CN118028314A - Citrus plant height regulating gene CitBBX and application thereof - Google Patents

Abstract

The invention discloses a citrus plant height regulating gene CitBBX and application thereof, wherein the regulating gene CitBBX is CitBBX19 or CitBBX22, and the nucleotide sequences of the regulating gene are shown as SEQ ID No.1 and SEQ ID No. 2. The invention verifies the functions of citrus plant height regulating genes CitBBX and CitBBX genes in the internode elongation and plant height growth and development of citrus plants, and provides valuable gene resources for citrus dwarf variety cultivation by a molecular breeding mode. According to the invention, citBBX is introduced into citrus, the plant height of the transgenic plant is obviously increased, and CitBBX19 is edited in citrus, so that the plant height of the transgenic plant is obviously reduced. By introducing CitBBX into citrus, the plant height of the transgenic plant is significantly reduced, while in citrus, citBBX is edited, the plant height of the transgenic plant is significantly increased.

Description

Citrus plant height regulating gene CitBBX and application thereof

Technical Field

The invention relates to the field of plant genetic engineering, in particular to a citrus plant height regulating gene CitBBX and application thereof.

Background

Citrus is one of important economic fruit trees in China, and the industry of citrus plays an important role in the economic development of national economy in China and the adjustment of rural economic industry structures. In order to keep the red line of grain cultivated land, the cultivation area of fruit trees is restricted, which threatens the economic benefits of farmers and influences the dietary balance needs of residents in China. The molecular biological means is utilized to cultivate and improve the citrus varieties, so that the dwarf citrus varieties are hopeful to be cultivated, the cultivation density is improved, the mechanized cultivation is facilitated, and the purposes of increasing the citrus yield in unit area and improving the economic benefit are achieved.

Plant height is an important factor affecting plant type, yield and biomass, with internodes being an important component of plant height. The factors for regulating plant height mainly comprise endogenous hormone signals, exogenous illumination temperature and other environmental signals. Wherein, gibberellin (GA) which is a plant endogenous hormone is a key hormone affecting plant height, and the expression level of synthetic and metabolic genes determines the content of active GA. There have been many reports on transcriptional level regulation of GA pathway genes in model plants and crops. For example, HY5 is a key gene for the elongation and development of the hypocotyl of a plant, and can integrate hormone signals and environmental signals to synergistically regulate the growth of the plant.

At present, the molecular mechanism of how the environmental signals and GA signals in citrus regulate the growth and development of citrus plants is not clear, and no good practical effect is reported on how to use the signals to serve the actual production process and industrial development. On the one hand, citrus is used as perennial fruit tree crops, genetic transformation has certain difficulty, so that previous researches on screening candidate plant height regulatory genes from transcription level only establish a co-expression relationship with downstream genes, and less researches report specific regulatory functions and action molecular mechanisms of the candidate genes. On the other hand, although citrus has abundant resources for plant height and internode variation, no report has been made on systematic integration and screening of citrus plant height regulatory genes using these abundant resources. On one hand, from the aspect of molecular breeding, the aim of citrus dwarf breeding is fulfilled by promoting the expression of negative regulation plant height genes or inhibiting the expression of positive regulation plant height genes; on the other hand, in practical generation, the aim of dwarfing breeding can be achieved by controlling the upstream and downstream regulation signals and influencing the expression of related pathway genes.

In order to improve the cultivated land area of grain crops, the fruit industry is advocated to rise the hill and rise the hill, and the planting area of the fruit industry is restricted, so that the adjustment of the rural economic industry structure is influenced, and the rural economic development and the benefits of farmers are influenced. Therefore, the method has the advantages of utilizing abundant citrus resources, along with clear utilization effect, good effect and strong operability, and can regulate plant height candidate genes, cultivate dwarf closely planted citrus, improve the fruit yield per unit area, promote economic development and protect the benefits of farmers.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a citrus plant height regulating gene CitBBX and application thereof. And candidate genes CitBBX for regulating internode elongation and plant height development are identified by transcriptome screening, wherein the candidate genes CitBBX are two genes, namely CitBBX19 and CitBBX19 respectively, and provide gene resources and key targets for citrus dwarf molecular design breeding.

In order to achieve the above purpose, the invention designs a technical scheme that:

The invention provides a citrus plant height regulating gene CitBBX, wherein the regulating gene CitBBX is CitBBX19 or CitBBX22, and the nucleotide sequence of CitBBX19 is shown as SEQ ID No. 1; the nucleotide sequence of CitBBX is shown as SEQ ID No. 2.

The invention also provides a protein CitBBX encoded by the citrus plant height control gene CitBBX, wherein the protein CitBBX is protein CitBBX or protein CitBBX22, and the amino acid sequence of the protein CitBBX19 is shown in SEQ ID No. 3; the amino acid sequence of the protein CitBBX is shown as SEQ ID No. 4.

The invention also provides a primer pair for obtaining the citrus plant height regulating gene CitBBX, when the regulating gene CitBBX is CitBBX19, the primer pair CitBBX F/R for obtaining CitBBX19 is:

CitBBX19 primer F:5'-ATGCGAACGCTTTGCGAC-3' the process of the preparation of the pharmaceutical composition,

CitBBX19 primer R:5'-TCAATTTTCAGGCTCTCTTTTGAA-3';

Or, when the regulatory gene CitBBX is CitBBX, the primer pair CitBBX F/R for obtaining CitBBX22 is:

CitBBX22 primer F:5'-ATGAGGATACAGTGCAACGTATGC-3', citBBX22 primer R:5'-TTACTGCAACCGCCTTCTTG-3'.

The invention also provides a citrus CitBBX over-expression vector, when the citrus CitBBX over-expression vector is pK7WG2D-CitBBX19, the citrus CitBBX over-expression vector contains the CitBBX gene;

Or, when the citrus CitBBX over-expression vector is pK7WG2D-CitBBX, the citrus CitBBX over-expression vector contains the CitBBX gene.

The invention also provides a citrus CitBBX editing vector, the citrus CitBBX editing vector is pCAMBIA1300-pYAO, when Cas9: citBBX19 is adopted, the citrus CitBBX editing vector is a vector containing the CitBBX19 gene editing target,

Or when the citrus CitBBX editing vector is pCAMBIA 1300-pYAO:Cas9: citBBX22,

The citrus CitBBX editing vector is a vector containing the CitBBX gene editing target.

The invention also provides a recombinant host cell which is a citrus CitBBX editing vector containing the citrus CitBBX over-expression vector or the citrus CitBBX editing vector, wherein the host cell is escherichia coli DH5 alpha.

The invention also provides an application of the citrus plant height regulating gene CitBBX in citrus dwarf breeding.

The invention also provides an application of the citrus plant height regulating gene CitBBX or the citrus plant height regulating gene CitBBX in citrus dwarf breeding.

The application of one of the following in citrus dwarf breeding,

(1) The citrus plant height control gene CitBBX;

(2) The citrus CitBBX over-expression vector;

(3) Citrus CitBBX editing vector as described above;

(4) Recombinant host cells as described above.

The invention has the beneficial effects that:

the invention verifies the functions of citrus plant height regulating genes CitBBX and CitBBX genes in the internode elongation and plant height growth and development of citrus plants, and provides valuable gene resources for citrus dwarf variety cultivation by a molecular breeding mode.

According to the invention, the citrus plant height regulating gene CitBBX and the transgenic plant are introduced into citrus, the plant height of the transgenic plant is obviously increased, and the plant height of the transgenic plant is obviously reduced when CitBBX is edited in the citrus. The citrus plant height control gene CitBBX is introduced into citrus, the plant height of the transgenic plant is obviously reduced, and CitBBX is edited in the citrus, and the plant height of the transgenic plant is obviously increased. The CitBBX gene and the CitBBX gene are indicated to be used for citrus dwarf breeding.

The invention discloses application of citrus plant height regulation transcription factors CitBBX and CitBBX genes in citrus dwarf breeding. The present invention finds that CitBBX < 19 > is low expressed in the top buds of the internode lime and CitBBX < 22 > is high expressed in the hypocotyl of the internode lime relative to normal length internode lime material. The over-expression CitBBX < 19 > in the citrus model material, namely the citrus acronychia praecox, promotes the growth and development of plants, increases the plant height, and edits the growth and development abnormality of CitBBX < 19 > plants, and obviously reduces the plant height. In contrast, the plants overexpressing CitBBX in acronychia, citrus sinensis and marjoram showed abnormal growth and development, with significantly reduced internode and plant height, while editing CitBBX in acronychia promoted growth and development of internode and plant height. To further investigate the cause of CitBBX to regulate citrus plant growth, transcriptome sequencing was performed on the acronychia plants overexpressing CitBBX and editing CitBBX22, and the results showed that GA pathways were significantly regulated, wherein the expression of the GA degradation pathway key gene CitGA ox8 was directly regulated by CitBBX 22. Biochemical experiments showed that CitBBX and CitHY5 formed a complex that could directly bind and activate the expression of CitGA2ox 8. Meanwhile, the exogenous active GA ₃ can restore the citrus internode shortening and plant dwarfing phenotype caused by the overexpression of CitBBX22, and further shows that CitBBX is used for regulating the growth and development of citrus plants by mediating GA metabolism. The research result reveals that CitBBX and CitBBX can be used as key target genes for citrus dwarf molecular design breeding.

Drawings

FIG. 1 is a CitBBX and CitBBX identification and amplification plot;

In the figure, A is a statistical diagram of the length of the branch tips and internodes of 16 identified by screening and representing citrus resources,

B is a cluster diagram of the identified short internode lime material SISO and 9 normal internode lime materials,

C is a schematic diagram of the branch tips of the short section intermodal lime material SISO and the normal intermodal lime material CDSO,

D is CitBBX showing the expression of SISO and CDSO shoot apical buds,

E is a schematic of SISO and CDSO seedlings,

F is a schematic diagram of SISO and CDSO seedling hypocotyl lengths,

G is a map of CitBBX for expression of SISO and CDSO in the internode of the hypocotyl.

FIG. 2 is a diagram showing the positive identification of CitBBX and CitBBX22 overexpressing citrus plants and editing citrus plants;

In the figure, A is a map of the overexpression multiple of CitBBX (19) over-expressing acronychia,

B is a fold over-expression diagram of CitBBX over-expression dark orange,

C is CitBBX over-expression fold graph of the Marshall shaddock,

D is CitBBX an editing situation diagram of the acronychia editing,

E is CitBBX an editing situation diagram of the acronychia editing,

F is CitBBX over-expression fold map of the Marshall shaddock.

FIG. 3 is a plant height phenotype identification chart of CitBBX19 over-expressed citrus plants and edited citrus plants;

In the figure, A is CitBBX19 phenotype chart of the over-expressed acronychia,

B is a schematic diagram of CitBBX19 over-expressed plant height of acronychia,

C is CitBBX an edit line bergamot phenotype map,

D is a schematic diagram of the plant height of CitBBX edited line acronychia.

FIG. 4 is a plant height and internode phenotype identification plot of CitBBX over-expressed citrus plants and edited citrus plants;

in the figure, A is CitBBX an edit series acronychia plant diagram,

B is CitBBX an edit line acronychia plant height map,

C is CitBBX an edit series acronychia internode length chart,

D is CitBBX a map of a CitBBX over-expressed acronychia plant,

E is CitBBX an over-expression acronychia plant height chart,

F is CitBBX an internode length diagram of the ultra-expressed acronychia plant,

G is CitBBX22 over-expression dark Liu Tiancheng plant graph,

H is CitBBX22 over-expression dark Liu Tiancheng plant height map,

I is CitBBX22 over-expression dark Liu Tiancheng plant internode length diagram,

J is CitBBX a map of a CitBBX over-expressed grapefruit plant,

K is CitBBX a plant height diagram of the super-expressed grapefruit,

L is CitBBX and the length chart of the internode of the super-expression grapefruit plant.

FIG. 5 is a diagram of exogenous GA ₃ spray treatment CitBBX over-expressing citrus plants;

In the figure, A is a figure before and after the CitBBX over-expression of the acronychia stenocardia fruit and the GA ₃ is sprayed,

B is a plant height chart before and after CitBBX over-expression of acronychia stenocardia and GA ₃ treatment,

C is CitBBX an internode length diagram of plants before and after the treatment of the ultra-expressed acronychia with GA ₃,

D is CitBBX plants graph before and after super-expression dark Liu Tiancheng GA ₃ treatment is sprayed,

E is a plant height chart before and after the treatment of CitBBX over-expressed dark orange spray GA ₃,

F is CitBBX an internode length diagram of plants before and after the treatment of carrying out the super-expression on dark orange by spraying GA ₃,

G is CitBBX and shows the plant diagram before and after GA ₃ is sprayed on the super-expressed grapefruit,

H is CitBBX a plant height chart before and after the GA ₃ is sprayed to the super-expressed grapefruit,

I is a map of internode length of plants before and after CitBBX over-expressing the grapefruit and spraying GA ₃.

Detailed Description

The present invention is described in further detail below in conjunction with specific embodiments for understanding by those skilled in the art.

Example 1CitBBX and CitBBX Gene acquisition

By analyzing the internode length of 16 citrus resources, the short internode lime with the shortest internode was screened (fig. 1A). Clustering analysis of the 10 lime materials showed that the capital lime and the inter-nipple lime were clustered together (fig. 1B). Each internode of short internode lime is shorter than adult lime (fig. 1C). Therefore, the materials of the short internode lime and the adult lime are selected, and the regulation and control mechanism of the growth and development of the short internode and the plant height is researched. By analyzing the shoot apical bud transcriptome of the mature lime and the interstice lime, citBBX genes were identified by screening, which were significantly highly expressed in the mature lime terminal buds (fig. 1D). Further we found that the length of the seedling hypocotyl of the interpup lime was also significantly shorter than that of the mature lime (fig. 1e,1 f), and that CitBBX genes were identified by analysis of the transcription sets of the seedling hypocotyls of the mature lime and the interpup lime, which were significantly highly expressed in the interpup lime hypocotyl (fig. 1G). CitBBX19 and CitBBX belong to the fourth subfamily of BBX family, which are key genes in photomorphogenesis, and members BBX18 and BBX23 report a synergistic regulation of the elongation of the hypocotyl of arabidopsis in response to temperature. The formation of the complex of BBX20/BBX21 and HY5 in tomato regulates hypocotyl elongation in response to UV-B. Therefore, citBBX and CitBBX are considered to be possible candidate regulatory factors for regulating the internode elongation and the growth and development of citrus plants.

The primer pair is designed by utilizing the sweet orange reference genome sequence:

CitBBX19 primer F:5'-ATGCGAACGCTTTGCGAC-3' the process of the preparation of the pharmaceutical composition,

CitBBX19 primer R:5'-TCAATTTTCAGGCTCTCTTTTGAA-3'.

CitBBX22 primer F:5'-ATGAGGATACAGTGCAACGTATGC-3' the process of the preparation of the pharmaceutical composition,

CitBBX22 primer R:5'-TTACTGCAACCGCCTTCTTG-3'.

The invention uses the DNA and cDNA of the lime leaves as templates and uses the sweet orange reference genome sequence as reference to carry out PCR amplification; the PCR products are obtained, and the CitBBX and CitBBX genes (the full-length CDS sequences of CitBBX and CitBBX) are obtained by sequencing, wherein the nucleotide sequence of CitBBX19 is shown as SEQ ID No.1, the nucleotide sequence of CitBBX22 is shown as SEQ ID No.2, and the amino acid sequence of CitBBX19 is shown as SEQ ID No.3 and the amino acid sequence of CitBBX is shown as SEQ ID No. 4.

Example 2CitBBX and CitBBX Gene overexpression vector construction

The expression vector pDONR221 is taken as an intermediate vector, pK7WG2D (given by Andrew C.Allan professor of New Zealand plant and food institute) is taken as a final vector, CDS fragments CitBBX and CitBBX are respectively inserted into the pK7WG2D vector by gateway recombination technology, and expression is driven by a 35S promoter; electrophoresis detection and sequencing analysis show that the citrus CitBBX over-expression vector and the citrus CitBBX over-expression vector are successfully obtained, namely the vectors are named as pK7WG2D-CitBBX19 and pK7WG2D-CitBBX, and the specific experimental steps are as follows:

1. Citrus CitBBX and citrus CitBBX gene amplification

Gateway cloning technology primers were designed for PCR amplification based on CDS sequences CitBBX, 19 and CitBBX. The primer sequences were as follows:

First round PCR amplification primers:

attb1_ CitBBX19_ox primer F:

5’-AAAAAGCAGGCTCCATGCGAACGCTTTGCGAC-3’，

attb1_ CitBBX19_ox primer R:

5’-AGAAAGCTGGGTTTCAATTTTCAGGCTCTCTTTTGAA-3’。

attb1_ CitBBX22_ox primer F:

5’-AAAAAGCAGGCTCCATGAGGATACAGTGCAACGTATGC-3’，

attb1_ CitBBX22_ox primer R:

5’-AGAAAGCTGGGTTTTACTGCAACCGCCTTCTTG-3’。

second round PCR amplification primers:

Adapter attB primer F:

GGGGACAAGTTTGTACAAAAAAGCAGGCT，

adapter attB primer R:

GGGGACCACTTTGTACAAGAAAGCTGGGT。

PCR amplification was performed using Vazyme Phanta Max Super-FIDELITY DNA polymerase for 2 rounds to obtain PCR products.

The first round PCR reaction was as follows (total volume 20. Mu.l):

the reaction procedure is: 95 ℃ for 3min;95 ℃ for 15s;55 ℃,15s;72 ℃,30s;72 ℃ for 5min;35 cycles;

the second round PCR reaction was performed as follows (total volume 50. Mu.l):

2×Phanta Max Buffer	25μl
		dNTP Mix	1μl
Adapter attB1-F	2μl
		Adapter attB1-R	2μl
Phanta Max Super-Fidelity DNA Polymerase	1μl
		First round PCR products	1μl
ddH2O	18μl

The reaction procedure is: 95 ℃ for 3min;95 ℃ for 15s;55 ℃,15s;72 ℃,30s;72 ℃ for 5min;35 cycles;

And 2, detecting and recovering PCR product glue: the PCR products were detected by agarose gel electrophoresis. Recovering the target fragment by using BIOMIGA gel recovery kit;

bp reaction: BP reaction is carried out by using Thermofisher BP clonase enzyme; the reaction system is as follows:

Gently sucking and beating by using a pipette, uniformly mixing, and collecting the reaction liquid to the bottom of a centrifuge tube after short centrifugation; water bath at 25 ℃ for 12 hours;

4. conversion of the product: the product transformed DH 5. Alpha. Competent cells were prepared according to the molecular cloning protocol.

5. Sequencing and identification: and (3) carrying out sequencing analysis after PCR identification of positive clones, and extracting plasmids from the single clone which is sequenced successfully, namely the intermediate vector of the pDONR221-CitBBX19 and the pDONR 221-CitBBX. The PCR positive detection and sequencing primers were as follows:

pDONR221 primer F:5'-GTAAAACGACGGCCAG-3' the process of the preparation of the pharmaceutical composition,

PDONR221 primer R:5'-CAGGAAACAGCTATGAC-3'.

Lr reaction: performing BP reaction by using Thermofisher LR clonase enzyme; the reaction system is as follows:

Gently sucking and beating by using a pipette, uniformly mixing, and collecting the reaction liquid to the bottom of a centrifuge tube after short centrifugation; water bath at 25 ℃ for 12 hours;

7. Conversion of the product: the product transformed DH 5. Alpha. Competent cells were prepared according to the molecular cloning protocol.

8. Sequencing and identification: and (3) carrying out sequencing analysis after PCR identification of positive clones, and extracting plasmids from the single clone which is sequenced successfully, namely the overexpression vectors of pK7WG2D-CitBBX and pK7WG 2D-CitBBX. The PCR positive detection and sequencing primers were as follows:

pK7WG2D primer F:5'-GACGCACAATCCCACTATCC-3' the process of the preparation of the pharmaceutical composition,

PK7WG2D primer R:5'-TAGAGGGCCCGACGTCGCAT-3'.

EXAMPLE 3 construction of BBX19 and BBX22 Gene-editing vectors

Based on pCAMBIA 1300-pYAO:Cas9 vector (professor Xie Qi of the national academy of sciences of China), the target spots of CitBBX and CitBBX22 are respectively inserted into pCAMBIA 1300-pYAO:Cas9 by homologous recombination, and expression is driven by YAO promoter. Electrophoresis detection and sequencing analysis show that: the citrus CitBBX and CitBBX22 gene editing construction named pCAMBIA1300-pYAO:: cas9: citBBX19 and pCAMBIA1300-pYAO:: cas9: citBBX22 were successfully obtained, and the specific experimental steps are as follows:

1. Design of target primers

According to the DNA sequence design of the acronychia CitBBX and CitBBX, a citrus database (http:// citrus. Hzau. Edu. Cn/crispr/query. Php) is utilized to search for targets, and the target primers with high scores and good specificity are screened as follows:

CitBBX19-gRNA-1 primer F:

5’-ATTGGCTTGCTAGTCGTCATGTGA-3’，

CitBBX19-gRNA-1 primer R:

5’-AAACTCACATGACGACTAGCAAGC-3’，

CitBBX19-gRNA-2 primer F:

5’-ATTGTTGGTGGTAAAAGAACCCAT-3’，

CitBBX19-gRNA-2 primer R:

5’-AAACATGGGTTCTTTTACCACCAA-3’，

CitBBX22-gRNA-1 primer F:

5’-ATTGATACAGTGCAACGTATGCGA-3’，

CitBBX22-gRNA-1 primer R:

5’-AAACTCGCATACGTTGCACTGTAT-3’，

Construction of sgRNA case

2.1 Target primer annealing

Dissolving target primer into 10 mu M mother solution with water, adding 80 mu L of 0.5 xTE (pH 8.0) into 10 mu L of each mother solution, and obtaining the final concentration of 1 mu M; heating at 98deg.C for 3min in PCR instrument, immediately taking out PCR tube, and naturally cooling to room temperature for connection.

2.2 Construction of sgRNA case

1 Μg of AtU-26-sgRNA-SK plasmid was taken and digested with the Bsa I enzyme of Thermofisher, the reaction system was as follows:

Gently sucking and beating by using a pipette, uniformly mixing, and collecting the reaction liquid to the bottom of a centrifuge tube after short centrifugation; water bath at 37 ℃ for 2h; the cleaved products were detected using agarose gel electrophoresis.

Recovering the target fragment by using BIOMIGA gel recovery kit; and then carrying out target point connection reaction.

Connecting at room temperature (20-25deg.C) for 30min; the ligation products were transformed into DH 5. Alpha. Competent cells, see molecular cloning guidelines.

Sequencing and identification: and (3) carrying out sequencing analysis after PCR identification of positive clones, and extracting plasmids from the single clone with successful sequencing. The PCR positive detection and sequencing primers were as follows:

SK-gRNA primer F:5'-CTCACTATAGGGCGAATTGG-3' the process of the preparation of the pharmaceutical composition,

The SK-gRNA primer R is the primer R of the corresponding target point in the step 1,

CitBBX19-gRNA-1 primer R:

5’-AAACTCACATGACGACTAGCAAGC-3’，

CitBBX19-gRNA-2 primer R:

5’-AAACATGGGTTCTTTTACCACCAA-3’，

CitBBX22-gRNA-1 primer R:

5’-AAACTCGCATACGTTGCACTGTAT-3’。

2.3 binary vector construction

1) Cas9 plasmid is used for enzyme digestion of pCAMBIA1300-pYAO

Cas9 plasmid was taken at 1. Mu.g of pCAMBIA1300-pYAO, and cleavage was performed using the SpeI enzyme of Thermofisher in the following reaction system:

Gently sucking and beating by using a pipette, uniformly mixing, and collecting the reaction liquid to the bottom of a centrifuge tube after short centrifugation; enzyme cutting for 2h, and inactivating at 80 ℃ for 20min; adding 0.2 mu L of alkaline phosphatase CIAP, reacting at 37 ℃ for 10min, carrying out dephosphorylation treatment on the carrier, detecting an enzyme digestion product by agarose gel electrophoresis, and recovering a target fragment by using BIOMIGA gel recovery kit;

2) SGRNA CASSETTE ligation reaction

Connecting at room temperature (20-25deg.C) for 30min; the product was transformed into DH 5. Alpha. Competent cells, reference molecular cloning protocols.

Sequencing and identification: and (3) carrying out sequencing analysis after PCR identification of positive clones, and extracting plasmids from the single clone which is successfully sequenced, namely pCAMBIA1300-pYAO: citBBX 19:Cas9 and pCAMBIA 1300-pYAO:Cas9: citBBX. The PCR positive detection and sequencing primers were as follows:

1300-gRNA-F：5’-CCAGTCACGACGTTGTAAAAC-3’，

1300-gRNA-R：5’-CAATGAATTTCCCATCGTCGAG-3’。

Example 4CitBBX and CitBBX22 over-expression of the orange positive line and the orange CitBBX and CitBBX editing lines were obtained

1. Citrus epicotyl stem transformation

And (3) the constructed over-expression vector and the editing vector are subjected to agrobacterium strain EHA105, and a transgenic positive line is obtained through a citrus epicotyl stem infection method. The specific method comprises the following steps:

Sterilizing the seeds of the fruits of acronychia, scotopic Liu Tiancheng and grapefruit, sowing in MT culture medium, and dark culturing in 28 deg.C incubator for 30 days. Transferring to 16h/8h (Light/Dark) illumination culture, and carrying out infection experiment after the epicotyl turns to Light green.

The agrobacterium strain EHA105 carrying the target vector is streaked on a flat plate, and after inversion culture for 2 days at 28 ℃, the agrobacterium is resuspended to OD _600nm =0.6 by using a citrus suspension medium, acetosyringone is added to a final concentration of 20mg/L, and then the mixture is stood and activated for 1 hour at 28 ℃.

Cutting the green-turned epicotyl into stem segments with the length of 1cm, transferring the stem segments into activated agrobacterium tumefaciens bacteria solution, carrying out shake table infection for 20min at the temperature of 28 ℃ and the speed of 200rpm/min, and vacuumizing for 5min. The stem sections after the dip-dyeing are transferred to a citrus co-culture medium and are subjected to dark culture at 22 ℃ for 3 days. Transferred to a screening medium and dark cultured at 25℃for 7 days. The stem segments are transferred into a 16h/8h (Light/Dark) illumination culture room with 28 ℃ Light for bud growth culture, positive seedlings are screened by green fluorescence screening markers (GFP), and then grafting and culture of the positive seedlings are carried out.

2. Screening of Positive lines

Screening CitBBX and CitBBX22 over-expressed orange positive lines, screening orange plants with green fluorescence by using a handheld fluorometer, performing DNA extraction and RNA extraction on the initially screened orange plant leaves, and performing positive line identification by using PCR amplification and qRT-PCR quantification modes. Co-screening CitBBX of the over-expressed plant 3, designated CitBBX #2, citBX 19#3, citBX 19#4 (FIG. 2A); citBBX22 mountain Jin Ganchao of 22 expressed plant 6, designated SJG-CitBBX22#1, SJG-CitBBX22#7, SJG-CitBBX22#21, SJG-CitBBX22#22, SJG-CitBBX22#24, SJG-CitBBX22#26 (FIG. 2F). CitBBX22 dark Liu Tiancheng overexpressing plant 3, designated AL-CitBBX22#1, AL-CitBBX22#2 (FIG. 2B). CitBBX22 Malus pummelo over-expression plant 2 was designated as MJY-CitBBX22#1, MJY-CitBBX22#2 (FIG. 2C).

The PCR amplification primers and qRT-PCR quantitative primers were as follows:

PCR amplification primer:

pK7WG2D primer F:5'-GACGCACAATCCCACTATCC-3' the process of the preparation of the pharmaceutical composition,

Attb1_ CitBBX19_ox primer R:

5’-AGAAAGCTGGGTTTCAATTTTCAGGCTCTCTTTTGAA-3’。

attb1_ CitBBX22_ox primer R:

5’-AGAAAGCTGGGTTTTACTGCAACCGCCTTCTTG-3’。

qRT-PCR quantitative primers:

qRT-PCR-CitBBX primer F:

5’-TCTTGCGACGAAAAGGTCCATA-3’，

qRT-PCR-CitBBX primer R:

5’-GTGGGACATCACTGGGGTTAGC-3’，

qRT-PCR-CitBBX primer F:

5’-TTCACGCCGCCAATAAGCTA-3’，

qRT-PCR-CitBBX primer R:

5’-TTCCTGCAGAGTAAGGCTCG-3’，

Screening CitBBX and CitBBX22 editing system orange positive lines, screening orange plants with green fluorescence by using a handheld fluorometer, extracting DNA from the initially screened orange plant leaves, and identifying the positive lines by using PCR amplification and Hi-TOM sequencing. The edited plant 5 of CitBBX19 was co-selected and designated citbbx g1#2, citbbx19g1#3, citbbx19g1#7, citbbx19g1#8, citbbx19g2#6 (FIG. 2D), the edited plant 4 of CitBBX22, designated citbbx22#5, citbbx22#11, citbbx22#13, citbbx22#32 (FIG. 2E), and the PCR amplification primers were as follows:

CitBBX19 primer F1 of 19-HiTOM:

GGAGTGAGTACGGTGTGCGTTACCCTTCGTGTTTTGGTACA

CitBBX19-HiTOM primer R1:

GAGTTGGATGCTGGATGG ACCAGGTGCATTTTCACAGAT

CitBBX19 primer F2 of 19-HiTOM:

GGAGTGAGTACGGTGTGCCTTGGAAATGTGTATGTAGCTTTCT

CitBBX19 primer R2 of 19-HiTOM:

GAGTTGGATGCTGGATGGACACAGAACCTCTGGAGTAGA GA

CitBBX22 primer F-HiTOM:

GGAGTGAGTACGGTGTGCTTAACGCCTTCTCAGCCTCACCitBBX22 primer R to HiTOM primer R:

GAGTTGGATGCTGGATGGGTGAACTTTGTCGTCGCACTC

example 5 identification of plant height phenotypes of citrus CitBBX and CitBBX22 overexpression lines and citrus CitBBX and CitBBX editing lines

The measurement of plant height and internode measurement were performed on the positive lines obtained, and the results showed that: citBBX19 the plant height of the overexpressing acronychia plant is higher than that of the wild acronychia plant (figure 3A), and the plant height is 1.37 times that of the wild acronychia plant (figure 3B); in contrast, the plant height of the CitBBX edited acronychia plants was significantly lower than that of the wild-type acronychia plants (fig. 3D), which was reduced by 51.6% compared to the wild-type plants (fig. 3E).

CitBBX the plant height and internode of the CitBBX over-expressed acronychia plant were lower than those of the wild acronychia plant (fig. 4A), and the plant height was reduced by 88.8% compared with that of the wild acronychia plant (fig. 4B); its internode decreased 89.0% compared to wild type (fig. 4C); citBBX the plant height and internode of the CitBBX over-expressed dark Liu Tiancheng plant were both lower than that of the wild-type dark willow plant (fig. 4D), which was 50.1% lower than that of the wild-type plant (fig. 4E); its internode decreased 57.7% compared to wild type (fig. 4F); citBBX the plant height and internode of the CitBBX over-expressed grapefruit plant were lower than those of wild grapefruit (fig. 4G), and the plant height was 22.1% lower than that of wild grapefruit (fig. 4H); its internode decreased by 44.3% compared to wild type (fig. 4I); citBBX22 the edited acronychia plants were higher in plant height and internode than wild-type acronychia plants (fig. 4J), 1.67 times higher in plant height than wild-type acronychia plants (fig. 4K), and 1.34 times higher in internode than wild-type acronychia plants (fig. 4L).

Example 6 exogenous GA ₃ spray treatment can restore the citrus dwarf phenotype resulting from CitBBX22 overexpression

To further confirm that the citrus dwarf phenotype of over-expression CitBBX was due to reduced levels of endogenous GA ₃. Exogenous GA ₃ spray treatment was performed on CitBBX over-expressed citrus positive lines. 20. Mu.M of GA ₃ was sprayed on day 0, day 5 and day 1, and the plant height and internode on day 0 and the plant height and newly grown internode on day 25 after treatment were measured. The results indicate that exogenous GA ₃ treatment can promote plant height growth of over-expressed CitBBX22 citrus plants, primarily significantly promoting internode elongation (fig. 5). The experiment shows that CitBBX directly regulates the endogenous GA metabolism of citrus plants, thereby affecting the internode and plant height development.

Other parts not described in detail are prior art. Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.

Claims (9)

1. A citrus plant height regulating gene CitBBX, characterized in that: the regulatory gene CitBBX is CitBBX or CitBBX, wherein the nucleotide sequence of CitBBX19 is shown as SEQ ID No. 1; the nucleotide sequence of CitBBX is shown as SEQ ID No. 2.

2. A protein CitBBX encoded by the citrus plant height control gene CitBBX of claim 1, wherein: the protein CitBBX is protein CitBBX19 or protein CitBBX, wherein the amino acid sequence of the protein CitBBX is shown in SEQ ID No. 3; the amino acid sequence of the protein CitBBX is shown as SEQ ID No. 4.

3. A primer set for obtaining the citrus plant height control gene CitBBX of claim 1, characterized in that: when the regulatory gene CitBBX is CitBBX19, the primer pair CitBBX F/R of CitBBX19 is obtained:

CitBBX19 primer F:5'-ATGCGAACGCTTTGCGAC-3' the process of the preparation of the pharmaceutical composition,

CitBBX19 primer R:5'-TCAATTTTCAGGCTCTCTTTTGAA-3';

Or, when the regulatory gene CitBBX is CitBBX, the primer pair CitBBX F/R for obtaining CitBBX22 is:

CitBBX22 primer F:5'-ATGAGGATACAGTGCAACGTATGC-3' the process of the preparation of the pharmaceutical composition,

CitBBX22 primer R:5'-TTACTGCAACCGCCTTCTTG-3'.

4. An citrus CitBBX over-expression vector, characterized in that: when the citrus CitBBX over-expression vector is pK7WG2D-CitBBX19, the citrus CitBBX over-expression vector contains the CitBBX gene of claim 1;

Or, when the citrus CitBBX over-expression vector is pK7WG2D-CitBBX, the citrus CitBBX over-expression vector contains the CitBBX gene of claim 1.

5. A citrus CitBBX editing vector, characterized in that: when the citrus CitBBX editing vector is pCAMBIA 1300-pYAO:Cas9: citBBX19, the citrus CitBBX editing vector is a vector containing the CitBBX19 gene editing target point in claim 1,

Or when the citrus CitBBX editing vector is pCAMBIA 1300-pYAO:Cas9: citBBX22,

The citrus CitBBX editing vector is a vector containing the CitBBX gene editing target of claim 1.

6. A recombinant host cell, characterized in that: the recombinant host cell is a citrus CitBBX editing vector comprising the citrus CitBBX overexpression vector of claim 4 or the citrus CitBBX editing vector of claim 5, wherein the host cell is escherichia coli DH5 a.

7. Use of the citrus plant height control gene CitBBX of claim 1 in citrus dwarf breeding.

8. Use of the citrus plant height control gene CitBBX or the citrus plant height control gene CitBBX of claim 1 in citrus dwarf breeding.

9. The application of one of the following in the cultivation of new varieties of dwarf citrus is characterized in that:

(1) The citrus plant height control gene CitBBX of claim 1;

(2) The citrus CitBBX overexpression vector of claim 4;

(3) A citrus CitBBX editing vector as in claim 5;

(4) The recombinant host cell of claim 6.