CN118006806A

CN118006806A - Lactobacillus reuteri strain A21041 specific detection primer, kit and application and screening method

Info

Publication number: CN118006806A
Application number: CN202410021642.3A
Authority: CN
Inventors: 庞世福; 罗卫飞; 蒙丽丽; 肖桂龙; 黄连飞; 余秀齐
Original assignee: Guangxi Aisheng Life Technology Co ltd
Current assignee: Guangxi Aisheng Life Technology Co ltd
Priority date: 2024-01-05
Filing date: 2024-01-05
Publication date: 2024-05-10

Abstract

The invention provides a lactobacillus reuteri (Limosilactobacillus reuteri) strain A21041 specific detection primer, a kit and a screening method, belonging to microorganism detection. The invention screens out a novel specific nucleic acid molecule at the species level of the lactobacillus reuteri, designs a corresponding primer, and can realize the specific detection of the lactobacillus reuteri. Meanwhile, based on the strict host specificity of phage, the invention identifies and screens phage sequences for distinguishing different strains from different strain genomes, screens out specific genes of the strain A21041, compares the specific genes with phage sequences to obtain nucleic acid molecules for specifically detecting the lactobacillus reuteri strain A21041, and the designed primers have ideal detection specificity, sensitivity, repeatability and stability for the lactobacillus reuteri strain A21041.

Description

Lactobacillus reuteri strain A21041 specific detection primer, kit and application and screening method

Technical Field

The invention belongs to the technical field of microorganism detection, and particularly relates to a lactobacillus reuteri (Limosilactobacillus reuteri) strain A21041 specific detection primer, a kit, application and a screening method.

Background

Probiotics regulate intestinal flora and maintain intestinal health through their own metabolites, which mainly include short chain fatty acids, extracellular polysaccharides, bacteriocins, tryptophan and tryptophan metabolites, inosine, conjugated linoleic acid, and the like. Along with the continuous and intensive and increasing research on probiotics in recent years, the probiotics can exert the probiotics effects on aspects of intestinal health, immune development, nutrition metabolism, emotion management, liver diseases, oral diseases, gynecological diseases and skin health, and have wide application in the fields of common foods, health foods, new medicine research and development and the like. However, the effect of probiotics has strain specificity, namely different strain functions of the same strain have variability, and accurate strain identification is an essential precondition for use of probiotics.

In the current market, the probiotic industry has the phenomena of various types, non-uniform detection and quality control modes and misuse of concepts, so that the accurate identification of probiotic strains in products is particularly important. At present, the traditional separation culture method has the problem of low detection efficiency, the strain level cannot be identified from the appearance form, and the report on the specificity identification analysis of probiotics based on the strain level is still deficient. The identification of lactobacillus reuteri based on 16S rRNA is common in the prior art, and no other effective specific genes have been found to be useful for the detection of lactobacillus reuteri.

In addition, the lactobacillus reuteri strain A21041 has the characteristics of well tolerating the stimulation of artificial gastrointestinal fluid and intestinal bile salts and inhibiting the growth of pathogenic bacteria, can effectively relieve ulcerative colitis of mice, has the effects of scavenging free radicals and enhancing antioxidant enzyme systems (patent publication No. CN 115948292A), and has good market application prospect. The identification classification of 16S rRNA at the strain level was not obvious enough, i.e.it was not possible to distinguish between different Lactobacillus reuteri strains by the full length of 16S rRNA. However, there is currently no genetic background information about lactobacillus reuteri strain a21041 and specific genes for distinguishing strain a21041 from other strains of lactobacillus reuteri, and thus there is a lack of effective means for specifically detecting strain a 21041.

Disclosure of Invention

In view of the above, the invention aims to provide a lactobacillus reuteri strain A21041 specific detection primer which has the characteristics of strong specificity and high sensitivity.

The invention provides a specific nucleic acid molecule for detecting lactobacillus reuteri (Limosilactobacillus reuteri), which has the nucleotide sequence shown in SEQ ID NO:14, and a nucleotide sequence shown in seq id no.

The invention provides a primer for detecting lactobacillus reuteri based on the specific nucleic acid molecules, which comprises a forward primer with a nucleotide sequence shown as SEQ ID NO. 1 and a reverse primer with a nucleotide sequence shown as SEQ ID NO. 2.

The invention provides a detection kit for lactobacillus reuteri, which comprises the primer and other detection reagents.

The invention provides a specific nucleic acid molecule for detecting lactobacillus reuteri (Limosilactobacillus reuteri) strain A21041, which comprises the specific nucleic acid molecule of lactobacillus reuteri and the specific nucleic acid molecule of lactobacillus reuteri strain A21041;

the nucleotide sequence of the specific nucleic acid molecule of the lactobacillus reuteri strain A21041 is shown in SEQ ID NO: shown at 6.

The invention provides a primer for detecting lactobacillus reuteri (Limosilactobacillus reuteri) strain A21041 based on the specific nucleic acid molecule, which comprises the primer for detecting lactobacillus reuteri and a lactobacillus reuteri strain A21041 specific detection primer;

The lactobacillus reuteri strain A21041 specific detection primer comprises a forward primer with a nucleotide sequence shown as SEQ ID NO. 3 and a reverse primer with a nucleotide sequence shown as SEQ ID NO. 4.

The invention provides a lactobacillus reuteri (Limosilactobacillus reuteri) strain A21041 detection kit, which comprises the primer and other detection reagents;

preferably, the other detection reagents include DNA extraction reagents, standards, and one of the following amplification reaction solutions: a PCR amplification reaction premix and a fluorescent quantitative PCR reaction solution.

The invention provides a screening method for detecting specific nucleic acid molecules of lactobacillus reuteri strain A21041, which comprises the following steps:

Identifying lactobacillus reuteri-specific phage sequences from the whole genome of lactobacillus reuteri strain a21041 and other different lactobacillus reuteri strains;

classifying and annotating the specific phage sequences and constructing phylogenetic tree, and screening phage sequences for distinguishing different strains;

Performing functional annotation on the lactobacillus reuteri strain A21041 and other different lactobacillus reuteri strains, performing genome analysis and non-orthologous gene analysis on genome characteristic files and protein sequence files obtained by annotation respectively, and taking intersection of specific genes and non-orthologous genes of the genome analysis to obtain intersection genes;

Performing Blast alignment on the intersection gene and the phage sequences, the non-redundant protein sequence database and the nucleotide sequence database respectively, and selecting sequences which cannot be aligned to any species as lactobacillus reuteri strain A21041 specific nucleic acid molecules;

Assembling the genome of lactobacillus reuteri, performing a flood genome analysis on the assembled whole genome, identifying core genes, and checking the specificity of a target species using BLAST to determine candidate core genes for lactobacillus reuteri;

and comparing the candidate core genes with species in a non-redundant protein sequence database and a nucleotide sequence database, if the matching result contains non-lactobacillus reuteri, excluding the corresponding candidate core sequences, and if the matching result is all lactobacillus reuteri, classifying the candidate core genes as specific nucleic acid molecules for detecting the lactobacillus reuteri.

Preferably, the screening criteria for the different other lactobacillus reuteri strains include:

① Excluding strains with a Contigs number greater than 200;

② And carrying out Average Nucleotide Identity (ANI) analysis on the downloaded Lactobacillus reuteri strain and the whole genome of the strain A21041, and selecting the strain with the ANI value more than or equal to 97%.

Preferably, the intersection genes comprise genes shown as SEQ ID NO. 5-SEQ ID NO. 13.

Preferably, the function annotation is accomplished with Prokka;

the pan-genome analysis is completed by roary;

the non-orthologous gene analysis was done using orthfinder.

The invention provides a specific nucleic acid molecule for detecting lactobacillus reuteri, which has the nucleotide sequence shown in SEQ ID NO:14, and a nucleotide sequence shown in seq id no. The invention utilizes a bioinformatics analysis method to determine a unique gene sequence for specifically detecting lactobacillus reuteri. Based on the detection of the specific nucleic acid molecules, detection can be realized on various lactobacillus reuteri strains, and target conditions cannot be detected on other near bacteria, so that the specific nucleic acid molecules have higher detection specificity, and a new basis is provided for detecting lactobacillus reuteri at the species level.

The invention provides a specific nucleic acid molecule for detecting lactobacillus reuteri (Limosilactobacillus reuteri) strain A21041, which comprises the specific nucleic acid molecule and a nucleotide sequence shown in SEQ ID NO:6, and a specific nucleic acid molecule shown in FIG. 6. The invention firstly screens the specific nucleic acid molecules aiming at the strain A21041 from the level of the strain, comprising the specific gene sequence of the lactobacillus reuteri and the specific nucleic acid molecules which can be distinguished from the strain A21041 and other strains. Based on the specific nucleic acid molecules, the invention can realize the accurate differentiation of the strain A21041 and other strains of the lactobacillus reuteri on the strain level, and provides a detection basis for the subsequent wide application of the strain A21041.

The invention provides a specific detection primer based on the biomarker lactobacillus reuteri strain A21041, which comprises the primer and the specific detection primer of the lactobacillus reuteri strain A21041; the lactobacillus reuteri strain A21041 specific detection primer comprises a forward primer with a nucleotide sequence shown as SEQ ID NO. 3 and a reverse primer with a nucleotide sequence shown as SEQ ID NO. 4. The primer for detecting the strain in the specific detection primer is used for detecting that a detection object belongs to lactobacillus reuteri at the species level, and then the specific detection primer of the strain A21041 is used for detecting again to realize the heat specificity detection at the strain level. Experiments show that the primer has the characteristics of strong specificity and high sensitivity, and meanwhile, the experimental result also shows that the primer has good repeatability and stability, and an effective detection tool is provided for qualitative and/or quantitative detection and subsequent application of the lactobacillus reuteri strain A21041.

Drawings

FIG. 1 is a 16S rRNA phylogenetic tree of 327 Lactobacillus reuteri strains;

FIG. 2 is a phylogenetic tree of phage sequences of different Lactobacillus reuteri strains;

FIG. 3 is a graph showing the unique base factors for Lactobacillus reuteri A21041 determined for Orthfinder and Roary;

FIG. 4 shows the results of gel electrophoresis of lactobacillus reuteri specific primers, illustrating: 1: DNA MARKER, the bands from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp respectively; 2: lactobacillus reuteri a21041;3: pattern strain cic c6132;4: commercial strain DSM17938;5: lactobacillus reuteri GDMCC NO:62960;6: lactobacillus reuteri GDMCC NO:63041;7: fermenting lactobacillus mucilaginosus GDMCC No:62963;8: lactobacillus paracasei GDMCC No:63042;9: lactobacillus plantarum GDMCC No:62961;10: lactobacillus rhamnosus GDMCC No:62226; 11: a negative control;

FIG. 5 is a qPCR standard curve of strain A21041;

FIG. 6 shows the melting curve results of primer pair A21041 strain qPCR;

FIG. 7 is a sensitivity test result of primer pair A21041 strain qPCR, illustrating: the curves from left to right are the DNA concentration results of 2.2X10 ⁶、2.2×10⁵、2.2×10⁴、2.2×10³、2.2×10², 2.2X10, 2.2 copies/. Mu.L, respectively, 3 replicates per dilution.

Preservation of biological Material

Lactobacillus reuteri (Limosilactobacillusreuteri) strain A21041 was deposited with the microorganism strain collection of Guangdong province, the unit is GDMCC, the address is building 5 No. 59 of Dai 100 in Guangzhou city martyr, the deposit number is GDMCC No:62832, and the deposit date is 2022, 9 and 23.

Detailed Description

The invention provides a specific nucleic acid molecule for detecting lactobacillus reuteri, which has a nucleotide sequence shown as SEQ ID NO：14(CGCTTCAAACGAGACCATCTTGCCCAAGANTTGC ATGATAAGTTTGATCAATANGATAAAGAAGAATTAAACGAGATGGGCG CCAAAGTAATTATTGCGGGTCGAATGACAAGAAAGCG).

In the present invention, the screening method for detecting a specific nucleic acid molecule of lactobacillus reuteri preferably comprises the steps of:

Assembling the genome of lactobacillus reuteri, performing a flood genome analysis on the assembled whole genome, identifying core genes (genes present in all the assemblies), and determining the specificity of the target species as candidate core genes of lactobacillus reuteri using BLAST;

In the present invention, the genome of lactobacillus reuteri is preferably downloaded from a nucleic acid database. The method of pan genome analysis is preferably performed using Roary analysis. The non-redundant protein sequence databases and nucleotide sequence databases preferably include all species sequence sets in the NT and NR databases. The matching standard is preferably that the comparison E value is less than 1E-5, and the consistency (Identity) is more than or equal to 98 percent. The screening method screens out specific sequences which can be used for identifying the species level of the lactobacillus reuteri from the whole genome of the lactobacillus reuteri. Experiments show that the specific nucleic acid molecule can realize target detection on various lactobacillus reuteri strains (model strains CICC6132, commercial strains DSM17938, accession numbers GDMCC NO:62960, accession numbers GDMCC NO:63041 and the like), but can not realize detection on other closely-related species, and has good specificity.

The invention provides a primer for detecting lactobacillus reuteri based on the specific nucleic acid molecules, which comprises a forward primer with a nucleotide sequence shown as SEQ ID NO. 1 (CGCTTCAAACGAGACCATCT) and a reverse primer with a nucleotide sequence shown as SEQ ID NO. 2 (TCGACCCGCAATAATTACTTTGG).

In the invention, the primer is designed by SPECIESPRIMER (v 2.2) software, the software is used for automatic high-throughput screening of a species-specific target region, and candidate specific primers are designed by combining the sequences, so that target strains can be specifically identified at the species level. The design principle of the primer is preferably as follows: the melting Temperature (TM) range of the primer is set to 57-63 ℃, the optimal TM value is set to 60 ℃, the length range of the primer is set to 16-25bp, the length of the optimal primer is set to 20bp, and the GC content of the primer is set to 30-70%. Specificity of template primers, secondary structure of amplicon sequence, potential for primer dimer formation were assessed by In-Silico PCR. Specific primers were designed for lactobacillus reuteri using this software, and the amplified fragment of interest was 105bp in length.

In the present invention, the other detection reagent preferably includes a DNA extraction reagent, a standard, and one of the following amplification reaction solutions: a PCR amplification reaction premix and a fluorescent quantitative PCR reaction solution. Qualitative detection was achieved when lactobacillus reuteri was detected using the usual PCR amplification method. The quantitative detection is realized when the fluorescent quantitative PCR reaction liquid is used for detecting the lactobacillus reuteri.

In the embodiment of the invention, the whole genome of the strain A21041 is sequenced, and a whole genome sequencing result is obtained. Then constructing phylogenetic tree for different Lactobacillus reuteri strains based on 16S rRNA, and the result shows that the identification classification result for different Lactobacillus reuteri strains based on 16S rRNA is not obvious enough, namely, different Lactobacillus reuteri strains cannot be distinguished through the full length of 16S rRNA, so that it is important to find the unique genetic genes of the strains for distinguishing different strains.

The invention provides a specific nucleic acid molecule for detecting lactobacillus reuteri (Limosilactobacillus reuteri) strain A21041, which comprises the specific nucleic acid molecule for detecting lactobacillus reuteri and the specific nucleic acid molecule for detecting lactobacillus reuteri strain A21041;

The nucleotide sequence of the specific nucleic acid molecule of lactobacillus reuteri strain a21041 is shown as SEQ ID NO：6(ATGAGTAATGATATTTTTAATTTGAACACAAATTTTGA TGCCATTCAAAATAATGCTGAGATGATACGTAAAACAACAAAAGCAATGGAAAATGTTGGTAAATTAGATAGAGATTCAAAGAAAGCAAATATTGAAGCATTGGAGGTATTAAAAAGAATAGAAATGAATACTGCATACTTAAAAGATGTTGTTGATCTTCTTAATACAAACAATGACCATCAACAAGAATTAAATGAAATGGTTCAAGATATATTAAATATTGCTAAAGCTCCTGATAAGAAGGAAGCACAAACAAGATATCGAAGCGTAATGAAGAAAATAGGTGATTTTGGAACCGTTACTACCTCTACATTAAATATCCTTAAACTTTCTTCATTGGCTTCCACTGTTTTACAATTTTTTATGCAATCACATTAA).

In the present invention, a method for screening a specific nucleic acid molecule of lactobacillus reuteri strain a21041, comprising the steps of:

Blast alignment of the intersection gene with the phage sequence, non-redundant protein sequence database and nucleotide sequence database, respectively, and selecting sequences which cannot be aligned to any species as lactobacillus reuteri strain a 21041-specific nucleic acid molecules.

In the present application, the screening criteria for the different strains of lactobacillus reuteri preferably include: ① Excluding strains with a Contigs number greater than 200; ② And carrying out Average Nucleotide Identity (ANI) analysis on the downloaded Lactobacillus reuteri strain and the whole genome of the strain A21041, and selecting the strain with the ANI value more than or equal to 97%. In the embodiment of the application, 355 lactobacillus reuteri whole genome data are downloaded from NCBI data, and 44 lactobacillus reuteri strains are obtained through screening.

In the application, by utilizing the characteristic that phage has strict specificity to bacterial hosts, phage identification of different strains becomes an effective way for searching unique genetic information of the strains. The method for identifying the specific phage sequence of lactobacillus reuteri is preferably phage identification by using phispy (v 4.2.19) software. In the example of the present application, 23 strains out of 45 strains identified 35 phage region sequences. The method for classifying and annotating the phage sequences is completed by adopting MMseqs (v 14.7) software. The phylogenetic tree construction is preferably accomplished by FastTree. The results showed that 2 phage sequences with the ability to distinguish different strains were screened from the 35 phage region sequences, aa1.21041_phag1 and aa1.21041_phag2, respectively.

In the present application, the function annotation is preferably accomplished using Prokka. The pan-genomics is preferably accomplished using roary; the nonorthologous genetic analysis is preferably accomplished using orthfinder. The results of the examples show that using roary to find out the number of genes unique to Lactobacillus reuteri A21041 is 251, using orthfinder to find out 21 non-orthologous genes of Lactobacillus reuteri A21041, the intersection of the two methods results in the gene as the unique gene of Lactobacillus reuteri A21041 and the number of intersection is 9, and the intersection genes preferably comprise the genes shown as SEQ ID NO 5-SEQ ID NO 13.

In the invention, after Blast comparison, the gene group_9444 is not compared with any species sequence, and compared with phage sequences Aa1.21041_phag1, the gene group_9444 has higher sequence specificity. Through detection verification, the gene group_9444 can distinguish the strain A21041 from other strains, and the gene group_9444 (SEQ ID NO: 6) can be used as the strain A21041.

In the invention, the screened gene group_9444 is used as a template, and a Primer3 is used for designing a specific Primer, wherein the set parameters are as follows: the melting Temperature (TM) range of the primer is set to 57-63 ℃, the optimal TM value is set to 60 ℃, the length range of the primer is set to 16-25 bp, the length of the optimal primer is set to 20bp, and the GC content of the primer is set to 30% -70%.

The invention provides a specific detection primer based on the biomarker lactobacillus reuteri (Limosilactobacillus reuteri) strain A21041, which comprises the primer and the specific detection primer of the lactobacillus reuteri strain A21041; the lactobacillus reuteri strain A21041 specific detection primer comprises a forward primer with a nucleotide sequence shown as SEQ ID NO. 3 (GCTCCTGATAAGAAGGAAGCAC) and a reverse primer with a nucleotide sequence shown as SEQ ID NO. 4 (AACAGTGGAAGCCAATGAAGAA). The length of the amplified target fragment of the primer is 123bp.

The invention provides a lactobacillus reuteri (Limosilactobacillus reuteri) strain A21041 detection kit, which comprises the primer and other detection reagents.

In the present invention, the other detection reagent preferably includes a DNA extraction reagent, a standard, and one of the following amplification reaction solutions: a PCR amplification reaction premix and a fluorescent quantitative PCR reaction solution. Qualitative detection was achieved when lactobacillus reuteri was detected using the usual PCR amplification method. The quantitative detection is realized when the fluorescent quantitative PCR reaction liquid is used for detecting the lactobacillus reuteri. The source of the other detection reagent is not particularly limited in the present invention, and detection reagents well known in the art may be used. The standard preferably comprises the specific nucleic acid molecule for detecting lactobacillus reuteri and the specific nucleic acid molecule of lactobacillus reuteri strain a 21041.

In the examples of the present invention, the primer was only able to amplify strain a21041, whereas it was not able to successfully amplify other lactobacillus reuteri strains. In the sensitivity test, the minimum detection amount of the fluorescent quantitative PCR was 2.2 copies/. Mu.L. In the repeatability and stability evaluation experiments, the results of combining 2 batches show that the variation coefficient of the Ct value in the batches is 0.07-1.58%, and the variation coefficient of the Ct value among the batches is 0.22-1.93%. Therefore, the fluorescence quantitative PCR detection method of the A21041 strain established by the specific primer provided by the invention has good repeatability and stability.

The specific detection primers, kits, applications and screening methods for lactobacillus reuteri strain a21041 provided by the present invention are described in detail below with reference to the examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Screening method of lactobacillus reuteri strain A21041 specific detection primers

1. Whole genome sequencing and assembly analysis of lactobacillus reuteri A21041

1) Bacterial liquid DNA extraction

Collecting fresh bacterial suspension, centrifuging at 8000r/min, collecting not less than 1g of thalli in a 1.5mL centrifuge tube, extracting DNA by using a kit method (bacterial nucleic acid extraction kit batch number: cracker A0418 KJ), and finally dissolving the DNA by using deionized water, and preserving at-20 ℃ for standby.

2) Whole genome sequencing

Full genome sequencing was performed using Nanopore PromethION third generation sequencing in combination with Illuminanovaseq6000 second generation sequencing platform. Three generations of sequencing a library was constructed using g-TUBE(10)×10(covarisUSA)、Native Barcoding Expansion 1-12(Nanopore,UK)、Native Barcoding Expansion13-24(NanoporeUK) and sequenced using PromethION Flow Cell (FL-PRO 002) chips. Second generation sequencing the library was constructed using VAHTSTM Universal DNA Library Pren Kit (VazymeChina) and sequenced using the NovaSeq 6000S4 Reagent Kit (illuminaUSA) kit.

3) Data processing

The original third generation down machine data is converted into fastq format by Guppy (v 3.2.6), and the joint and low quality reads are filtered to obtain the total dataset. The filtered reads were corrected, clipped and assembled using Canu (v 2.2) (main parameters: maximum expected number of difference bases between corrected reads correctedErrorRate =0.1; sequences MINREADLENGTH =2000 using a threshold greater than 2000 bp; length of minimum overlap OverlapLength =500). And then, carrying out correction on the assembly result by Racon (v 3.4.3) by using third-generation data, and further carrying out error correction by using second-generation data by using Pilon (v 1.22), thereby obtaining the genome with higher accuracy. The assembly results were evaluated using Quast (v5.0.2) and the results are shown in Table 1.

TABLE 1 Lactobacillus reuteri A21041 Assembly results

2. Accuracy verification of identification of different lactobacillus reuteri based on 16S rRNA

The Lactobacillus reuteri gene sequence 355 strain reported in the literature and completed whole genome sequencing was downloaded from the U.S. Biotechnology information center (National Center for Biotechnology Information, NCBI) database (https:// www.ncbi.nlm.nih.gov/datasets/genome /). rRNA gene prediction is carried out on 355-strain lactobacillus reuteri whole genome by using rnammer (v 1.2), 16S rRNA obtained by prediction is used as a marker, a phylogenetic tree of lactobacillus reuteri is constructed (wherein 327-strain whole genome can be annotated to the 16S rRNA, multiple sequence alignment is carried out by using different lactobacillus reuteri strain 16S rRNA gene sequences through software MAFFT (v 7.271), a comparison result is trimmed by using trimAI (v 1.4), false sequence or non-aligned region can be automatically removed from the multiple sequence alignment, and finally the phylogenetic tree of the 16S rRNA is constructed by using FastTree (v 2.1.11). As can be seen from fig. 1, the identification and classification results of different lactobacillus reuteri strains based on 16S rRNA are not obvious enough, i.e. the different lactobacillus reuteri strains cannot be distinguished through the full length of 16S rRNA, so it is important to find the unique genetic genes of the strains for distinguishing the different strains.

3. Screening of Lactobacillus reuteri complete Gene

In order to find out the unique genetic genes of the lactobacillus reuteri A21041, 44 strains of whole genome sequences are screened out from the whole genome of 355 strains of lactobacillus reuteri and are compared with the A21041 for analysis. The screening criteria were: ① Excluding strains with a Contigs number greater than 200; ② The average nucleotide identity analysis (ANI, average nucleotide identity) was performed on downloaded lactobacillus reuteri with a21041 whole genome using fastANI (v 1.33), which was mainly used to assess the relatedness between species at the whole genome level, typically with 95% ANI as species division. The strain closely related to lactobacillus reuteri a21041 (ANI: 97%) was selected for subsequent analysis based on the ANI value, and 44 lactobacillus reuteri strains (bolded-font strain in fig. 1, 5 strains were not labeled because they were not annotated to 16S rRNA) were screened out in total, and the whole genome sequence information and the ANI value with the a21041 strain were as shown in table 2.

TABLE 2 Whole genome information and A21041 ANI values for 44 Lactobacillus reuteri strains

4. Phage recognizing whole genome of lactobacillus reuteri

Because of the stringent specificity of bacteriophages for bacterial hosts, the identification of phages from different strains is an efficient way to find unique genetic information for the strains. Phage identification was performed on the whole genome of lactobacillus reuteri obtained by screening by phispy (v 4.2.19), 35 phage region sequences were identified for 23 strains of lactobacillus reuteri among 45 strains, the identified phage sequences were subjected to classification annotation (see table 3) by using MMseqs (v 14.7), phylogenetic tree construction was performed on the phage sequences by FastTree, and 2 phage sequences with the ability to distinguish different strains were obtained by screening. As shown in fig. 2, according to this constructed circular evolution tree, 2 phage sequences in a21041 (aa1.21041_phag1 and aa1.21041_phag2) can be separated into different clades.

TABLE 3 phage sequence classification annotation results

/>

5. Genetic analysis specific to Lactobacillus reuteri A21041

To further determine the unique genetic information of a21041, 44 strains of lactobacillus reuteri and lactobacillus reuteri a21041 obtained by screening were functionally annotated with Prokka (v1.14.5), and genome profile (gff) and protein sequence file (faa) obtained by annotation were subjected to pan-genome analysis and non-orthologous gene analysis using roary (v3.13.0) and orthfinder (v2.5.4), respectively. The number of unique genes of Lactobacillus reuteri A21041 is 251 by roary, 21 non-orthologous genes of Lactobacillus reuteri A21041 are orthfinder, and the intersection of the genes obtained by the two methods is 9 (figure 3) as the unique genes of Lactobacillus reuteri A21041, and the detailed information of the genes is shown in the sequence SEQ ID NO:5-SEQ ID NO:13.

The specific gene sequence of lactobacillus reuteri a21041 obtained above was subjected to BLAST search of the whole library with phage sequences, non-redundant protein sequence databases of NCBI and nucleotide sequence databases (NR/NT libraries), and the specificity of the gene sequence was further verified. As shown in Table 4, the gene group_9444 from phage sequences in the NR/NT database was not aligned to any species sequences, indicating that it has higher sequence specificity.

TABLE 4 Blast alignment of A21041 9 unique genes

/>

Remarks: and selecting a result with the highest homology percentage from Blast comparison results, and displaying the result.

6. Lactobacillus reuteri specific primer design

In order to fully verify the recognition capability of the unique sequence to the strain A21041 in the subsequent experiments, a specific primer of the strain A21041 and a specific primer of the strain A21041 are respectively designed, and can respectively recognize all the strain A21041 and uniquely recognize the strain A21041, and the steps are as follows:

(1) Universal primer design for lactobacillus reuteri species

Specific primer design was performed on lactobacillus reuteri by SPECIESPRIMER (v 2.2) software. The software is used for automatic high-throughput screening of species-specific target regions, and design candidate specific primers combining the sequences can specifically identify target strains at the species level. Briefly, the method comprises the following steps: ① Assembling by NCBI downloading the genome of the species; ② Performing flood genome analysis on the assembled whole genome by Roary, determining a core gene of a target species, comparing sequences of other list species with the core gene, and eliminating corresponding sequences if matching hits, otherwise classifying the sequences as core sequences for subsequent primer design; ③ Primer3 was used for Primer design of the core gene sequence. The set parameters are as follows: the melting Temperature (TM) range of the primer is set to 57-63 ℃, the optimal TM value is set to 60 ℃, the length range of the primer is set to 16-25 bp, the length of the optimal primer is set to 20bp, and the GC content of the primer is set to 30-70%. Specificity of template primers, secondary structure of amplicon sequence, potential for primer dimer formation were assessed by In-Silico PCR. The pipeline is used for designing a specific primer for lactobacillus reuteri, the length of a target fragment amplified by the primer is 105bp, and the detailed sequence is shown in SEQ ID NO. 1-SEQ ID NO. 2.

(2) Lactobacillus reuteri A21041 specific primer design

The parameters set by using the unique gene fragment group_9444 of lactobacillus reuteri a21041 as a template and using Primer3 to design a specific Primer are as follows: the melting Temperature (TM) range of the primer is set to 57-63 ℃, the optimal TM value is set to 60 ℃, the length range of the primer is set to 16-25bp, the length of the optimal primer is set to 20bp, and the GC content of the primer is set to 30-70%. Specific primers for lactobacillus reuteri strain a21041 were designed by the above parameters, and the information of the primers is shown in table 5 and SEQ ID NO:3-SEQ ID NO:4.

TABLE 5 Lactobacillus reuteri A21041 specific primer information

7. Specificity verification of Lactobacillus reuteri A21041 primer

The specificity of lactobacillus reuteri strain and strain a21041 was detected by PCR amplification using the DNA of 4 lactobacillus reuteri, 4 non-lactobacillus reuteri and lactobacillus reuteri a21041 stored in the laboratory as amplification templates while setting negative controls. The deposit numbers of the 4 Lactobacillus reuteri are model strain CICC6132, commercial strain DSM17938, GDMCCNO, respectively: 62960 and GDMCC NO:63041; the deposit numbers of the 4 strains of non-lactobacillus reuteri are fermented lactobacillus mucilaginosus GDMCC No:62963, lactobacillus paracasei GDMCC No:63042, lactobacillus plantarum GDMCC No:62961 and lactobacillus rhamnosus GDMCC No:62226 respectively. The method mainly comprises the following steps:

(1) Preparation of bacterial liquid

The purified single colony of the above 5 strains of lactobacillus reuteri is selected and prepared into bacterial suspension in sterile water as a PCR template for colony PCR amplification.

(2) PCR amplification

The bacterial suspension prepared above was subjected to PCR amplification using Lactobacillus reuteri strain primers (SEQ ID NO:1-SEQ ID NO: 2) and strain A2104116 primer (SEQ ID NO:3-SEQ ID NO: 4), which were synthesized by Beijing qing department of Biotechnology Co., ltd. The PCR reaction system is as follows: 2X SAN TAQPCR Mix 12.5. Mu.l, template 1. Mu.l, upstream and downstream primers 1. Mu.l each, make up ddH ₂ O to 25. Mu.l. The reaction procedure is: pre-denaturation at 94℃for 5min, denaturation at 94℃for 30s, annealing at 55℃for 30s, extension at 72℃for 1min, 30 cycles were performed in total, and extension at 72℃for 10min.

(3) Gel electrophoresis detection result of PCR product

The PCR products were analyzed by electrophoresis in 1 XTAE buffer on a 1.0% agarose gel containing GelRed stain at 120V and 300mA current for about 30min. And after electrophoresis, analyzing by using a gel imaging system, and judging the specificity of the set primer by using an electrophoresis strip.

According to the result of the gel electrophoresis detection, a distinct band appears at 105bp using the strain primer (SEQ ID No. 1-2) for 5 strains of Lactobacillus reuteri, whereas 4 strains of Lactobacillus non-reuteri (Lactobacillus fermentum GDMCC No:62963, lactobacillus paracasei GDMCC No:63042, lactobacillus plantarum GDMCC No:62961, and Lactobacillus rhamnosus GDMCC No:62226) do not have a specific band using the strain primer (SEQ ID No. 1-2), indicating that the strain-specific primer (SEQ ID NO:1-SEQ ID NO: 2) can specifically identify 5 strains of Lactobacillus reuteri; the obvious band appears at 123bp by using the g9444 primer (SEQ ID NO:3-SEQ ID NO: 4) for lactobacillus reuteri A21041, other 4 strains of lactobacillus reuteri and 4 strains of lactobacillus reuteri (fermented lactobacillus reuteri GDMCC No:62963, lactobacillus paracasei GDMCC No:63042, lactobacillus plantarum GDMCC No:62961 and lactobacillus rhamnosus GDMCC No:62226) have NO obvious band, which shows that the g9444 primer can specifically distinguish lactobacillus reuteri A21041 from other lactobacillus reuteri strains and lactobacillus reuteri (figure 4), and the primer specificity is good and can be used for qualitative detection of lactobacillus reuteri A21041 in foods or medicines.

8. Sensitivity test of Lactobacillus reuteri A21041 primer

In order to further verify the specificity and sensitivity of the primer (SEQ ID NO:3-SEQ ID NO 4) to lactobacillus reuteri A21041, a method for real-time fluorescent quantitative polymerase chain reaction (qPCR) quantitative detection of the specific gene of lactobacillus reuteri A21041 is established, and biological targets in a sample can be detected and quantified. The method comprises the following steps:

(1) DNA extraction

After 1mL of the overnight-cultured A21041 strain was centrifuged at 8000rpm for 2min, the supernatant was discarded. The DNA extraction of A21041 was performed according to the bacterial DNA extraction kit (Tiangen Biochemical technologies Co., ltd.). The concentration was tested with Nanodrop.

(2) Optimization of fluorescent quantitative PCR reaction conditions

A21041 was tested for relative quantification using beta-actin as an internal reference, using SYBR (Beijing full gold Biotechnology Co., ltd.). The quantitative DNA concentration obtained was diluted 10-fold with deionized water in the concentration range of (5.24X10 ^-10ng/μL～5.24×10^-10 ng/. Mu.L) and converted to copy number (2.2X10 ⁶～2.2×10^-5 copies/. Mu.L) as shown in formula I:

Remarks: m: the mass g of DNA; l: the length of the DNA fragment is bp; m: average molar mass g/mol of 1bp base; n _A: avogalde Luo Changliang 6.02.02x10 ²³.

By comparing the primer concentration, the probe concentration and the annealing temperature experimental results in the reaction system, a reaction system with high reaction sensitivity, low background fluorescence signal, typical S-shaped amplification fluorescence signal curve and amplification efficiency close to 1 is selected. The reaction system obtained by optimization is as follows: F/R primers (10. Mu.M) each 0.5. Mu.L,GREEN QPCR Supermix 5. Mu.L, unicersal PASSIVE REFERENCE DYE (50X) 0.2. Mu.L, DNA template 1. Mu.L, ddH ₂ O make up 10. Mu.L. The running program is as follows: 94℃30s,40 cycles: 94℃for 5s,60℃for 15s and 72℃for 10s. Finally, the minimum detection limit of the target DNA was evaluated by qPCR CT value (Cycle Threshold), and the reproducibility and stability of the fluorescent quantitative PCR were evaluated by using the coefficient of variation (Coefficient of Variation, CV) of CT value.

(3) Fluorescent quantitative PCR detection result

1) Establishment of fluorescent quantitative PCR standard curve and specificity and sensitivity evaluation

The quantitative DNA obtained was diluted 10-fold with deionized water at a concentration of 2.2X10 ⁶～2.2×10^- ⁵ copies/. Mu.L, and three replicates were made for each dilution, and the sensitivity test was performed and a standard curve was drawn using the optimized system and reaction conditions. The results show that the fluorescence quantitative PCR shows good linear relationship in the dilution range of 2.2X10 ⁶ -2.2 copies/. Mu.L, and the correlation coefficient (R ²) of the standard curve is 0.99 (see the standard curve of FIG. 5), which shows that the detection method has good linear relationship. As can be seen from the melting curve results, qPCR single melting curve further verifies the specificity of the primer pair, and the occurrence of the phenomenon that the primer pair has no mismatch, primer dimer and the like and affects the amplification result (FIG. 6). As can be seen from the amplification curve, the lowest detection amount of the fluorescent quantitative PCR was 2.2 copies/. Mu.L, and the corresponding CT value was 36.1 (average of 3 replicates), indicating that the primer had good sensitivity (FIG. 7).

2) QPCR method repeatability and stability evaluation

Since the setting of the fluorescence signal threshold of qPCR may vary from experimental batch to experimental batch, the CT value is ultimately affected. Therefore, to verify the stability of primer qPCR, we performed another batch qPCR assay using 6 dilutions (2.2X10 ⁶、2.2×10⁵、2.2×10⁴、2.2×10³、2.2×10², 22 and 2.2 copies/. Mu.L) of DNA as templates for batch-to-batch reproducibility test, each dilution was repeated 2 times, and the results combined with 2 batches showed that the variation coefficient of Ct value in the batch was 0.07% -1.58% and that of Ct value in the batch was 0.22% -1.93% (see Table 6), which indicated that the fluorescence quantitative PCR assay of strain A21041 established based on the specific primer had good reproducibility and stability.

TABLE 6 results of reproducibility and stability evaluation of qPCR within and between lots

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims

1. A specific nucleic acid molecule for detecting lactobacillus reuteri (Limosilactobacillus reuteri), characterized by having the sequence set forth in SEQ ID NO:14, and a nucleotide sequence shown in seq id no.

2. A primer for detecting lactobacillus reuteri is characterized by comprising a forward primer with a nucleotide sequence shown as SEQ ID NO.1 and a reverse primer with a nucleotide sequence shown as SEQ ID NO. 2.

3. A kit for detecting lactobacillus reuteri comprising the primer of claim 1 and an additional detection reagent.

4. A specific nucleic acid molecule for detecting lactobacillus reuteri (Limosilactobacillus reuteri) strain a21041, comprising the specific nucleic acid molecule of lactobacillus reuteri of claim 1 and the specific nucleic acid molecule of lactobacillus reuteri strain a 21041;

5. A primer for detecting lactobacillus reuteri (Limosilactobacillus reuteri) strain a21041, comprising the primer for detecting lactobacillus reuteri of claim 2 and a primer for detecting lactobacillus reuteri strain a21041 specifically;

6. A lactobacillus reuteri (Limosilactobacillus reuteri) strain a21041 assay kit comprising the primer of claim 5 and an additional detection reagent;

7. A screening method for detecting a specific nucleic acid molecule of lactobacillus reuteri strain a21041 according to claim 4, comprising the steps of:

8. The screening method according to claim 7, wherein the screening criteria for the different other lactobacillus reuteri strains comprise:

① Excluding strains with a Contigs number greater than 200;

② And carrying out average nucleotide consistency analysis on the downloaded lactobacillus reuteri strain and the whole genome of the strain A21041, and selecting the strain with the ANI value of more than or equal to 97 percent.

9. The screening method according to claim 7, wherein the intersection genes include genes shown in SEQ ID NO. 5 to SEQ ID NO. 13.

10. The screening method of claim 7, wherein the functional annotation is accomplished using Prokka;

the pan-genome analysis is completed by roary;

the non-orthologous gene analysis was done using orthfinder.