarose gel electrophoresis, gel extraction purpose Fragment.Purpose fragment SexAI and NcoI double digestions, after alcohol precipitation endonuclease bamhi, with the 20 ultrapure water dissolves of μ l.

2.3 mutational sites import pLH plasmids

The plasmid that methylates can not be cut in view of SexAI sites, therefore pLH plasmids are transferred to HST04 Host Strains (Takara, Japan) is methylated with eliminating plasmid.Then SexAI and NcoI double digestions are used, linearized fragment is separated by electrophoresis, then Gel extraction 6.4kb fragments.The 1.6kb mutant fragments for reclaiming are connected with 6.4kb fragments, connection product is transferred to DH5 α competence Cell, is coated with LB flat boards.Clone is inserted in mutation using the method for HindIII digestions plasmids to identify the positive, goes forward side by side one Step selection carries primer and send commercialization company to be sequenced, it is ensured that while mutational site correctly introduces, other sites are not sent out It is raw to change.Positive colony is named as pLH Δs.

The transfection rescue of 3.pLH Δ plasmids

3.1.pLH the purifying of Δ plasmid

Picking pLH Δs clone single bacterium colony, are inoculated in the LB culture mediums containing ampicillin (100 μ g/ml), 37 DEG C 16~24h of concussion and cultivate.Using the Miniprep kits plasmids of Qiagen companies, concrete operations are entered according to its specification OK.Using the nucleic acid determination instrument of Nanodrop 2000, plasmid purity is detected, it is ensured that OD260/280 is between 1.8-2.0.

3.2. the preparation of plasmid-transfection reagent mixtures

The preparation of transfection mixture is carried out with reference to the transfection reagent specifications of Lipofectamine 2000.Plasmid and transfection are tried The ratio of agent is according to 1:2.5(μg:μ L) carry out.Draw in 16 μ g plasmid solutions to 1 dactylethrae of sterilizing, use opti-DMEM Nutrient solution (Invitrogen) is diluted to 1ml；The transfection examinations of 40 μ l Lipofectamine 2000 are added in another centrifuge tube Agent, adds 960 μ l opti-DMEM nutrient solutions to mix.It is soft to mix after plasmid after dilution and transfection reagent are stood into 5min, Transfected by being stored at room temperature after 20min.

3.3. goose embryo is transfected

The above-mentioned transfection reagent for preparing, 8 11 age in days goose embryos, every goose embryonic breeding kind are inoculated with through CAM approach 0.25ml, wherein comprising 2.0 μ g plasmids.It is put into after paraffin sealing in incubator and is incubated, embryo is shone once every 8h, is discarded 24 hours Interior dead goose embryo.The allantoic fluid of 72h death goose embryos is collected, idiosome lesion is checked.Result shows that pLH Δs plasmid is urinated by fine hair Cyst membrane approach transfects 11 age in days goose embryos, and goose embryo starts death on the 5th day after inoculation, and to after transfecting the 8th day, the death rate reaches 75%.Test result indicate that, CAM approach transfected plasmids are adapted to the rescue of infectivity GPV, and dead goose embryo idiosome is presented The characteristic change of typical GPV infection, shows as idiosome bleeding and CAM oedema is thickened.

The passage of 3.4 Revive virus

The 1st generation virus allantoic fluid chloroform that will be saved out 1 time, with DNA enzymatic I (Promega, the U.S.) in 37 DEG C of works With 30min, with the DNA of remaining of degrading, then 1 is done with PBS：11 age in days goose embryos are inoculated with after 5 dilutions.

The differentiation of 3.5 Revive virus and parental virus

By PCR method, the about 1.6kb fragments of covering genetic marker site can be amplified, the fragment can not be HindIII is cut, and the 1.6kb fragments that the DNA extracted with parental virus goes out as template amplification, HindIII digestions are used, produce Two bar segments (Fig. 5) of 0.9-kb and 0.7-kb.Result of the test it is definite show Revive virus come from plasmid transfection rescue institute Produce, and be unlikely to be the result of parental virus or wild poison pollution.Sequence analysis to Revive virus is also indicated that, except as something lost 2 mutating alkali yls that mark is introduced are passed, other parts sequence is completely the same with parental array.

4. the biological characteristics of Revive virus

4.1 virus titer (ELD₅₀) measure

The new allantoic fluid containing Revive virus or parental virus collected is diluted to 10^-3、10^-4、10^-5With 10^-6Four dilutions Degree, 12 age in days goose embryos are inoculated with by allantoic cavity route of inoculation.Every goose embryonic breeding kind 0.2ml, each dilution factor is inoculated with 5 goose embryos. Continue to be incubated in 37 DEG C of incubators, discard dead goose embryo in 24h, Continuous Observation 10 days, every group of goose embryo death number of statistics is used Reed-Muench methods calculate virus titer.Result of the test shows：The ELD of Revive virus₅₀Reach every milliliter 5 × 10^4.77, with Parent LH plants very much like, the ELD of the latter₅₀It is every milliliter 5 × 10^4.36。

4.2 viruses neutralize experiment

200ELD₅₀Revive virus and parental virus LH plants mix with isometric GPV positive serums through 10 times of dilutions, 37 DEG C of incubation 30min, 5 12 age in days goose embryos are respectively inoculated with by allantoic cavity approach.Control group is then negative with virus liquid and GPV Serum mixes.Anti- GPV positive serums are prepared in the immune gaggle methods of GPV vaccine strains SYG61v.Neutralization test result table Bright, none is dead for 5 goose embryos that Revive virus and parental virus after being acted on GPV antiserums are inoculated with, and uses at physiological saline Goose embryo is all dead between 84-120 hours in the control group of reason, and it is consistent with parental virus that this shows that Revive virus possess Antigenicity.

4.3 young goose challenge viral dosages

48 susceptible young geese of 1 age in days are randomly divided into 3 groups.16 of 1st group young gooseneck portion's hypodermic injection 0.3ml containing 3 × 10⁴ELD₅₀Revive virus；LH plants of parental virus of the young gooseneck portion's hypodermic injection equivalent of 16 of the 2nd group；3rd group 16 young geese Injection sterile saline is used as negative control group.Three groups of young geese are respectively in single room isolated rearing 15d, and record is dead individual Number and death time, all dead young bird geese analyse observation pathological change, calculate the death rate and survival rate in different time points.

Result shows that two kind of 1 age in days young bird goose is vaccinated with the Revive virus and parental virus for carrying genetic marker respectively, 15 In it observation period, inoculation parental virus group young bird goose started death occurred at the 3rd day, and Revive virus group is the 4th day after poison is attacked Occur dead.By the 9th day attacked after poison, two groups of young goose death rates all reached 93.8% (Fig. 6).And it is inoculated with the right of physiological saline According to group equal healthy growth of young goose, none is dead.Revive virus are attacked the dead young bird goose of poison group and equally show " gosling plague " feature venereal disease Become, including typical intestines bolt is formed, intestinal mucosa such as comes off at the pathological change (Fig. 7 a).

4.4 pathological material of disease amplifying nucleic acids are detected

Take to attack to poison with poison and die young Goose Liver or intestinal tissue enters performing PCR detection.Liver or intestinal tissue are shredded, plus in right amount PBS grinds, and moves into 1.5ml centrifuge tubes, and 10000rpm is centrifuged 10min.Supernatant is transferred in new centrifuge tube, adds equivalent chlorine Imitative extracting 1 time, 10000rpm centrifugations 10min.Upper strata aqueous phase is transferred in another centrifuge tube, water-bath 10min in boiling water, 12000rpm is centrifuged 5min, draws supernatant and is used as amplification template.Made with the overlap-1 in overlap PCR and overlap-4 It is detection primer, amplified fragments are 1.6kb.PCR primer observes amplified band size after 1% agarose gel electrophoresis, cuts glue Reclaim purpose fragment.Digestion or PCR primer direct Sequencing method is carried out with HindIII to determine that dead young bird goose is to die from rescue disease Poison or parental virus.

Result shows, from liver, intestinal tissue extraction viral nucleic acid as DNA profiling, can amplify and be marked comprising heredity Remember specific fragment of the site in interior 1.6kb, these amplified fragments can not be cut by HindIII.To the direct of PCR primer Sequencing also confirms that in HindIII sites there are 2 default base mutations (Fig. 7 b), and this is absolutely proved attacks in Revive virus In malicious group, dead young bird goose comes from caused by the infection of rescue really, during challenge test being discharged, young goose infection parental virus or The possibility of the wild poison of other GPV.Current result of the test shows that Revive virus possess the virulence similar to parent's LH Strain.

SEQUENCE LISTING

<110>Yangzhou University

<120>A kind of rescue method of Goose Parvovirus clone

<130>

<160> 5

<170> PatentIn version 3.3

<210> 1

<211> 22

<212> DNA

<213>Artificial sequence

<400> 1

gcaggaacaa ttaccaggta cg 22

<210> 2

<211> 21

<212> DNA

<213>Artificial sequence

<400> 2

gtggtcggtg agtttccctg t 21

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence

<400> 3

acagggaaac tcaccgacca c 21

<210> 4

<211> 20

<212> DNA

<213>Artificial sequence

<400> 4

cggcccatgg tgccataagc 20

<210> 5

<211> 5047

<212> DNA

<213>Goose parvovirus LH plants

<400> 5

tcattggagg gttcgttcgt tcgaaccagc caatcagggg agggggaagt gacgcaagtt 60

ccggtgacgc acatccggtg acgtagttcc ggtcacgtgc ttcctgtcac gtgtttccgg 120

tcacgtgact tccggtcatg tgacttccgg tgacgtgttt ccggctgtta ggttgaccgc 180

gcgcatgcgc gcggttagcc caatagttaa gccggaaaca cgtcaccgga agtcacatga 240

ccggaagtca cgtgaccgga aacacgtgac aggaagcacg tgaccggaac tacgtcaccg 300

gatgtgcgtc accggaactt gcgtcacttc cccctcccct gattggctgg ttcgaacgaa 360

cgaaccctcc aatgagactc aaggacaaga ggatattttg cgcgccagga agtgacgtgc 420

aatgccaccc tatataaccc aggaaacttc cggtttagtt cattcgttac tctgctctca 480

gagagaacgg acctcaggtc ggagagatgg cactttctag gcctcttcag atttcttctg 540

ataaattcta tgaagttatc attagattac catcggatat tgatcaagat gtccccggtc 600

tgtctcttaa ctttgtagaa tggctttcta ccggagtttg ggagcccacg ggcatctgga 660

acatggagca tgtgaatcta ccgatggtga ccttggcaga gaagatcaag aacattttca 720

tacaaagatg gaatcagttc aaccaggacg aaacggactt cttctttcaa ctggaagaag 780

gcagtgagta cattcatctt cattgctgta ttgcccaggg caatgtacgg tcttttgttc 840

tcgggagata tatgtctcag ataaaagact ctatcataag agatgtatat gaagggaaac 900

aaatcaagat ccccgattgg tttgctatta ctaaaaccaa gaggggagga cagaataaga 960

ccgtgactgc agcatacata ctgcattacc ttattcctaa aaagcaacct gaactgcaat 1020

gggcctttac caatatgcct ttattcactg ctgctgctct ttgtctgcaa aagcggcaag 1080

aattgctgga tgcatttcaa gaaagtgatt tggctgcccc tttacctgat cctcaagcat 1140

caactgtggc accgcttatt tccaacagag cggcaaagaa ctatagcaac cttgttgatt 1200

ggctcattga aatggggata acatctgaga agcaatggct cactgagaac cgagagagct 1260

acagaagctt tcaagcaact tcttcaaata atagacaagt gaaagctgca ctggaaaatg 1320

cccgtgctga aatgttattg acaaagactg caaccgatta cctgatagga aaagaccctg 1380

tcctggacat aactaagaat agggtctatc agattctgaa aatgaataac tacaaccctc 1440

aatacatagg aagtatcctg tgcggctggg tgaagagaga gttcaacaaa agaaacgcca 1500

tatggctcta cggacctgcc accaccggga agaccaacat tgcagaagct attgcccatg 1560

ctgtaccctt ctatggctgt gttaactgga ctaatgagaa ctttcctttt aatgattgtg 1620

ttgataaaat gctgatttgg tgggaggagg gaaaaatgac taataaggtt gttgaatctg 1680

caaaagcaat tttaggaggg tctgctgtcc gggtagatca gaaatgtaaa ggatctgttt 1740

gtattgaacc tactcctgta attattacta gtaatactga tatgtgtatg attgttgatg 1800

gcaactctac tacaatggaa catagaatac cgttagagga gcgtatgttt caaatcgtcc 1860

tatcacataa attggagcct tcttttggaa aaatttctaa aaaagaagtc agagaatttt 1920

tcaaatgggc caatgataat ctagttcctg ttgtgtctga gttcaaagtc cgaacgaatg 1980

aacaaactaa cttgccagag cccgttcctg aacgagcgaa cgagccggag gagcctccta 2040

agatctgggc tcctcctact agggaggagt tagaagagct tttaagagcc agcccagaat 2100

tgttctcatc agtcgctcca attcctgtga ctcctcagaa ctcccctgag cctaagagaa 2160

gcaggaacaa ttaccaggta cgctgcgctt tgcatactta tgacaattct atggatgtat 2220

ttgaatgtat ggaatgtgag aaagcaaact ttcctgaatt tcaacctctg ggagaaaatt 2280

attgtgatga acatgggtgg tatgattgtg ctatatgtaa agagttgaaa aatgaacttg 2340

cagaaattga gcatgtgttt gaacttgatg atgctgaaaa tgaacaataa agatgactca 2400

aagcagatat gtctactttt ttagattctt ttgaagagtg gtatgaaact gcagccgcct 2460

cgtggcggaa tctgaaagct ggagcccctc acccaaaacc aaaccagcag actcagtctg 2520

tgtctccagc cagagaaccc gaacgaagag ataataaccg gggctttgta cttcctggct 2580

ataagtatct tggccctggt aacggccttg ataaagggcc acccgttaat aaggcggaca 2640

gcgtcgcgct tgaacacgac aaggcctacg accaacagct taaagcggga gacaacccat 2700

atataaaatt caatcacgct gaccaggact ttatagatag cctccaagac gaccagtcgt 2760

tcggaggtaa tcttggaaag gctgtatttc aggccaaaaa acgtatctta gaaccatttg 2820

gcctagtaga agatcctgtc aacacggcac ctgcaaaaaa aaatacaggg aagcttaccg 2880

accactaccc ggtagttaag aagcctaaac ttaccgagga agtcagtgcg ggaggtggta 2940

gtagtgccgt acaagacgga ggagccaccg cggagggcac cgaacctgtg gcagcatctg 3000

aaatggcaga gggaggaggc ggagctttgg gcgacgcttc agggggtgcc gatggagtgg 3060

gtaatgcctc gggaaattgg cattgcgatt cccaatggat gggaaacaca gtcatcacaa 3120

agaccaccag aacctgggtc ctgccaagct acaacaacca catctacaaa gcgattacca 3180

gtggaacctc tcaagatgca aatgtccagt atgcaggata cagtacccct tggggatact 3240

ttgatttcaa ccgcttccac tgccacttct cccctagaga ctggcagaga cttatcaaca 3300

accattgggg aatcagaccc aagtctctta aattcaagat cttcaatgtc caagtcaaag 3360

aagtcacaac gcaggatcag acgaagacca ttgcaaacaa tctcacgtca acaattcaag 3420

tctttacgga tgacgagcat caactcccgt atgtcctggg ctcggctacg gaaggcacca 3480

tgccgccgtt cccgtcggat gtctatgccc tgccgcagta cgggtattgc acaatgcaca 3540

ccaaccagaa cggtgcacga ttcaatgacc ggagtgcatt ctactgctta gaatacttcc 3600

ccagtcagat gctaagaaca ggcaacaact ttgagttcac gtttgacttt gaagaagttc 3660

ctttccacag catgttcgct cattcacagg acttagacag gctgatgaac cccttagtgg 3720

atcaatacct ctggaatttc aatgaggtag acagcagcag aaatgctcaa tttaaaaagg 3780

ctgtgaaagg cgcttatgga accatgggcc gcaattggct gccaggacct aaattcctgg 3840

accagagagt tagggcctat acaggcggaa cagataatta tgcaaactgg aacatctgga 3900

gtaatggaaa caaggttaat ttgaaggaca ggcagtacct cctgcaaccc ggacctgtat 3960

cagctactca tacagaagca gaggcttcca gtatcccagc ccaaaatatt ttaggtttag 4020

ctaaagatcc atacagatct ggcagcacta cagcaggaat aagtgatatt atggtcacgg 4080

acgagcagga agtagcacct acaaacggcg tagggtggaa accatatggc aagactgtaa 4140

cgaatgaaca aaacactact acagctccta caagttcaga tctggatgtt cttggagctt 4200

taccaggaat ggtttggcag aacagggata tatatctgca gggacctatt tgggcaaaaa 4260

taccgaagac tgatggtaaa ttccatcctt ctccgaatct cggaggattt ggtctgcaca 4320

atccaccacc gcaggtgttc atcaagaata caccagtgcc tgcagaccct ccagtagaat 4380

acgtgcacca gaagtggaat tcctacataa cccagtactc tacgggccag tgtacagtag 4440

agatggtgtg ggagctgaga aaagagaatt caaagagatg gaacccagaa atccagttca 4500

ccagtaattt cagtgacaga acaagcatca tgtttgcacc taatgaaact ggtggatatg 4560

tagaagatag attaattgga accagatatc taactcaaaa tctgtaaatt ctgtgtaaaa 4620

attcaaataa agcacttcct ggcgcgcaaa atatcctctt gtccttgagt ctcattggag 4680

ggttcgttcg ttcgaaccag ccaatcaggg gagggggaag tgacgcaagt tccggtgacg 4740

cacatccggt gacgtagttc cggtcacgtg cttcctgtca cgtgtttccg gtcacgtgac 4800

ttccggtcat gtgacttccg gtgacgtgtt tccggcttaa ctattgggct gaccgcgcgc 4860

atgcgcgcgg tcaacctaac agccggaaac acgtcaccgg aagtcacatg accggaagtc 4920

acgtgaccgg aaacacgtga caggaagcac gtgaccggaa ctacgtcacc ggatgtgcgt 4980

caccggaact tgcgtcactt ccccctcccc tgattggctg gttcgaacga acgaaccctc 5040

caatgag 5047

Claims (6)

1. a kind of rescue method of goose parvovirus (GPV) infective cloned plasmids, it is characterised in that be by the complete base of GPV Because group is cloned into vector plasmid pBSKNB, recombinant plasmid is obtained；After recombinant plasmid is mixed with transfection reagent, by fine hair allantois Film approach is inoculated with nonimmune goose embryo, and recombinant plasmid is saved in goose embryo；The pBSKNB carriers, are by pBluescript Original EcoRV and HindIII restriction enzyme sites are replaced and obtained with NcoI and BclI sites respectively on II (SK) plasmid.

2. the method for claim 1, it is characterised in that：By recombinant plasmid and transfection reagent Lipofectamine 2000 According to 1:After the mixing of 2.5 (μ g/ μ l) ratios, the nonimmune goose embryo of 11 ages in days is inoculated with by CAM approach；Goose embryo is in inoculation Dead between 120h~192h afterwards, idiosome has typical GPV infection characteristics, shows as idiosome bleeding, CAM oedema Characteristic feature.The virus saved out has the biological characteristics close with parental virus.

3. the method for claim 1, it is characterised in that described recombinant plasmid is pLH, and its construction method is：It is super Fast centrifugal concentrating GPV LH strain virus, extract the genome single stranded DNA of virus, and distrand DNA is generated after external annealing；From BclI Sub-genomic fragment is generated with NcoI digestions genomic DNA, the corresponding restriction enzyme site of pBSKNB carriers is cloned into respectively, then pass through The molecule manipulation of digestion-connection, splicing obtains the plasmid pLH containing complete genome group.

4. the method for claim 1, it is characterised in that introduce two inside the colone genome of described recombinant plasmid Individual synonymous base mutation as genetic marker, after the recombinant plasmid with genetic marker mixes with transfection reagent again, by fine hair Chorioallantoic membrane approach is inoculated with the nonimmune goose embryo of 11 ages in days, and the recombinant plasmid with genetic marker is saved in goose embryo.

5. method as claimed in claim 4, it is characterised in that the recombinant plasmid with genetic marker is pLH Δs, it Construction method is：Ultracentrifugation concentrates GPV LH strain virus, extracts the genome single stranded DNA of virus, and generation is double after external annealing Stock DNA；Sub-genomic fragment is generated from BclI and NcoI digestions genomic DNA, the corresponding of pBSKNB carriers is cloned into respectively Restriction enzyme site, then by the molecule manipulation of digestion-connection, splicing obtains the plasmid pLH containing complete genome group；Further pass through Overlap PCR methods, introduce two mutating alkali yls as genetic marker in the VP1 genes of pLH plasmids, obtain plasmid pLH Δ。

6. method as claimed in claim 2, it is characterised in that the close biological characteristics refers in goose embryo median lethal Amount (ELD₅₀) and infection experiment in young the two key indexs of the goose death rate on, Revive virus have it is close with parental virus Numerical value.