CN118006584A - Programmable nuclease with CRISPR loci completely deleted from Cas1, cas2 and Cas4 and application thereof - Google Patents

Abstract

The invention discloses programmable nucleases with CRISPR loci completely deleted from Cas1, cas2 and Cas4 and application thereof, and relates to the technical field of biology. The invention provides novel Cas12a nucleases, wherein the PAM recognition range of the novel Cas12a nucleases is larger than that of the traditional nucleases, and targets of various genes can be recognized. When the novel nuclease is used for editing the nucleic acid fragment, the defects of the traditional Cas12a can be overcome, and the gene editing efficiency of cells is improved. And under Mn ²⁺ ion condition, the side-cutting activity of the novel nuclease is rapidly activated, and the signal intensity during detection can be obviously improved in nucleic acid detection, so that the detection time is shortened, and the detection efficiency is improved. The advantages enable the invention to be more suitable for editing and detecting the nucleic acid fragments with wider range, and lay a foundation for the application of the invention in gene editing and detection.

Description

Programmable nuclease with CRISPR loci completely deleted from Cas1, cas2 and Cas4 and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to programmable nucleases with CRISPR loci completely deleted from Cas1, cas2 and Cas4 and application thereof.

Background

The CRISPR-Cas system is originally derived from the RNA-guided adaptive immune system of bacteria for protection against the nucleic acid components of invading bacteria including phage genes. CRISPR refers to clustered, regularly interspaced short palindromic repeats (clustered regularly interspaced short palindromic repeats), derived from phage DNA fragments that can infect prokaryotes, which can detect and destroy similar DNA in other phages that can cause similar infection, and is therefore critical for prokaryote anti-phage. Cas protein refers to CRISPR-associated protein, which is a related protein in a CRISPR system. The CRISPR Locus (CRISPR Locus) consists of one operon encoding a Cas protein and one repeat spacer sequence (REPEAT SPACER), and can be guided by RNA corresponding to the spacer sequence (spacer) in the CRISPR sequence, identifying and cleaving DNA strand (R,B.,et al.,CRISPR provides acquired resistance against viruses in prokaryotes.Science(New York,N.Y.),2007,315(5819)：p.1709-12.).CRISPR/Cas systems specific for its complement into two major classes, class1 and Class2 respectively, with the difference that the functional protein in the first major Class consists of multiple Cas proteins, whereas the functional protein in the second major Class is a single protein (Kira S.Makarova.,Evolutionary classification of CRISPR-Cas systems：a burst of class 2 and derived variants.Nat Rev Microbiol.2020 Feb;18(2)：67-83.). comprising multiple domains, the second major Class has always been the hotspot of research applications, including type II, type V and type VI 3 types.

The CRISPR/Cas9 system belongs to a Class 2 and type II CRISPR system, consists of Cas9 nuclease, crRNA and tracrRNA, and is the most widely used gene editing tool at present; the method is simple and efficient, can realize gene editing by only synthesizing a new segment of RNA, and has the characteristics of simple design and easy operation. CRISPR/Cas9 makes gene editing faster, more accurate and easier to operate, and can also be applied to various aspects including human medicine, agriculture, biofuel and the like, and is a technology with social subversion. CRISPR-Cas tools have greatly accelerated the foothold of scientific research, while Cas-based biotechnology has also progressed rapidly.

Currently, CRISPR/Cas systems have evolved from the original CRISPR/Cas9 to the current CRISPR/Cas12a, CRISPR/Cas13a, and like various gene editing systems. The CRISPR-Cas12a is 2-Type RNA guided endonuclease, and a CRISPR system (Zetsche B,Gootenberg J S,Abudayyeh O O,et al.Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.Cell,2015,163(3)：759-771.).CRISPR-Cas12a(Cpf1), capable of being used for editing a genome of a mammal belongs to Class2 Type V, is small in size, has the capability of RNA endonuclease and DNA endonuclease, can recognize a PAM sequence rich in thymine (T), and expands the editable range of the CRISPR/Cas system. Conventional CRISPR-Cas12 sites (CRISPR Locus) include effector protein Cas12 proteins, as well as acquisition (Adaptation) phase related proteins Cas4, cas1 and Cas2, as shown in the diagram of fig. 1 a. Cas1, cas2 are highly conserved proteins in current CRISPR/Cas systems, with Cas1 having nuclease activity, whereas Cas2 does not. The Cas1-Cas2 complex functions to aid integration PRESPACER into CRISPR ARRAY, while Cas4 is responsible for completing the identification and removal of PAM sequences, processing the captured exogenous DNA fragments to the appropriate length and promoting Spacer insertion into CRISPR arrays in the correct orientation, selection, processing and directional integration of PRESPACER is critical (Chunyi Hu,et al.Mechanism for Cas4-assisted directional spacer acquisition in CRISPR-Cas.Nature volume 598,pages515-520 (2021)). whereas in systems partially containing Cas1-Cas2, without Cas4, dnaQ is capable of processing PAM-containing and PAM-free DNA strands to standard lengths for integration reactions, i.e., dnaQ performs Cas 4-like functions (Dongmei Tang,et al.DnaQ mediates directional spacer acquisition in the CRISPR-Cas system by a time-dependent mechanism.The Innovation,Volume 4,Issue 5,2023.).

The CRISPR-Cas12 system not only has better target cutting DNA activity, but also shows the editing characteristic which is obviously different from CRISPR-Cas 9. Cas12a nucleases expand the selection range of gene editing target sites with lower off-target effects. In contrast to Cas9 nucleases, cas12a nucleases recognize DNA target sequences complementary to the crRNA spacer, without the use of tracrRNA. Moreover, the molecular weight of the Cas12a protease is smaller, the Cas12a protease is easier to enter cells, and the editing success rate is higher. Meanwhile, the Cpf1 system may be more advantageous for applications such as integration of DNA sequences in precise directions than the Cas9 producing blunt ends by recognizing T-rich PAM and leaving sticky ends at its targeted DNA sequence to produce gene editing effects. In addition to Cas12a being a multifunctional protein containing a double-stranded DNA binding domain and a nuclease domain, cas12a targets the activity of binding to cleave the target nucleic acid while concomitantly activating the paraclinizing activity, i.e., the cleavage activity (S.Y.Li et al.,CRISPR-Cas12a has both cis-and trans-cleavage activities on single-stranded DNA.Cell Res 28,491-493(201 8).). that nonspecifically cleaves ssDNA, but traditional gene editing of Cas12a proteins is limited by the prosomain sequence adjacent motif (PAM), only part of the nucleic acid target can be recognized, e.g., lbCas a tends to recognize PAM sequences containing TTTV; internationally widely used are the amino acid cocci Cpf1 (Acidaminococcus Cpf1, asCpf 1) and the Mahalanobis Cpf1 (Lachnospiraceae Cpf1, lbCPf 1), which have limited application in the field of gene editing due to their lack of flexibility in recognizing the adjacent motif of the 5'-TTTN-3' prosomain sequence. Therefore, it is desirable to find new Cas12a proteins, and to find new Cas12a proteases that have a broader recognition range and are more convenient to use.

Disclosure of Invention

The technical problem to be solved by the invention is to overcome the defect that the PAM range of a dsDNA target sequence is limited by Cas12a in the prior art, and the CRISPR locus is found to contain no protein of any one of Cas1, cas2 and Cas4 by metabase data mining, as shown in a graph of figure 1b, so the invention provides a programmable nuclease with the CRISPR loci completely deleted of Cas1, cas2 and Cas4 and application thereof, wherein the CRISPR loci completely delete the programmable nucleases of Cas1, cas2 and Cas4, namely novel Cas12a nuclease, which are named RbrCas12 112a, rbrCas12 1a_2, rbrCas12 1a_3 and RbrCas a_4 respectively, and the PAM recognition range is larger than that of the traditional nuclease, so that targets of various genes can be recognized. The invention also provides application of the novel Cas12a nuclease in preparing a kit for detecting nucleic acid, and Mn ²⁺ ions are added to activate bypass cutting activity of the novel Cas12a nuclease, so that detection targets are realized. The PAM recognition range of the nuclease is larger than that of the traditional nuclease, the reaction speed is faster, and the detection is faster and more sensitive.

The CRISPR locus completely deletes programmable nucleases of Cas1, cas2 and Cas4, namely Cpf1 protein, and the amino acid sequence of the Cpf1 protein is shown as SEQ ID NO. 2-5.

The invention also provides a fusion protein comprising the Cpf1 protein, and one or more functional domains. The functional domain is selected from deaminase and methyltransferase.

The invention also provides a polynucleotide encoding the Cpf1 protein or the fusion protein.

Cpf1 (Cas 12 a) can recognize DNA nucleic acid sequences under the guidance of RNA, but the conventional PAM recognition range of Cas12a protein is limited, such as LbCas a PAM is TTTV, and the novel protease found by us can recognize PAM in a wider range, so that the recognition range is enlarged.

Preferably, the polynucleotide is codon optimized for expression in a cell of interest.

The invention also provides a vector comprising the polynucleotide.

The Cpf1 protein is Cpf1 protein subjected to codon optimization, a prokaryotic codon optimization is carried out on Cpf1 protein nucleic acid sequences from various sources to obtain sequences, the sequences are constructed into a pET28a expression vector, low-temperature induced soluble protein expression is carried out, and target proteins are obtained through affinity purification and molecular sieve purification.

The invention also provides a V-type CRISPR/Cas 12a gene editing system which comprises the Cpf1 protein or polynucleotide encoding the Cpf1 protein.

The V-type CRISPR/Cas 12a gene editing system also comprises CRISPR RNA. The sequence of CRISPR RNA is at least one of SEQ ID NO. 13-16.

The invention also provides application of the Cpf1 protein, or the fusion protein, or the polynucleotide, or the vector, or the gene editing system in gene editing.

Preferably, the application is binding, target cleavage or non-target cleavage of DNA.

The invention also provides a method for editing the genes, and the target DNA is edited by using the gene editing system.

The method specifically comprises the following steps:

(1) Designing CRISPR RNA aiming at a target gene sequence to be edited;

(2) Constructing a gene editing vector comprising a CRISPR RNA coding gene sequence and the polynucleotide;

(3) Introducing the gene editing vector in the step (2) into a receptor cell to be subjected to gene editing, and screening to obtain a transgenic cell after gene editing.

In the present invention, once the target ds nucleic acid, crRNA and Cas12a protein form a ternary complex, the cleavage activity of Cas12a protease is activated and the target dsDNA is cleaved by Cas12 a. Different target DNA fragments can be targeted by designing different crRNA sequences in the presence of a suitable PAM.

In the present invention, the target DNA molecule is inserted into pcDNA3.1 vector, and the plasmid is linearized by PCR method. In the gene editing identification experiment, when the corresponding crRNA is added in the presence of PAM recognized by the Cas12a protease, the protease can cut the target DNA molecule from the linearization vector. The reaction system is heated at 95 ℃ for 5-10 minutes to inactivate the Cas12a protease, and then agarose gel electrophoresis is carried out to observe the cut target DNA molecules.

The invention also provides application of the Cpf1 protein in preparing a kit for detecting nucleic acid, wherein the amino acid sequence of the Cpf1 protein is shown in SEQ ID NO. 2-5.

The invention also provides a nucleic acid detection kit, which comprises a Cpf1 detection system, wherein the Cpf1 detection system comprises: guide RNA, cpf1 protein, nucleic acid probe and manganese ion-containing solution;

In the invention, once the target nucleic acid of the sample to be detected, crRNA and Cas12a protein form a ternary complex, the complex can cleave other single-stranded DNA molecules in the system. Targeting a target nucleic acid by designing crrnas; adding crRNA and Cas12a protein to a detection system; when the target DNA is present, cas12a forms a ternary complex with crRNA and target DNA, while the complex exerts its trans-cleavage activity and cleaves single-stranded DNA labeled with a fluorescent signal, thereby emitting fluorescence.

The guide RNA is crRNA for guiding Cpf1 protein to specifically bind to nucleic acid;

The amino acid sequence of the Cpf1 protein is shown as SEQ ID NO. 2-5.

Preferably, the solution containing manganese ions may be manganese sulfate, manganese chloride or manganese acetate solution. In the example of the embodiment of the invention, the solution containing manganese ions is preferably a manganese chloride solution, and in the example of the embodiment of the invention, the final concentration of manganese ions in the solution containing manganese ions is 10mM;

And/or, the nucleic acid probe is a single-stranded DNA probe.

In addition, we found that Cas12a protease has greatly improved cleavage efficiency in the presence of Mn ²⁺ and that target molecules can be detected faster.

Preferably, the nucleic acid probe is a single-stranded DNA probe, which preferably includes a fluorescent label, more preferably has a fluorescent group and a fluorescence quenching group at both ends thereof, and even more preferably has a fluorescent group at the 5 'end and a fluorescence quenching group at the 3' end. The fluorophore may be conventional in the art, for example, 6-FAM, TET, CY, CY5, or ROX.

The fluorescence quenching group may be conventional in the art, for example, BHQ1, BHQ2, or BHQ3. The single-stranded DNA probe may be prepared by a method conventional in the art, and its sequence may be TTATT, for example.

The Cpf1 detection system comprises the following specific components: 200ng Cpf1 protein, 25pM nucleic acid probe, 1. Mu.M crRNA, 2. Mu.L of sample to be tested, and a final volume of 20. Mu.L.

Preferably, the detection kit further comprises a reaction buffer solution, wherein the reaction buffer solution comprises NaCl, tris-HCl and BSA (bovine serum albumin); the pH of the reaction buffer was 7.5.

In an example of an embodiment of the invention, the reaction buffer is 100mMNaCl,50mM Tris-HCl, 100. Mu.g/mL BSA, pH 7.5.

Preferably, the reaction temperature of the Cpf1 assay system is 37℃and the reaction time of the Cpf1 assay system is 30 minutes.

The nucleic acid detection kit for rapidly detecting nucleic acid provided by the invention can be used for fluorescent detection by using an enzyme-labeled instrument or can be used for macroscopic detection by using fluorescence. In the invention, when the nucleic acid probe (for example ssDNAFQ reporter) is used for fluorescence detection by an enzyme-labeled instrument, the detection excitation light is set to 485nm-520nm; when the detection is directly carried out by naked eyes, a light emitter capable of generating a 485nm wavelength light source is selected for detection.

Term interpretation:

The term crRNA refers to CRISPR RNA, a short RNA that directs Cas12a (Cpf 1) to bind to a target DNA sequence.

The term CRISPR refers to clustered, regularly interspaced short palindromic repeats (clustered regularly interspaced short palindromic repeats), which are the immune system of many prokaryotes.

The term Cas protein refers to a CRISPR-associated protein, which is a related protein in a CRISPR system.

The term Cpf1 (also known as Cas12 a) refers to a crRNA-dependent endonuclease, which is an enzyme of type V (type V) in the CRISPR system classification.

The term PAM refers to a protospacer-adjacent motif (protospacer-adjacent motif) that is necessary for Cas12a cleavage, the PAM of FnCas a being the TTN sequence, and the PAM of LbCas a being the TTTN sequence.

On the basis of conforming to the common knowledge in the field, the above preferred conditions can be arbitrarily combined to obtain the preferred examples of the invention. The reagents and materials used in the present invention are commercially available.

The invention has the beneficial effects that:

The present invention provides programmable nucleases, named RbrCas12a_1, rbrCas12a_2, rbrCas12a_3 and RbrCas12a_4, respectively, with complete deletion of the CRISPR loci Cas1, cas2 and Cas 4. Their PAM recognition range is larger than that of conventional nucleases, and can recognize targets of various genes.

When the novel nuclease is used for editing the nucleic acid fragment, the defects of the traditional Cas12a can be overcome, and the gene editing efficiency of cells is improved. And under Mn ²⁺ ion condition, the side-cutting activity of the novel nuclease is rapidly activated, and the signal intensity during detection can be obviously improved in nucleic acid detection, so that the detection time is shortened, and the detection efficiency is improved.

The advantages enable the invention to be more suitable for editing and detecting the nucleic acid fragments with wider range, and lay a foundation for the application of the invention in gene editing and detection.

Drawings

FIG. 1 is a schematic representation of classical and non-classical CRISPR (a) site building block.

FIG. 2 is a graph showing the cleavage activity of programmable nucleases RbrCas a_1, rbrCas12a_4 at different temperatures.

FIG. 3 is a graph showing the cleavage activity of programmable nucleases RbrCas a_2, rbrCas12a_3 at different temperatures.

FIG. 4 is a graph showing the in vitro bypass activity of programmable nucleases.

FIG. 5 is a graph of metal ion preference detection of programmable nucleases.

FIG. 6 is a thermal diagram of programmable nuclease PAM identification.

FIG. 7 is a graph showing the detection of intracellular activity of a programmable nuclease.

Detailed Description

The application will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present application and are not intended to limit the scope of the present application. Furthermore, it should be understood that various changes and modifications can be made by one skilled in the art after reading the teachings of the present application, and such equivalents are intended to fall within the scope of the application as defined in the appended claims.

The experimental methods, in which specific conditions are not noted in the following examples, were selected according to conventional methods and conditions, or according to the commercial specifications.

In the present invention, conventional reagents such as Tris-Base (i.e., tris Base, chinese name also referred to as Tris (hydroxymethyl) aminomethane), bovine Serum Albumin (BSA), naCl, tris-HCl (i.e., tris hydrochloride, chinese name: tris (hydroxymethyl) aminomethane hydrochloride), glycerol, etc. are purchased from the national pharmaceutical company; the nucleic acid fragment for detection and RNA synthesis are synthesized by Jiangsu Saikovia Biotechnology Co., ltd; transfection reagents for transfection of mammalian cells were purchased from Shanghai plum Biotechnology Co., ltd; in the experiment, the second generation sequencing experiment was completed by Shanghai Paeno Biotechnology Co., ltd; the cell sorter used in the experiment was an overspeed flow cell sorting system (BD FACSARIA III).

Conventional CRISPR-Cas12 sites (CRISPR Locus) include effector protein Cas12 proteins, as well as acquisition (Adaptation) phase related proteins Cas4, cas1 and Cas2, as shown in the diagram of fig. 1 a. According to the invention, the protein with CRISPR sites not containing any one of Cas1, cas2 and Cas4 is found through macro gene data mining, as shown in a graph of figure 1 b.

The invention will be further illustrated with reference to specific examples.

Example 1: in vitro cleavage Activity identification of novel Cas12a proteases

Preparation of Cas12a protease

The genes of Cpf1 (Lachnospiraceae Cpf1, lbCPf 1), also known as LbCas a (gene sequence shown as SEQ ID NO. 6), and novel Cas12a proteases (named RbrCas a_1, rbrCas a_2, rbrCas12a_3, and RbrCas12a_4, respectively) of the present embodiment (gene sequences shown as SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO. 10) were codon optimized to make them more suitable for expression in E.coli strains. The gene was amplified by PCR with NcoI and BamHI primers, and the pET28a plasmid vector was digested simultaneously with NcoI and BamHI, and then the PCR product and plasmid digested products were subjected to cleavage site ligation reaction with T4 ligase. The enzyme-linked reaction products transform DH5a competent cells, and monoclonal is selected for sequencing and identification. Plasmid vectors of the normal insert gene fragments were extracted and BL21 competent cells were transformed. LbCPf1 and novel Cas12a proteins were expressed in E.coli, bacteria in the medium were collected, sonicated cells, nickel column affinity chromatography purified, proteins of interest were eluted using different concentrations of imidazole, and distinct protein bands were seen in 250 and 500mM imidazole eluates. The amino acid sequences of LbCas a and the novel Cas12 protease used in the experiment are shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3SEQ ID NO.4 and SEQ ID NO. 5.

2. Preparation of nucleic acids

CrRNAs the synthesis was completed by Beijing engine biotechnology limited, sequence crRNAs synthesized: mers-cr2+: uaaUUUcUacUaagUgUagaUGACAUAUGGAAAACGAACUAUGU.

The target DNA is MERS virus gene fragment (the sequence used in the experiment is shown as SEQ ID NO. 11), forward and reverse primers respectively carrying Nhe I and BamH I enzymes are used for PCR expansion of the target DNA fragment, then Nhe I and BamH I are used for double enzyme digestion of pcDNA3.1 vector, the digested vector and PCR expansion product are subjected to reconnection under the action of T4 ligase, and DH5a competent cells are transformed by the connection product. Selecting monoclonal, shaking, and collecting thallus to extract plasmid vector. The extracted plasmid was used to generate linear dsDNA by PCR for detection of the reaction. PCR all primer sequences: p3.1-F: GAACAAGATGGATTGCACGC, p3.1-R: GATCCTCATCCTGTCTCTTG.

3. CRISPR/Cas12 a-based in vitro gene cleavage Activity detection

The crRNA in the experiment consisted of one 21 nt region that interacted with Cas12a and one 23nt programmable guide region for target DNA recognition. The assay system used 400ng of Cas12a protease, 100ng of target DNA fragment, crRNA in an amount of 5pmol and the final volume of the reaction was 10. Mu.L. The reaction is incubated at 37 ℃ or room temperature for one hour, the temperature is heated for 5-10 minutes at 95 ℃ to inactivate the Cas12a protease, agarose gel electrophoresis is carried out, the cut target DNA molecules are observed, and the linearized plasmid is cut by the Cas to form two DNA fragments with the lengths of about 4400bp and 1300 bp.

In a gene editing system, once the crRNA-mediated Cas protease targets the target DNA molecule, the cleavage activity of the protease will be activated and then the target DNA fragment will be cleaved. The specific results of the experiments are shown in FIG. 2, and it can be seen from FIG. 2 that RbrCas a_1, rbrCas a_2, rbrCas a_3, and RbrCas a_4 protease can cleave the target dsDNA molecule at 37℃and room temperature in an in vitro cleavage activity experiment, as shown in FIGS. 2 and 3, respectively. Some star activity, i.e., high cleavage activity, was seen at 37℃for RbrCas a_2 and RbrCas a_3 proteins, whereas cleavage activity was more normal at room temperature.

Example 2: identification of novel Cas12a protease bypass-cleavage Activity

1. Nucleic acid preparation

CrRNAs the synthesis was completed by Beijing engine biotechnology limited, sequence crRNAs synthesized: mers-cr2+: uaaUUUcUacUaagUgUagaUGACAUAUGGAAAACGAACUAUGU. The target dsDNA molecule used was obtained from pcdna3.1 vector PCR of MERS virus gene fragment in example 1, primers used for PCR: mers-p3.1-F: ACGGCTAGCGCTACCATGCTGTTTTCGTG, mers-p3.1-R: ACGGGATCCTTCAAAAAAACACACATAATC.

2. In vitro bypass activity detection based on CRISPR/Cas12a

The crRNA consists of a 21 nt region that interacts with Cas12a and a 23nt programmable guide region (called a spacer) for target DNA recognition. A single stranded DNA reporter gene (ssDNA-FQ) labeled with FAM and BHQ1 was synthesized from Jin Weizhi and the sequence was 5'-FAM-TTATT-BHQ1-3'. Detection was performed with 200ng purified Cas12a,25pM ssDNA-FQ,1 μΜ crRNA,2 μl sample, a final volume of 20 μl. The reaction was incubated at 37 ℃. In the detection system, ssDNA-FQ is cleaved once Cas12a is activated by the target sequence. The full wavelength microplate reader was used to measure the fluorescence of the detection reaction, with excitation wavelength of 485nm and emission wavelength of 520nm. The signal was recorded every 0.5 minutes for 0.5 hours.

As shown in FIG. 4, the detection results of the bypass activity show that LbCas a has obvious bypass activity under NEB r3.1buffer environment, while the fluorescent signals of RbrCas a_1, rbrCas12 1a_2, rbrCas12 112a_3 and RbrCas12a_4 are very weak. The novel Cas12a protease is poor in bypass cutting activity under the conventional environment. In the context of intracellular genome editing, cas12a target-activated ssDNA cleavage may be a rare event, but it is possible to cleave transiently exposed ssDNA at the replication fork, R loop and transcription blebs or ssDNA templates for homology-directed repair, causing unintended effects on cellular physiological activity. The bypass activity is a property shared by Cas12a, and has potential side effects in intracellular gene editing due to the indiscriminate cleavage of ssDNA in the system after the cleavage activity is activated, so that the novel Cas12a with weak self bypass activity is probably more beneficial to intracellular gene editing.

Example 3: metal ion preference detection of novel Cas12a protease

After the Cas12a protease forms a ternary complex with crRNA and target DNA, the complex will exhibit strong "hackle" activity, whose bypass activity requires the presence of Mg ²⁺. In addition to conventional detection systems, we found that Mn ²⁺ greatly improved the parachuting activity of proteases. Taking RbrCas a_1 protease as an example, ion preference detection of novel Cas12a protease bypass activity was performed.

20. Mu.L of the detection system was reacted with 100X 10 ^-3M NaCl,50×10^-3 M Tris-HCl, 100. Mu.g/mL BSA (bovine serum albumin), pH 7.5. To the buffer was added 2. Mu.l of NEB r3.1buffer at a concentration of 10×10^-3 M CaCl₂、CoCl₂、CuCl₂、MgCl₂、MnCl₂、NiCl₂、ZnCl₂. The nucleic acid fragments used for the detection were as in example 2.

As a result, as shown in FIG. 5, the protein activity was greatly improved under Mn ²⁺ conditions. The results demonstrate that the RbrCas12a—1 protease detects the target molecule faster and the fluorescent signal is stronger in the presence of Mn ²⁺. In the subsequent PAM detection experiments, the RbrCas a_1 protease reaction system is added with Mn ²⁺.

Example 4: PAM identification of novel Cas12a proteases

Cas12a recognizes T-rich PAMs, but traditional Cas12a proteins tend to recognize PAM sequences containing TTTV, such as LbCas a and AsCas a. By taking RbrCas a_1 protease as an example, the sequence of the protease is identified by a PAM identification method which is developed before (the name of the invention is that of a method for identifying a motif adjacent to a forebay sequence; the patent application number is 202310173577.1).

The PAM identification results of RbrCas12a_1 are shown in fig. 6, and the results show that the novel Cas12a protease can recognize the PAM site of TTTV of the conventional Cas, but TTTV is not the optimal PAM sequence, and GGTV has a stronger recognition capability. In addition, the novel Cas12a protease can also recognize a plurality of PAM sequences such as KGTN, ARTV, TTCM, TATM, ATTR, AGCS, CTTD, CGTM, GTTV, GCTM, GGGH, GGCM, KNTA, NDTA, DNTA, MGCG, RGGC and the like. Wherein R represents a+ G, M represents a+ C, K represents g+ T, S represents c+ G, H represents a+c+ T, V represents a+c+ G, D represents a+g+ T, N represents a+c+g+t.

Example 5: novel Cas12a protease intracellular cleavage activity assay

To identify whether the novel protease has gene editing activity in mammalian cells, we have validated in 293T cells using RbrCas a_1 protease as an example.

Cloning RbrCas a_1 gene fragment (gene sequence is shown as SEQ ID NO. 7), wherein the amino acid sequence of RbrCas a_1 used in the experiment is shown as SEQ ID NO.2, and the LbCas gene fragment and the amino acid sequence are shown as SEQ ID NO.6 and SEQ ID NO. 1. The PCR-expanded gene fragment, pST1374 (Addgene, # 13426) vector was digested with Not I, and then the gene fragment and vector were recombined under the action of recombinase (Noruzan, C112-01). Sequencing to identify the recombinant plasmid vector, and extracting the plasmid. The sgRNA vector used was pGL3-U6-sgRNA-EGFP vector, to which repeat fragment of AsCas 12: 12A CRISPR ARRAY was added by point mutation experiments following the U6 promoter, the sequence: TAATTTCTACTCTTGTAGAT.

Sequencing and identifying mutant plasmid vector, adding target gene sequence of cut gene locus on plasmid vector with correctly inserted repeat fragment through point mutation experiment. The name of the cleavage gene, PAM and the base sequence are shown in table 1:

TABLE 1

Name of the name	Gene locus	PAM	Sequence (5 '-3')
				sitel	FANCF	TTTG	tgtggcgaaagtaaaagtattag
site2	FANCF	TTTC	accttggagacggcgactctctg
				site3	EMX1	TTTC	tcatctgtgcccctccctccctg
site4	EMX1	TTTG	tggttgcccaccctagtcattgg

The expression plasmid and sgRNA plasmid vector are obtained, and the corresponding crRNA sequences are shown as SEQ ID NO.13-SEQ ID NO.16. 900ng of pST1374 expression plasmid per sample, 300ng of sgRNA vector per sample, and the plasmid was transfected into 293 cells according to the instructions of the EZ Trans cell transfection reagent (Lei Ji Bio, AC04L091/AC04L 092), three replicates were performed at each site, and incubated at 37℃for 72 hours. Then, a flow cell sorting system is used for sorting cells with green fluorescence, then the cells are lysed, and the lysate is taken for PCR expansion of the cleavage site gene fragments. Agarose gel electrophoresis identifies the length of the target fragment, then the fragment is recovered, NGS sequencing is carried out, and the cleavage effect of each site is analyzed after the sequencing result is obtained.

The results of the intracellular activity assay of the novel Cas12a protease are shown in fig. 7. The results show that the cleavage efficiency of RbrCas12a_1 was better than that of the conventional LbCas a protease at site2 and site 3. At site4, the cleavage efficiency of RbrCas a_1 was comparable to LbCas a protease. Novel Cas12a proteases, such as RbrCas a_1, are shown to have cleavage activity in cells and cleavage efficiency at partial sites is better than LbCas a, indicating that these novel Cas12a can be used as tool enzymes for gene editing in mammalian cells.

Claims (10)

1. A programmable nuclease with complete deletion of Cas1, cas2 and Cas4 at crispr loci, characterized by the designation Cpf1 protein, the amino acid sequence of the Cpf1 protein being shown in SEQ ID No. 2-5.
2. 2. A fusion protein comprising the Cpf1 protein of claim 1, and one or more functional domains.
3. 3. A polynucleotide encoding the Cpf1 protein of claim 1 or the fusion protein of claim 2.
4. 4. A vector comprising the polynucleotide of claim 3.
5. 5. A V-type CRISPR/Cas 12a gene editing system comprising the Cpf1 protein of claim 1 or a polynucleotide encoding the Cpf1 protein of claim 1.
6. 6. The V-type CRISPR/Cas 12a gene editing system of claim 5, further comprising CRISPR RNA;

   The sequence of CRISPR RNA is at least one of SEQ ID NO. 13-16.
7. 7. Use of the Cpf1 protein of claim 1, the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the gene editing system of claim 5 or 6, in gene editing.
8. 8. A method of gene editing comprising the steps of:

   (1) Designing CRISPR RNA aiming at a target gene sequence to be edited;

   (2) Constructing a gene editing vector comprising a CRISPR RNA coding gene sequence and the polynucleotide of claim 3;

   (3) Introducing the gene editing vector in the step (2) into a receptor cell to be subjected to gene editing, and screening to obtain a transgenic cell after gene editing.
9. The application of Cpf1 protein in preparing a kit for nucleic acid detection, wherein the amino acid sequence of the Cpf1 protein is shown in SEQ ID NO. 2-5.
10. 10. A nucleic acid detection kit comprising a Cpf1 detection system, wherein said Cpf1 detection system comprises: guide RNA, cpf1 protein, nucleic acid probe and manganese ion-containing solution;

    the guide RNA is crRNA for guiding Cpf1 protein to specifically bind to nucleic acid;

    The amino acid sequence of the Cpf1 protein is shown as SEQ ID NO. 2-5.