CN118006844A - Method for improving specificity of CRISPR/Cas12a SNV detection system and application of method in detection of novel coronavirus - Google Patents

Abstract

The invention discloses a method for improving the specificity of a CRISPR/Cas12a SNV detection system, which comprises the following steps of: and (3) truncating the Spacer sequence part in the crRNA, and introducing wobble base mismatch at a specific position in the truncated Spacer sequence. According to the invention, crRNA is modified, spacer truncation is firstly carried out, and the specificity can be improved under the condition that the sensitivity is not affected after the Spacer truncation, but the effect of the specificity improvement on different targets and different positions is inconsistent. Therefore, in order to further improve the specificity and universality, a wobble base pairing mismatch is introduced into a specific position in the Spacer after truncation, so that 'double mismatch versus SINGLE MISMATCH STRATEGY' is formed, the single base pairing mismatch tolerance of a target is reduced, the detection signal of the single base mutation of the target is further reduced, and the specificity of each position on the target is further improved.

Description

Method for improving specificity of CRISPR/Cas12a SNV detection system and application of method in detection of novel coronavirus

Technical Field

The invention belongs to the technical field of gene detection, and particularly relates to a method for improving specificity of a CRISPR/Cas12a SNV detection system and application of the method in detecting novel coronaviruses.

Background

In recent years, CRISPR/Cas systems derived from prokaryotic adaptive immune mechanisms have the characteristics of strong developability, simplicity, high efficiency and the like, thereby not only bringing revolutionary breakthrough to in-vivo gene editing technology, but also amplifying the wonderful colors in the field of in-vitro diagnosis. CRISPR-associated proteins Cas9 and Cas12a are the most influential and widely used two of them, which can bind to the protospacer-adjacent motif (PAM) in the genome leading to the local opening of the double-stranded DNA double-STRANDED DNA (dsDNA) target, resulting in Watson-Crick base pairing between guide RNA (guide RNA) and the template strand of the dsDNA target, ultimately forming an R-loop structure, triggering structural rearrangement of the Cas nuclease domain to activate its cis-cleavage activity leading to double-stranded DNA cleavage for gene editing purposes.

Unlike Cas9, cas12a only requires a single CRISPR RNA (crRNA) as a gRNA target; and single stranded DNA (ssDNA) targets that do not require PAM motifs for cleavage can be identified. In addition, the CRISPR/Cas12a system can activate its trans-cleavage (TRANS CLEAVAGE) activity upon loading of the target, non-specifically cleaving nearby single-stranded DNA (ssDNA) molecules. Based on the characteristics, ssDNA of a fluorescent reporter group and a quenching group is introduced as a reporter probe molecule, and after the target DNA and crRNA form an R-loop structure to activate Cas12a, the reporter probe molecule is cut, and a fluorescent signal is released, so that the fluorescent reporter probe molecule is applied to the fields of nucleic acid detection and biological sensing. In order to achieve high sensitivity molecular detection, however, it is often desirable to combine target nucleic acid pre-amplification techniques with CRISPR detection techniques. Combining CRISPR/Cas12a detection with RPA isothermal amplification technology can realize amplification and detection of nucleic acid at a constant temperature of 37 ℃, and the characteristic has important value for developing simple nucleic acid detection methods and instruments. Several CRISPR/Cas12 a-based diagnostic techniques have been developed, such as DETECTR, HOLMES and others.

It is well known that the detection of single-nucleotide variants (SNVs) is of great importance for the diagnosis of genetic diseases, cancer and pathogen variants. However, the specificity of Cas12a has been controversial, although it has been reported that Cas12a has higher specificity for cis-cleavage activity than Cas9, particularly in the PAM-proximal region, both in vivo and in vitro. There is still much evidence that Cas12a cis-cleavage activity is not only highly tolerant to a single mismatch, but can tolerate multiple mismatches. However, cas12a also has poor specificity of trans-cleavage activity, and single base variation cannot be distinguished. In general, cas12a has unsatisfactory specificity, and the signal-to-noise ratio (signal-to-noise ratio) between wild type and single base mutant is low or even absent, and cannot meet the requirement of SNV diagnosis, which is a bottleneck for popularization and application.

The manner in which the CRISPR/Cas12a system promotes specificity is primarily by engineering Cas12a enzymes or crRNA sequences. Compared with the complicated modification and screening of Cas enzyme, the modification of the crRNA sequence is a simpler strategy. At present, the modification is mainly carried out in the following ways: ① Chemically modifying the crRNA partial sequence; ② Shortening the length of crRNA; ③ Changing the secondary structure of crRNA; ④ Substitution of crRNA partial sequences with DNA bases; ⑤ crRNA introduces additional mismatched bases; ⑥ The base is inserted or deleted in the pairing region of crRNA and target spot to form DNA-RNA vacuole structure.

Although there are several ways to increase specificity by engineering crrnas, there are still some drawbacks. ① The improvement of specificity is not obvious, and the signal to noise ratio of some target mutant types and wild types is less than 5 times. ② Sensitivity and specificity (trade-off) exist, for example, chemically modified grnas, while enhancing specificity, have some attenuation of cis-cleavage activity for certain targets. ③ The universality is limited, and the crRNA of different targets has different positions needing chemical modification; the optimal introduction of additional mismatched bases at different target sites varies. Therefore, a need exists for CRISPR/Cas12a SNV detection technology that greatly improves its specificity while maintaining its sensitivity and expanding its versatility.

Disclosure of Invention

A method for improving specificity of CRISPR/Cas12a SNV detection system adopts the following technical scheme:

A method for improving specificity of a CRISPR/Cas12a SNV detection system, wherein crRNA is modified in the method, and the modification method comprises the following steps: and (3) truncating the Spacer sequence part in the crRNA, and introducing wobble base mismatch at a specific position in the truncated Spacer sequence.

In order to improve the trans-cleavage specificity of cas12a and effectively maintain the sensitivity, the crRNA is modified, the Spacer is firstly truncated, the specificity can be improved under the condition that the sensitivity is not affected after the truncated, but the effect of the specificity improvement on different targets and different positions is inconsistent. Therefore, in order to further improve the specificity and universality, a wobble base pairing mismatch is introduced into a specific position in the Spacer after truncation, so that 'double mismatch versus SINGLE MISMATCH STRATEGY' is formed, the single base pairing mismatch tolerance of a target is reduced, the detection signal of the single base mutation of the target is further reduced, and the specificity of each position on the target is further improved.

Preferably, the shortening of the Spacer sequence part is performed by shortening 2-4 bp at the 3' -end of the Spacer sequence; wobble base mismatches were introduced at position 14 in the truncated Spacer sequence.

Further preferably, the Spacer sequence portion is truncated by 3bp at the 3' end of the Spacer sequence.

Preferably, the crRNA is modified by the following steps: the nearest distance of the mutation position of the target non-template strand finds an A or C base, and the A or C base is defined as shortening the length of CRRNA SPACER to 17bp relative to the 14 th position of PAM within +2bp or-2 bp of the mutation position, then the 14 th base on a spacer is changed into U or G, and a wobble base mismatch is introduced at the 14 th position in the spacer-TS DNA heteroduplex.

Preferably, a method of increasing CRISPR/Cas12a SNV detection system specificity, wherein PAM sequence TTTV of Cas12a, v=a/C/G, is introduced in the RPA upstream primer.

Because Cas12a has PAM dependency on the recognition of double-stranded target sequences, and the distance for introducing wobble base pairing PAM in the modification method of crRNA is limited, the detectable sequence range is easily narrowed, and the PAM sequence TTTV of Cas12a is introduced into the RPA upstream primer in the invention, the limitation on the distance of PAM can be eliminated, and the detectable sequence range is ensured.

Further preferably, the 4-14 position of the 3' end of the RPA upstream primer introduces PAM sequence TTTV of Cas12 a.

Preferably, a method of increasing the specificity of a CRISPR/Cas12a SNV detection system wherein glycerol is added to the detection system.

The glycerol is added into the detection system of the invention, so that the fusion of the RPA and the CRISPR system can be slowed down, and aerosol pollution is avoided, thereby realizing one-tube detection.

The method for improving the specificity of the CRISPR/Cas12a SNV detection system is applied to detection of the novel coronavirus.

An application of a method for improving specificity of a CRISPR/Cas12a SNV detection system in detection with BA5.2 novel coronavirus T1050N as a target spot, comprising the following steps:

S1, designing crRNA according to a target sequence of virus T1050N, wherein the crRNA is shown as SEQ ID NO.1 in a sequence table, and the crRNA is specifically as follows: 5'-UAAUUUCUACUAAGUGUAGAUagcuaacaccuguaaugaaa-3', wherein the lower case letter portion is a Spacer sequence;

S2: shortening 3bp at the 3' -end of the Spacer sequence in the crRNA in the step S1, wherein the truncated crRNA is shown as a sequence SEQ ID NO.2 in a sequence table, and the specific steps are as follows: 5'-UAAUUUCUACUAAGUGUAGAUagcuaacaccuguaaug-3'; then, the 14 th A of the truncated Spacer sequence is changed into G to obtain the reconstructed crRNA (SNV crRNA), and the reconstructed crRNA is shown as a sequence SEQ ID NO.3 in a sequence table, and the concrete steps are as follows: 5'-UAAUUUCUACUAAGUGUAGAUagcuaacaccuguGaug-3';

S3, according to the T1050N target, the RPA upstream primer and the RPA downstream primer are respectively shown in the sequence SEQ ID NO.4 and the sequence SEQ ID NO.5, and the specific steps are as follows: 5'-tgctggtgattacattttagctaacacctg-3'; r is 5'-ccaacttcccatgaaagatgtaattctctg-3'; inserting a base at 13 positions of the RPA upstream primer, which are far from the 3' -end, to introduce a PAM sequence TTTC, so as to obtain an improved RPA upstream primer; the sequence of the modified RPA upstream primer is shown as a sequence SEQ ID NO.6 in a sequence table, and the specific sequence is shown as F5'-tgctggtgattacatTTTCagctaacacctg-3';

And S4, adding the modified crRNA, the RPA upstream primer, the RPA downstream primer and the glycerol into the CRISPR/Cas12a system to obtain the CRISPR/Cas12a SNV detection system with high specificity by taking T1050N as a target point.

An application of a method for improving specificity of a CRISPR/Cas12a SNV detection system in detection with XBB novel coronavirus Q183E as a target spot, comprising the following steps:

S1, designing crRNA according to a virus Q183E target sequence, wherein the crRNA is shown as a sequence SEQ ID NO.7 in a sequence table, and the crRNA is specifically as follows: 5'-UAAUUUCUACUAAGUGUAGAUgaccuugaaggaaaagaggg-3', wherein the lower case letter portion is a Spacer sequence;

S2: shortening 3bp at the 3' -end of the Spacer sequence in the crRNA in the step S1, wherein the truncated crRNA is shown as a sequence SEQ ID NO.8 in a sequence table, and the specific steps are as follows: 5'-UAAUUUCUACUAAGUGUAGAUgaccuugaaggaaaaga-3'; then, the 14 th A of the truncated Spacer sequence is changed into G to obtain the reconstructed crRNA (SNV crRNA), and the reconstructed crRNA is shown as a sequence SEQ ID NO.9 in a sequence table, and the concrete steps are as follows: 5'-UAAUUUCUACUAAGUGUAGAUgaccuugaaggaaGaga-3';

S3, according to the Q183E target, the RPA upstream primer and the RPA downstream primer are respectively shown in the sequence SEQ ID NO.10 and the sequence SEQ ID NO.11, and the specific steps are as follows: f, 5'-atgtctctcagccttttcttatggaccttg-3'; r is 5'-gtgatgttaatacctattggcaaatctacc-3'; inserting a base at 13 positions of the RPA upstream primer, which are far from the 3' -end, to introduce a PAM sequence TTTG, so as to obtain an improved RPA upstream primer; the sequence of the modified RPA upstream primer is shown as a sequence SEQ ID NO.12 in a sequence table, and the method is specifically as follows: f, 5'-atgtctctcagccttttcttaTTTGgaccttg-3';

And S4, adding the modified crRNA, the RPA upstream primer, the RPA downstream primer and the glycerol into the CRISPR/Cas12a system to obtain the CRISPR/Cas12a SNV detection system with high specificity by taking Q183E as a target point.

The invention has the beneficial effects that:

1. According to the invention, by modifying the Spacer sequence of the crRNA, the specificity of detection can be greatly improved under the condition of basically not reducing the sensitivity, and the method has universality.

According to the invention, the PAM sequence is introduced into the RPA primer, so that the position requirement of avoiding swinging base by breaking through the limitation of PAM is overcome; and the glycerol additive can be used for one-pipe treatment, so that aerosol pollution and complicated operation are avoided, and popularization and application are not limited.

Drawings

The secondary structure of fig. 1CrRNA is schematically shown.

Figure 2 is a graph of the effect of Cas12a trans-cleavage activity of engineered and non-engineered crrnas in example 1.

FIG. 3 is a graph of the analytical sensitivity test results for 7 engineered and non-engineered crRNAs selected in example 1, wherein a is M37; b: M39; M42+M43; d is M45; e, M48; fM 63; g is M65; h: unmodified crRNA (control). FIG. 4 is a non-template strand sequence used in example 1 to evaluate tolerance of engineered crRNA to CPSIT _0429 target mismatches, wherein mut 1-20 contains a single target mismatch (single mutant target sequence) and mut 21-29 contains two adjacent target mismatches (adjacent double mutant target sequence).

FIG. 5 is a graph of the results of evaluating the mismatch tolerance of engineered crRNA to CPSIT _0429 activator in example 1; the result is an increased fluorescence value within 1 hour of mutating the target sequence divided by an increased fluorescence value within 1 hour of unmutating the target sequence.

FIG. 6 is a graph showing the fold-result of the evaluation of the corresponding site-specific increase in crRNA after double mismatch versus SINGLE MISMATCH STRATEGY in example 1; results the increased fluorescence value within 1 hour for the single base mutant target sequence divided by the increased fluorescence value within 1 hour for the adjacent double mutant target sequence.

FIG. 7 is a non-template strand sequence used in example 2 to evaluate mismatch tolerance of engineered crRNAs to D614G and R346T targets; wherein mut 1-20 contains a single target site mismatch (single mutant target sequence) and mut 21-29 contains two adjacent target site mismatches (adjacent double mutant target sequences).

FIG. 8 shows trans-cleavage activity after truncating 3 targets CRRNA SPACER by different lengths in example 2, resulting in a spacer truncated by the increased fluorescence value over 1 hour for different lengths divided by the increased fluorescence value over 1 hour for a 20bp spacer.

FIG. 9 is a graph of the results of CRRNA SPACER truncations of different lengths for the CPSIT _0429 activator mismatch tolerance in example 2; the result is an increased fluorescence value within 1 hour of mutating the target sequence divided by an increased fluorescence value within 1 hour of unmutating the target sequence.

FIG. 2 is a graph showing fold results of corresponding site-specific increases in FIG. CRRNA SPACER after truncation of CPSIT _0429 activator construct double mismatch versus SINGLE MISMATCH STRATEGY of different lengths; results the increased fluorescence value within 1 hour for the single base mutant target sequence divided by the increased fluorescence value within 1 hour for the adjacent double mutant target sequence.

FIG. 10 is a graph showing the results of the CRRNA SPACER truncations of different lengths for mismatch tolerance to the D614G activator in example 2; the result is an increased fluorescence value within 1 hour of mutating the target sequence divided by an increased fluorescence value within 1 hour of unmutating the target sequence.

FIG. 11 is a graph showing the results of the CRRNA SPACER truncations of different lengths for R346T activator mismatch tolerance in example 2; the result is an increased fluorescence value within 1 hour of mutating the target sequence divided by an increased fluorescence value within 1 hour of unmutating the target sequence.

FIG. 12 is a graph showing the results of sensitivity analysis of a spacer of 20bp and a truncating of 17bp in the presence of different target activators in example 2, respectively; wherein (a) CPSIT _0429 17bp; (b) D614G 20bp; (c) D614G 17bp; d) R346T 20bp; (e) R346T 17bp; NTC is blank.

FIG. 13 is a graph showing the increase in fluorescence value over 1 hour for the target sequence matched and unmatched by CRRNASPACER truncations of different lengths, respectively, in example 2.

FIG. 14 is a non-template sequence (NTS-DNA sequence) of 3 targets in example 3, mainly single mutation T14C or T14A at position 14 of the non-template sequence; double mutant sequences: wherein the method comprises the steps of CPSIT_0429(T14C&C1A～T14C&C17A;T14A&C1A～T14A&C17A);D614G(T14C&T1C～T14C&A17G;T14A&T1C～T14A&A17G);R346T(T14C&A1G～T14C&A17G;T14A&A1G～T14A&A17G).

FIG. 15 is a graph of the sensitivity results of example 3 in which 3 targets were truncated to 17bp crRNA at different positions to introduce wobble base mismatches (rU-dG); (a) CPSIT _0429 14 bits T14C; (b) CPSIT _0429 11 bits T11C; (C) D614G position T14C; (D) D614G 9 position T9C; e) R346T 14 bit T14C; (f) R346T 12 bit T12C; NTC is blank.

FIG. 16 is a graph showing the results of the mismatch tolerance of 3 target crRNAs of different lengths (20 bp to 15 bp) to the target non-template strand at position 14 by introducing different mutant bases (T14C, T14A, T G).

FIG. 17 is a graph of trans-cleavage activity of 16 RNA-DNA base pairing combinations introduced at position 14 of the spacer and TS DNA heterozygous duplex with 3 target spacers 17bp in example 3.

FIG. 18 is a graph of the sensitivity results of example 3 in which 3 targets were truncated to 17bp crRNA at different positions to introduce wobble base mismatches (rG-dT); (a) CPSIT _0429 14 bits T14A; (b) CPSIT _0429 bits G9A; ; (c) D614G 14 position T14A; (D) position G15A of D614G 15; e) R346T 14 bit T14A; (f) R346T 10 position G10A; NTC is blank.

FIG. 19 is a graph showing the results of the specificity evaluation of crRNA (SNV crRNA) after modification of the three targets by the double mutant non-template sequence in example 3.

FIG. 20 is a graph showing the effect of mutation at another position of the double mutant non-template sequence in example 3 and the distance between the mutation and position 14 on specificity.

FIG. 21 is a flow chart of the optimal iterative design of the engineered crRNA obtained in example 3.

FIG. 22 is a schematic flow chart of the modification of the RPA upstream primer in example 4.

FIG. 23 is a diagram showing the sequence of the three target RPA upstream primers of example 4 after PAM sequence was introduced and the expected sequence alignment.

FIG. 24 is a graph showing the amplification results of PAM sequence introduced into the RPA upstream primer of CPSIT _0429 target in example 4.

FIG. 25 is a graph showing the amplification results of the PAM sequence introduced into the RPA upstream primer of the D614G target in example 4.

FIG. 26 is a graph showing the amplification results of the PAM sequence introduced into the RPA upstream primer of the R346T target in example 4.

FIG. 27 is a graph showing the sensitivity results of the labeled RPA upstream primer of FIG. 24 in example 4.

FIG. 28 is a graph of the results of evaluation of the effect of glycerol at various concentrations on the detection system of the one-tethered RPA-CRISPR/Cas12a of CPSIT-0429 target in example 4.

FIG. 29 is a graph of the sensitivity results of a three-target, 20% glycerol and glycerol containing, monocular RPA-CRISPR/Cas12a detection system of example 4.

FIG. 30 is a schematic representation of the iterative engineering of crRNAs for the T1050N and Q183E targets of example 5.

FIG. 31 is a graph of the results of SNV crRNA (engineered crRNA) and WT crRNA (non-engineered crRNA) trans-cleavage activity and sensitivity of the synthetic mock templates of example 5 (a) SNV crRNA (engineered crRNA) and WT crRNA (non-engineered crRNA) trans-cleavage activity of the synthetic mock templates (including mutant templates and non-mutant templates); (b) SNV crRNA of the corresponding target spot is used for detecting a sensitivity result graph of the one-tube detection of the simulated template; (c) A graph of WT crRNA sensitivity results for a corresponding target for a one-tube detection of a mock template.

FIG. 32 is a schematic diagram of a detection flow chart of a tubular detection system in embodiment 5.

FIG. 33 is a graph showing the results of an evaluation of 60 clinical SARS-COV-2 samples (NGS verified as BA.5.2 and XBB variant 30 strains) using the corresponding SNV crRNA and WT crRNA-based detection system of example 5; and a consistent result graph of the detection result and NGS verification result in example 5; (a) evaluating a result graph; (b) a consistent results graph.

FIG. 34 is a graph showing the results of ROC test analysis performed on T1050N and Q183E targets using corresponding SNV crRNA and WT crRNA-based detection systems in example 5; (a) Q183E; (b) T1050N.

Detailed Description

The detection preparation process of the CRISPR/Cas12a SNV detection system provided by the invention is as follows:

In a one-pot reaction system, components A and B were prepared in advance. Component A was an RPA system, and 29.5. Mu.L PRIMER FREE Rehydration buffer, 11.2. Mu.L nuclease free water, and 2.4. Mu.L of each of the RPA upstream and downstream primers (10. Mu.M) were added to an Eppendorf tube. The mixture was then added to a reaction tube containing lyophilized RPA enzyme, followed by 2. Mu.L of template DNA. The tube was spun and centrifuged. Component B consisted of LbCas a (5. Mu.M) 1. Mu. L, crRNA (5. Mu.M) 1. Mu. L, ssDNA-FQ reporter (5. Mu.M) 2. Mu. L, NEBuffer 2.1.1 (10X) 5. Mu.L, a suitable amount of 50% glycerol (v/v) and nuclease-free water, with a total product of 50. Mu.L. After spin-centrifugation of the mixture, 10. Mu.L of component B was added to the bottom of the reaction tube, and 9. Mu.L of component A and 1. Mu.L of magnesium acetate (280 nM) were added to the side of the reaction tube. The reaction tube was capped, placed in a centrifuge for slow and transient centrifugation, and then placed on ABIQ instrument at 37 ℃ for 1 hour. Fluorescence values were collected and recorded every minute.

Modification of the sequence of example 1 crRNA experiments

CrRNA is an RNA molecule with a secondary structure, the 5 'end contains a bracket sequence necessary for cas12a binding and comprises Scaffold, stem and Loop sequences, the 3' end contains a Spacer sequence (Spacer) complementary pairing with 20bp target gene base, and the specific structure is shown in figure 1. In the present invention the Scaffold sequence is UAAUU … … U (where the ellipses are Stem and Loop sequences); as can be seen from FIG. 1, the Stem sequence is a double-stranded structure, the sequence isLoop sequence UAAGU.

In this example, CPSIT _0429 gene (specific target for detecting Chlamydia psittaci) was selected as target, and crRNA sequence was designed as shown in Table 1.

Wherein the capital part sequence in M35 (unmodified crRNA) (UAAUU … … U is the Scaffold sequence part, UAAGU is the Loop sequence, the lowercase part sequence cauagagaguucuuuacuac is the Spacer sequence part, stem is the chain structure part, and the specific sequence can be seen in FIG. 1). M36, M37 and M38 are respectively deleted by 1bp, 2bp and 3bp at the 5' -end of the Scaffold part of the M35 sequence; m39 is a deletion of 1bp at the 3' end of the Scafold portion of the M35 sequence; m40 is a hairpin structure added 3' to the Scaffold portion of the M35 sequence.

M41+m42 is 2 RNA molecules formed after cleavage of the 5 'and 3' ends of the Loop portion of the M35 sequence; M42+M43 is 2 RNA molecules formed after cleavage at the 3' -end of the Loop portion of the M35 sequence. M44 is a deletion of 1bp (UAGU) in the middle part of the basic Loop sequence of M35; m45 is a deletion of 3bp (UU) in the middle of the base Loop sequence of M35; m46 is the complete deletion of the Loop sequence on the basis of M35.

M47 is a bottom base pair mismatch of the Stem portion of the M35 sequence; m48 is a top base pair mismatch of the Stem portion of the M35 sequence; m49 is the bottom base pair deletion of the Stem portion of the M35 sequence; m50 is the top base pair deletion of the Stem portion of the M35 sequence; m51 is a stretch of 2 base pairs in the Stem portion of the M35 sequence; m52 is a stretch of the Stem portion of the M35 sequence by 4 base pairs; m53 is the substitution of the A-U base pair of the Stem portion of the M35 sequence to G-C; m54 is the substitution of the G-C base pair of the Stem portion of the M35 sequence to A-U.

M55 is a hairpin structure added at the 5' end based on M35; m56 is 5bp of 5' -end folding closure based on M35; m57 is turned back and sealed at the 5' end for 3bp on the basis of M35; m58 is folded and sealed at the 5' end by 2bp on the basis of M35; m59 is 7bp of 5' -end folding closure based on M35; m60 is a hairpin structure added at the 3' end based on M35; m61 is turned back and sealed at the 3' end by 5bp on the basis of M35; m62 is turned back and sealed by 10bp at the 3' end on the basis of M35; m63 is folded and sealed at the 3' end by 15bp on the basis of M35; m64 is a 20bp closed 3' end fold back based on M35.

M65 is 2bp truncated at the 3' end of the Spacer sequence based on M35; m66 is truncated by 4bp at the 3' end of the Spacer sequence based on M35; m67 is truncated 6bp at the 3' end of the Spacer sequence based on M35; m68 is 2bp added to the 3' end of the Spacer sequence based on M35; m69 is that the 3' -end of the Spacer sequence is increased by 4bp on the basis of M35; m70 is a Spacer sequence increased by 6bp at the 3' end based on M35. Specific sequence information for M35-70 can be found in Table 1.

TABLE 1

The effect of the designed crrnas (sequences M35-M70) on the trans-cleavage activity of Cas12a (fluorescence increase in 1h of engineered and non-engineered crrnas in the presence of CPSIT _0429 activator) was initially determined, and as a result, it can be seen in fig. 2 that decreasing the reactivity of Cas12a increases the specificity, but too low reactivity was not applicable for detection, so 7 crRNA mutants of sequences M35-M70, with less effect on trans-cleavage activity, were selected for the next experiment, in particular M37, M39, m42+43, M45, M48, M63 and M65.

The non-template strand sequence used to evaluate the CPSIT _0429 activator target of the engineered crRNA can be seen in fig. 4 (where TTTG at the left end is PAM sequence) for detection of sensitivity and specificity of the engineered crRNA. The sensitivity test of the above-selected modified crrnas was performed using the unmutated non-template strand sequence (WT) of fig. 4, and the results can be seen in fig. 3, where the detection limit of the M65 modification is identical to that of the wild type, and the detection limit is affected to some extent by other modifications.

The modified crRNA specificity is detected by adopting non-template strand sequences (mut 1-39) of single base mutation and adjacent double base mutation targets in FIG. 4, and the result can be seen in FIG. 5; from the results, it can be seen that the specific increase in crRNA engineering has position-dependent and insignificant properties, with a small signal-to-noise ratio between the PAM proximal and PAM distal wild type and mutant, and is more pronounced at positions 12 and 13 relative to PAM. Where M65 engineering gives the best signal-to-noise ratio between wild type and mutant at position 12 relative to PAM, but also only 10-fold.

Compared with single base mutant targets, the mismatch tolerance of the modified crRNA to adjacent double base mutant targets is drastically reduced, especially the double base mutant targets of mut 27, mut 31, mut 32, mut 35, mut 36 and mut37, which is probably because the formation of r-loop is greatly affected by adjacent mismatches, so that the mismatch tolerance is reduced. This also gives us a hint that 'double mismatch versus SINGLE MISMATCH STRATEGY' can be introduced to further increase its detection specificity: the adjacent position of the spacer sequence matched with the single base mutation site in the target sequence is introduced with a single base mutation in advance, and when the single base mutation is combined with the target sequence and meets the single base mutation in the target sequence, the adjacent double base mutation is formed, so that the mismatch tolerance is further reduced, and the detection specificity is improved. As can be seen from the data in fig. 6, the signal to noise ratio between the various crRNA engineered wild type and mutant variants with improved specificity was significantly improved, with many sites exceeding 10-fold, where the improvement in M65 engineering was most pronounced, but there were still many sites with insufficient improvement in specificity.

From the results in example 1, it can be seen that spacer truncation is a way to significantly improve detection specificity without decreasing sensitivity, and that it is possible to introduce single base mutations at specific positions on the basis of truncation to further improve specificity.

Example 2 analysis of the Effect of CRRNA SPACER truncated Length on specificity and its universality on different targets

To more finely analyze the effect of truncations CRRNASPACER on specificity and their universality on different targets, two targets D614G and R346T (new coronary point mutation targets) were additionally added in this example. Together with CPSIT _0429 target points, the length of the spacer is shortened from 20bp to 15bp, and 1bp is shortened each time; the sequence information can be seen in table 2.

TABLE 2

Detecting the specificity of CPSIT _0429 genes by adopting target non-template chain sequences of single base mutation and adjacent double base mutation in FIG. 4, and detecting the specificity of D614G and R346T corresponding to the target non-template chain sequences of the single base mutation and the adjacent double base mutation in FIG. 7; the sensitivity of the corresponding unmutated non-template strand sequence WT was detected.

From the results of FIG. 8, it can be seen that when the spacer is truncated to 16bp, the difference in detection signal is larger for the different targets, the D614G and R346T targets still have stronger signals, while the signal for the CPSIT _0429 target drops sharply. This is probably due to the fact that the stability of the space-TS DNA heteroduplex is affected by the GC content. The GC content of both the D614G and R346T targets is 50% compared to the 35% GC content of the CPSIT _0429 target, which makes the space-TS DNA hybrid double strand more stable and easy to form an R-loop structure, thereby initiating structural changes of cas12a enzyme. All 3 targets had no obvious detection signal when the spacer was truncated to 15 bp. As can be seen from the results of fig. 12: when the spacer is truncated to 17bp, the detection signals of the three targets are not obviously reduced, and the detection limit is the same as that of 20 bp.

The specificity results can be seen in FIGS. 9-13, and as can be seen from FIGS. 9-13, the single base mutation results of three targets (CPSIT _0429, D614G and R346T) show that the specificity improvement of the spacer truncations has truncate number dependence; as the number of spacer truncations increases, the tolerance of base mismatch also decreases; 17bp spacer is a balance point which ensures that R-loop is not broken down (sensitivity is not reduced) and can maximally improve specificity; the specific increase of the spacer to 17bp has the property of being position dependent and insignificant. The signal-to-noise ratio between wild-type and mutant of the PAM proximal and PAM distal regions is small, whereas the difference in PAM middle region is more pronounced. The signal to noise ratio was higher than 10-fold between the wild type and mutant at positions 10 and 15 of PAM for the R346T target only. Notably, it is also target specific. For example, at 12 positions relative to PAM, the signal to noise ratio of the 0429 target point is obviously improved by about 10 times; the lifting degree of the D614G target point is generally about 2 times; while the R346T target signal to noise ratio is close to 1, and almost no improvement exists. Taken together, this suggests that the specific increase of the spacer to 17bp is inconsistent with respect to the effect of different targets and different positions. Thus, its versatility and single base discrimination are still worth improving.

Compared with single base recognition capability, the adjacent double base mismatch recognition capability is particularly obvious along with the shortening promotion of the spacer, and after double mismatch versus SINGLE MISMATCH STRATEGY is introduced, the specific promotion of 3 targets is obvious only when the spacer is shortened to 18bp and 17 bp. Similarly, this specific increase has both position dependence and target specificity, but a uniform and distinct increase in signal-to-noise ratio at mut 14/34,3 targets.

Example 3 introduction of wobble base mismatches into truncated spacer sequences

CRRNA SPACER introduction of single mismatched base formation double mismatch versus SINGLE MISMATCH STRATEGY is a simple and efficient strategy for improving specificity of the Crispr system. However, to create an optimal SNV detection signal-to-noise ratio, two preconditions need to be met after the spacer introduces a single mismatched base: firstly, the detection signal for detecting the unmutated target spot should be similar to the signal detected by the WT crRNA; and secondly, the detection signal of the mutant target spot after forming double base mismatch is suddenly reduced, which is similar to the signal detected by NTC.

The non-template strand 14 sites of the 3 targets selected in this example (CPSIT _0429, D614G, and R346T) are all T-C mutations (see T14C in FIGS. 14a, C, e for sequence information), which result in formation of rU-dG pairs by the spacer-TS DNA heterozygotes (spacer and TS in FIG. 1); when the spacer length is 17bp, after the T-C mutation at the 14 th site of the non-template strand of the target spot, the analysis sensitivity of the target spot has no obvious difference from that of the wild type, and the test result can be seen in fig. 15 (a, C and e); this indicates that the free energy change (ΔG) of R-loop formation is hardly affected. Based on the effect of the base mismatch on Cas12a binding energy, the single base mutation of non-template strand T14C was also found to have minimal increase in dissociation rate relative to other mismatch positions. In addition, rU-dG mismatches are also the most mismatching type for in vivo off-targeting of CRISPR systems, presumably due to the fact that rU-dG mismatches belong to wobble pairing, which is similar in thermodynamic stability to Watson-CRICK PAIRING. However, it has been previously reported that most of the position of the different base pair mismatches have no significant difference in their effect on specificity, indicating that this mutant base type-specific difference at position 14 may be space length dependent.

To further verify that this mutant base type-specific difference at position 14 may be space length dependent, the non-template strand sequence of the three targets (CPSIT _0429, D614G and R346T) was mutated to C, G, A at position 14T in this example (where the sequence of the T-A mutation is seen in T14A for b, D and f in FIG. 14; the T-G mutation sequence is seen in Table 3), and CRRNA SPACER may be 20bp to 15bp in length. The test results are shown in FIG. 16, and it can be seen from FIG. 16 that there is a significant difference only when the base is truncated to 17bp, but the difference is not significant at 20bp, 19 bp and 18bp, which indicates that the difference in the energetics of the base complementary pairing can only be represented at the R-loop energy collapse point, and also verifies that the R-loop energy of 20bp is excessive.

TABLE 3 Table 3

CPSIT _0429 non-template strand T14G	TTTGCATAGAGAGTTCTGTACTAC
		D614G non-template strand T14G	TTTATCAGGATGTTAACGGCACAG
R346T non-template strand T14G	TTTAACGCCACCAGATTGGCATCT

At a length of 17bp of the spacer, we constructed 16 DNA-RNA pairing combinations of 3 targets at position 14 of the spacer-TS DNA heterozygote (wherein rA-dA in the figure represents that position 14 of the spacer of CrRNA is mutated to A; and the corresponding 14 th bit of TS DNA is also mutated to A, and similarly rG-dA indicates that the 14 th bit of a spacer of CrRNA is mutated to G, and the corresponding 14 th bit of TS DNA is mutated to A, and the rest indicate that the three pairs are less different from the detection signals of Watson-CRICK PAIRING (figure 17). RU-dG and rG-dT are common modes of in vivo miss-target, which are also consistent with the previous method, rG-dT (indicating that the 14 th bit of a spacer of CrRNA is mutated to G, and the corresponding 14 th bit of TS DNA is also mutated to T) and rC-dT (indicating that the 14 th bit of a spacer of CrRNA is mutated to C, and the corresponding 14 th bit of TS DNA is also mutated to T), are all three pairs belonging to wobble base pairing, and are also the common modes of in vivo miss-target, which are also consistent with the previous method, rC-dT is possibly containing base pairing by double-strand frame rearrangement, and the two base pairing is also the three base pairing is also presumed to have a great influence on the position of the three base pairing of a spacer, and thus the three base pairing is also significantly affected by the three base pairing of a spacer and a spacer pair is also presumed to have a great influence on the position of a spacer-down.

For comparison in this example, the non-template strand T-C mutation was at positions 11, 9 and 12 of CPSIT _0429, D614G, R346T target, respectively (specific sequence information Table 4); analysis sensitivity experiments were performed on these 3 templates with 17bp spacer crRNA targets. The results show that the detection signals of the T9C single mutation of the D614G target have no obvious difference from the wild type, and the analysis sensitivity of the other two positions is obviously reduced in FIG. 15 (b, D and f).

TABLE 4 Table 4

CPSIT _0429 non-template strand T11C	TTTGCATAGAGAGTCCTTTACTAC
		D614G non-template strand T9C	TTTATCAGGATGCTAACTGCACAG
R346T non-template strand T12C	TTTAACGCCACCAGACTTGCATCT

Ext> inext> thisext> exampleext>,ext> aext> nonext> -ext> templateext> strandext> Gext> -ext> Aext> mutationext> (ext> seeext> Tableext> 5ext> forext> specificext> sequencesext>)ext> andext> aext> Text> -ext> Aext> mutationext> atext> positionext> 14ext> (ext> seeext> Text> 14ext> Aext> inext> FIG.ext> 14ext> forext> sequenceext> informationext>)ext> wereext> alsoext> constructedext>,ext> withext> noext> significantext> decreaseext> inext> theext> sensitivityext> ofext> theext> analysisext> ofext> 3ext> targetext> spacerext> -ext> TSext> heterozygotesext> toext> formext> rGext> -ext> dText> wobbleext> baseext> pairingext> atext> positionext> 14ext>,ext> andext> noext> significantext> decreaseext> atext> otherext> positionsext> (ext> seeext> FIG.ext> 18ext> forext> resultsext>)ext>.ext>

TABLE 5

CPSIT _0429 non-template strand G9A	TTTGCATAGAGAATTCTTTACTAC
		D614G non-template strand G15A	TTTATCAGGATGTTAACTACACAG
R346T non-template strand T12C	TTTAACGCCACCAAATTTGCATCT

From the results of the two above experiments, it was shown that wobble base pairing had little effect on ΔG of R-loop at position 14 of the spacer-TS heterozygote duplex, and that R-loop spatial backbone also affected wobble base pairing formation. Whereas the high signal of the T9C single mutation of the D614G target suggests that in addition to the spacer-TS heterozygous duplex 14, there may be G-U wobble base pairing at certain target specific positions with less effect on the ΔG variation of R-loop.

Under the condition that CRRNA SPACER is truncated to 17bp, the space reintroduces mismatched bases and TS DNA (the sequence can be seen in FIG. 14), rU-dG and rG-dT wobble base pairing is formed at position 14, double mismatches versus SINGLE MISMATCH STRATEGY is formed, single base mismatch tolerance of 3 targets is obviously reduced, the specificity improvement has position dependence, particularly the position near position 14, and the signal to noise ratio is almost more than 20 times (FIGS. 19-20). Compared with the case of CRRNA SPACER truncated to 17bp only, the detection signal of the 3 target single base mutation is further reduced, so that the specificity of each position on the target is further improved, the specificity improvement has obvious distance dependence (figure 20), and the position specificity improvement within 14 positions +2 or-2 is highest. Overall, in vitro shearing experiments and in vivo phage competition experiments also showed that adjacent mismatches were more detrimental than two distant mismatches. Overall, our results indicate that the specificity of cas12a depends on the number, type, position and distance of mismatches in the space-TS DNA heteroduplex.

The experimental results of this example were combined: the crRNA iterative design principle for detecting SNV sites meets the optimal SNV detection signal-to-noise ratio (fig. 21): the A or C base can be found at the closest distance from the site of the target non-template strand mutation, preferably within +2 or-2, defined as position 14 relative to PAM. The length of CRRNA SPACER was shortened to 17bp, then the 14 th position on the spacer was changed to U or G, and a wobble base mismatch was introduced at the 14 th position in the spacer-TS DNA heteroduplex.

Example 4PAM sequence engineering

Since Cas12a has PAM dependency on the recognition of double-stranded target sequences, and the design method of iterative crrnas has limitations on the distance of wobble base pairing distance PAM, resulting in a reduced detectable sequence range, getting rid of PAM limitations is extremely important for the application and popularization of implementation techniques. The introduction of PAM motifs into pre-amplification products provides an opportunity to remove sequence restriction.

The introduction of PAM sequences into the selected 3 target amplification products is achieved in this example by introducing PAM sequences of Cas12a in the RPA upstream primer (TTTV). Specifically, a PAM sequence was introduced between the 1 st and 2 nd bases and between the 2 nd and 3 rd bases by inserting 0-3bp bases at the 3 'to 5' end of the upstream primer of RPA, and so on, to construct an upstream primer having PAM sites at different positions, and then carrying out RPA amplification reaction with the downstream primer, respectively, resulting in the first base behind the upstream primer sequence being spaced from the PAM sites-1 to 14 positions, respectively, in order to obtain amplified products containing PAM sites at different distances (FIG. 22), and specific sequence information of the RPA primer sequence and the RPA primer sequence inserted with the PAM sequence can be seen in Table 6.

TABLE 6

To verify whether PAM sequences were inserted correctly, the amplification products were sequenced in this example, and it was found that insertion of PAM sequences near the 3' end of the primers had an effect on the accuracy of the flanking sequences (see in particular figures 23 to 26). Products containing sites-1 and 1-3 from PAM cannot be amplified correctly, while other products from PAM sites can be introduced correctly without mutations or deletions of flanking bases. This indicates that the 3' -end of the RPA primer is intolerant to insertion.

To verify whether PAM sequence insertion would affect the analytical sensitivity of the RPA-CRISPR reaction. In this example, the upstream primer sequences of 3 targets (F for CPSIT _0429 (9), F for D614G (3) and F for R346T (4)) in fig. 23 were selected for RPA reaction, and PAM sequence introduction at different distances was constructed, wherein the positions of CPSIT _0429 target were 9, D614G target were 3, and R346T target were 4. Then, through analysis sensitivity experiments of a two-step method, the sensitivity of the CPSIT _0429 target and the R346T target is not affected, and the detection limit of the D614G target is obviously reduced (FIG. 27), which shows that the correctly inserted PAM sequence does not affect the analysis sensitivity of the RPA-CRISPR reaction, and the sensitivity of the incorrectly inserted PAM sequence is reduced.

The results show that a method for introducing TTT by inserting bases into the 4-15 positions of the upstream primer of RPA from the 3' -end can be established, so that the PAM limit of CRISPR detection reaction is broken through, and the position requirement during iterative crRNA design is avoided.

The one-pipe reaction of RPA and CRISPR can save the whole detection time and reduce the operation steps, can bring additional advantages of aerosol pollution removal, and is also very important for the popularization and application of the technology. A recent report has found that glycerol additives can slow down the fusion of RPA to CRISPR systems, thus allowing for a one-tube assay. We also used this method, and first we screened the glycerol additives at different volume ratio concentrations to find that the signal of a one-tube detection reaction at a concentration of 20% was best (FIG. 28). Therefore, we selected 20% glycerol for the next experiment, and found through analysis sensitivity experiments that the addition of 20% glycerol can raise the detection limit of a tube method of 3 targets compared with a tube detection without glycerol (fig. 29), thereby realizing a tube detection (fig. 29). Therefore, we have established a PAM-free, one-pipe RPA-CRISPR detection method.

Example 5

In this example, a CRISPR/Cas12a SNV detection system was constructed for two mutants BA5.2 and XBB of the new coronavirus.

BA5.2 has 1 unique mutation T1050N, 1 unique mutation XBB, Q183E, respectively; based on the non-template strand sequences of the point mutation sites, crRNA for detecting the corresponding SNV sites is designed through crRNA iterative design, and the crRNA can be seen in Table 7; wherein the lower case letter portion is a space.

TABLE 7

Sequence name	Sequence 5'-3'
		Q183E WT crRNA(20bp Spacer)	UAAUUUCUACUAAGUGUAGAUgaccuugaaggaaaagaggg
T1050N WT crRNA(20bp Spacer)	UAAUUUCUACUAAGUGUAGAUagcuaacaccuguaaugaaa

The crRNA engineering flow design can be seen in fig. 30, which comprises the following specific steps:

1) The crRNA in Table 5 was space truncated to 17bp and the truncated crRNA sequence is shown in Table 8.

TABLE 8

Sequence name	Sequence 5'-3'
		Q183E WT crRNA(17bp Spacer)	UAAUUUCUACUAAGUGUAGAUgaccuugaaggaaaaga
T1050N WT crRNA(17bp Spacer)	UAAUUUCUACUAAGUGUAGAUagcuaacaccuguaaug

2) The sequence information of the modified crrnas, also referred to as SNV crrnas, obtained by introducing a wobble base mismatch at position 14 of the Spacer of the truncated crRNA sequences in table 2 is shown in table 9.

TABLE 9

Sequence name	Sequence 5'-3'
		Q183E SNV crRNA(17bp Spacer)	UAAUUUCUACUAAGUGUAGAUgaccuugaaggaaGaga
T1050N SNV crRNA(17bp Spacer)	UAAUUUCUACUAAGUGUAGAUagcuaacaccuguGaug

The specificity of the engineered crrnas was assessed using in vitro synthesized Q183E and T1050N target sequences (see table 10 for non-template sequence specific sequence information), the results of which are shown in figure 31; as can be seen from fig. 31, the detection signal of crRNA after modification drops sharply in the face of the unmutated template, without significant difference from the detection signal of NTC. When facing to the mutant template, the SNV crRNA can have obvious detection signals, and the analysis sensitivity is 10 ² copies per reaction consistent with that of the non-mutant template detected by the WT crRNA; the SNV crRNA of the corresponding target in the example can be used for distinguishing whether the simulated sample (in-vitro synthesized Q183E and T1050N targets) has single base mutation or not, and the SNV crRNA and the simulated sample have obvious difference (p < 0.0001)

Table 10

3) For BA5.2 and XBB, RPA primer sequences were designed, and the primer sequences are shown in Table 11.

TABLE 11

RPA primer sequences	Sequence 5'-3'
		F for Q183E	atgtctctcagccttttcttatggaccttg
R for Q183E	gtgatgttaatacctattggcaaatctacc
		F for T1050N	tgctggtgattacattttagctaacacctg
R for T1050N	ccaacttcccatgaaagatgtaattctctg

Introducing PAM sequence at the 8 th position of the 3 end of the RPA upstream primer aiming at the XBB target, and introducing PAM sequence at the 13 th position of the 3 end of the RPA upstream primer aiming at the BA5.2 target; the primer sequences on the modified RPA are shown in Table 12.

Table 12

Engineering RPA primer sequences	Sequence 5'-3'
		F for Q183E	atgtctctcagccttttcttaTTTGgaccttg
F for T1050N	tgctggtgattacatTTTCagctaacacctg

4) The modified crRNA, modified RPA primer sequence, and 20% glycerol corresponding to the Q183E target were added to the CRISPR/Cas12a system (prepared according to the "detection preparation procedure of CRISPR/Cas12a SNV detection system" in the first paragraph of the specific embodiment), resulting in a one-tube detection system.

60 Pharyngeal swabs (30 strains each comprising second generation sequencing verification BA5.2, XBB) and 30 new crown negative clinical samples of qPCR verified new crown positive real samples were collected. The flow chart of the detection system established by the embodiment can be seen in fig. 32. To ensure the reliability of the detection, each sample was tested 3 times. The SNV crRNA designed for the single base mutation position of the Q183E target in this example can significantly distinguish between BA5.2 and XBB mutants, which have significant differences (p < 0.0001), Q183E TARGET SNV CRRNA has a significant detection signal in the presence of mutant XBB, whereas Q183E TARGET SNV CRRNA has a sharp drop in detection signal in the presence of mutant ba.5.2, without significant differences from the detection signal of NTC. While Q183EWT crRNA was unable to distinguish between BA5.2 and XBB mutants, there was no obvious difference between the two, and the results were shown in FIG. 33 (a). In contrast, SNV crrnas designed by the location of single base mutations at the T050N target could significantly differentiate between BA5.2 and XBB mutants, with significant differences (p < 0.0001). T1050N TARGET SNV CRRNA had a distinct detection signal in the presence of mutant BA.5.2, whereas T1050N TARGET SNV CRRNA had a sharp drop in detection signal in the presence of mutant XBB, without a significant difference from the NTC detection signal. The same T1050N WT crRNA was unable to distinguish between BA5.2 and XBB mutants, and there was no obvious difference between the two.

Subject working characteristics (receiver operating characteristic, ROC) curve analysis was performed on the fluorescence results after 1h of the new crown samples by Q183E SNV CRRNA and T1050N SNV CRRNA, and areas under the curve were observed to be 1.0 and 0.97, respectively, for the corresponding variant, indicating higher discrimination between positive and negative samples, whereas subject working characteristics (receiver operating characteristic, ROC) curve analysis was performed on the fluorescence results of the new crown samples by Q183E WT crRNA and T1050N WT crRNA, and areas under the curve were 0.71 and 0.72, respectively (see fig. 34 for the results). Taken together, the results demonstrate that the performance of the iteratively designed SNV crrnas in distinguishing single base mutation sites is far superior to WT crrnas. Meanwhile, the yin and yang of the detection result are judged according to the criterion value of ROC, and good consistency with the sequencing result is found (fig. 6d, e). Notably, the Ct values of samples not detected by T1050N SNV CRRNA are all substantially less than 30.

The Positive compliance rate (Positive PERCENT AGREEMENT) was 100% and the negative compliance rate (NEGATIVE PERCENT AGREEMENT) was 100% for the XBB mutant detected by Q183E SNV CRRNA, whereas the Positive compliance rate was 100% with Q183E WT crRNA, but the negative compliance rate was drastically reduced by only 10% (see fig. 33 (b)). The Positive compliance (Positive PERCENT AGREEMENT) for the ba.5.2 mutant was 80%, the negative compliance (NEGATIVE PERCENT AGREEMENT) was 100%, the Positive compliance for the WT crRNA was 96.7%, and the negative compliance was 50% as determined by T1050N SNV CRRNA (fig. 33 (b)). Concordance table between CRISPR AND NGS shows that compared with the WT crRNA, the SNV crRNA can greatly improve the negative coincidence rate and the discrimination of single base mutation. The detection method of the embodiment can efficiently, accurately and rapidly detect SNV mutation sites.

In the invention, through the transformation of different areas of the crRNA secondary structure, 4 transformation modes are found to be capable of remarkably improving the trans-cleavage specificity of cas12a enzyme. Wherein M39:3' truncate 1bp (Scaffold engineering) and M42+M43:3' split (Loop engineering) may be due to reduced affinity of crRNA to Cas12a to affect the stability of R-Loop formation to increase specificity, and M63:3'foldback blocking 15bp (Extension engineering) may be due to hairpin secondary structure formation on the spacer to affect R-Loop formation to increase specificity. The two modification modes of M42+M43 and M63 have been successfully verified in CRISPR gene editing function to improve the effect of specificity. However, these three improved methods have insufficient degree of specificity improvement and partial loss of sensitivity.

Truncating the spacer is a preferred approach. The invention carries out fine research on the influence of CRRNA SPACER region truncation in a CRISPR/Cas12a system on the specificity of in-vitro trans-cutting activity for the first time. Although the single and double base specificity increases with increasing spacer truncations, the maximum truncations of different targets are not identical. 17bp spacer is the shortest length that universally maintains cas12a activity. But relying solely on truncations CRRNA SPACER to promote specificity is not perfect. The maximum truncable length is different for targets of different GC values. Furthermore, even the longest truncatable length truncated to the target does not completely eliminate off-target effects, and may also come at the expense of sensitivity.

Single base mutation experiments on crRNA engineering showed that mismatches at the PAM proximal and PAM distal regions had little effect on trans-cleavage activity, whereas previous literature showed that PAM proximal mismatches had a greater effect on cis-cleavage. These results demonstrate that perfect pairing of Cas12 protein PAM proximal regions is of great importance for its cis-cleavage activity, but is not a requirement for activation of trans-cleavage activity. Whereas the sequence of the spacer middle region is sensitive to mismatches, this is necessary for activation of the RuvC catalytic pocket, since the spacer and the intermediate double-stranded region that matches the TS DNA and cas12 protein HELICAL II act directly and influence their conformation. And the adjacent double-base mutation experiment shows that the punishment energy of double-base mismatch is far greater than that of single-base mismatch. But the construction of a single-double mismatch detection strategy is not perfect by only utilizing the characteristic that adjacent mismatch greatly influences R-loop formation. This strategy also requires consideration of how to avoid the influence of single mismatches on sensitivity and problems of target specificity and sequence specificity.

In the present invention, it was found that the fourteenth bit of R-loop is a special position when the spacer is truncated to 17 bp. Wobble base pairing at this position has little effect on the stability of R-loop. This phenomenon may be due to the following reasons: 1. the thermodynamic stability of wobble base pairs is comparable to that of Watson-Crick base pairs, GU pairing is also more common for off-target in vivo, favoring double strand formation. 2. Skeletal steric hindrance may also affect formation of rU-dT base pairs, and the possible spatial position at position 14 may be less limiting. By utilizing the phenomenon, the invention realizes a new strategy for improving specificity through simple iterative reconstruction of crRNA, can realize high specificity through improving k _off and single mismatch penalty for the first time, and keeps sensitivity and universality, and the crRNA reconstruction method only needs to find an A or C base in 2 bases beside a mutation site, which is very easy for a genome sequence, thus ensuring the usability of the crRNA.

The iterative reconstruction of crRNA in the invention has requirements on the introduction position of a swinging base, and PAM-free and one-pipe have great value for realizing popularization and application of RPA-CRISPR diagnostic tools. We therefore solve the above problems by introducing PAM sequences and using glycerol additives in the RPA reaction.

The invention establishes a novel coronavirus point mutation detection platform based on an RPA-CRISPR/Cas12a combined technology. The detection platform has the following characteristics: the single tube has high specificity, does not sacrifice sensitivity, has high universality and simple crRNA reconstruction mode, and the characteristics are convenient for commercialization and popularization and can quickly adjust the scheme when facing new mutant strains. However, there is still a need for further work to improve the detection system to be suitable for detection of low CT value samples and to collect more real samples to verify the reliability and stability of the scheme.

Claims (10)

1. A method for improving specificity of CRISPR/Cas12a SNV detection system is characterized in that crRNA is modified in the method, and the modification method is as follows: and (3) truncating the Spacer sequence part in the crRNA, and introducing wobble base mismatch at a specific position in the truncated Spacer sequence.

2. The method of claim 1, wherein the truncating of the Spacer sequence portion is 2-4 bp truncating at the 3' end of the Spacer sequence; wobble base mismatches were introduced at position 14 in the truncated Spacer sequence.

3. The method of claim 2, wherein the truncating the Spacer sequence portion is by truncating 3bp at the 3' end of the Spacer sequence.

4. The method according to claim 3, wherein the crRNA is modified by the steps of: the nearest distance of the mutation position of the target non-template strand finds an A base or a C base, and the A base or the C base is defined as shortening the length of CRRNA SPACER to 17bp relative to the 14 th position of PAM within +2bp or-2 bp of the mutation position, then the 14 th base on a spacer is changed into U or G, and a wobble base mismatch is introduced at the 14 th position in a spacer-TSDNA heteroduplex.

5. The method of claim 1, wherein the PAM sequence TTTV of Cas12a, V = a/C/G, is introduced into the RPA upstream primer in a method of increasing CRISPR/Cas12a SNV detection system specificity.

6. The method of claim 5, wherein the 4-14 position of the 3' end of the RPA upstream primer introduces the PAM sequence TTTV of Cas12 a.

7. The method of claim 5, wherein the method of increasing CRISPR/Cas12a SNV detection system specificity comprises adding glycerol to the detection system.

8. Use of a method of increasing the specificity of a CRISPR/Cas12a SNV detection system according to any one of claims 1 to 7 in the detection of a novel coronavirus.

9. Use of the method of enhancing CRISPR/Cas12a SNV detection system specificity according to claim 8 in BA5.2 novel coronavirus T1050N targeted detection comprising the steps of:

S1, designing crRNA according to a target sequence of virus T1050N, wherein the crRNA is shown as SEQ ID NO.1 in a sequence table, and the crRNA is specifically as follows: 5'-UAAUUUCUACUAAGUGUAGAUagcuaacaccuguaaugaaa-3', wherein the lower case letter portion is a Spacer sequence;

S2: shortening 3bp at the 3' -end of the Spacer sequence in the crRNA in the step S1, wherein the truncated crRNA is shown as a sequence SEQ ID NO.2 in a sequence table, and the specific steps are as follows: 5'-UAAUUUCUACUAAGUGUAGAUagcuaacaccuguaaug-3'; then, the 14 th A of the truncated Spacer sequence is changed into G to obtain the reconstructed crRNA (SNV crRNA), and the reconstructed crRNA is shown as a sequence SEQ ID NO.3 in a sequence table, and the concrete steps are as follows: 5'-UAAUUUCUACUAAGUGUAGAUagcuaacaccuguGaug-3';

S3, according to the T1050N target, the RPA upstream primer and the RPA downstream primer are respectively shown in the sequence SEQ ID NO.4 and the sequence SEQ ID NO.5, and the specific steps are as follows: 5'- - -TGCTGGTGATTACATTTTAGCTAACACCTG- -3'; r is 5'-ccaacttcccatgaaagatgtaattctctg-3'; inserting a base at 13 positions of the RPA upstream primer, which are far from the 3' -end, to introduce a PAM sequence TTTC, so as to obtain an improved RPA upstream primer; the sequence of the modified RPA upstream primer is shown as a sequence SEQ ID NO.6 in a sequence table, and the specific sequence is shown as F5'-tgctggtgattacatTTTCagctaacacctg-3';

And S4, adding the modified crRNA, the RPA upstream primer, the RPA downstream primer and the glycerol into the CRISPR/Cas12a system to obtain the CRISPR/Cas12a SNV detection system with high specificity by taking T1050N as a target point.

10. Use of the method of enhancing CRISPR/Cas12a SNV detection system specificity according to claim 8 in XBB neocoronavirus Q183E targeted detection comprising the steps of:

S1, designing crRNA according to a virus Q183E target sequence, wherein the crRNA is shown as a sequence SEQ ID NO.7 in a sequence table, and the crRNA is specifically as follows: 5'-UAAUUUCUACUAAGUGUAGAUgaccuugaaggaaaagaggg-3', wherein the lower case letter portion is a Spacer sequence;

S2: shortening 3bp at the 3' -end of the Spacer sequence in the crRNA in the step S1, wherein the truncated crRNA is shown as a sequence SEQ ID NO.8 in a sequence table, and the specific steps are as follows: 5'-UAAUUUCUACUAAGUGUAGAUgaccuugaaggaaaaga-3'; then, the 14 th A of the truncated Spacer sequence is changed into G to obtain the reconstructed crRNA (SNV crRNA), and the reconstructed crRNA is shown as a sequence SEQ ID NO.9 in a sequence table, and the concrete steps are as follows: 5'-UAAUUUCUACUAAGUGUAGAUgaccuugaaggaaGaga-3';

S3, according to the Q183E target, the RPA upstream primer and the RPA downstream primer are respectively shown in the sequence SEQ ID NO.10 and the sequence SEQ ID NO.11, and the specific steps are as follows: f, 5'-atgtctctcagccttttcttatggaccttg-3'; r is 5'-gtgatgttaatacctattggcaaatctacc-3'; inserting a base at 13 positions of the RPA upstream primer, which are far from the 3' -end, to introduce a PAM sequence TTTG, so as to obtain an improved RPA upstream primer; the sequence of the modified RPA upstream primer is shown as a sequence SEQ ID NO.12 in a sequence table, and the method is specifically as follows: f, 5'-atgtctctcagccttttcttaTTTGgaccttg-3';

And S4, adding the modified crRNA, the RPA upstream primer, the RPA downstream primer and the glycerol into the CRISPR/Cas12a system to obtain the CRISPR/Cas12a SNV detection system with high specificity by taking Q183E as a target point.