CN117965623A

CN117965623A - Method for improving animal antibacterial and toxin based on KLRB1 gene

Info

Publication number: CN117965623A
Application number: CN202410007576.4A
Authority: CN
Inventors: 曹三杰; 袁建林; 赵勤; 黄小波; 杜森焱; 王一平; 文翼平; 颜其贵; 伍锐; 郎一飞
Original assignee: Sichuan Agricultural University
Current assignee: Sichuan Agricultural University
Priority date: 2024-01-03
Filing date: 2024-01-03
Publication date: 2024-05-03

Abstract

The invention discloses a method for improving animal antibacterial and toxin based on KLRB1 gene, belonging to the technical field of genetic engineering; the invention proves for the first time that the KLRB1 protein is related to the deadly effect of the porcine pasteurella multocida and the recombinant porcine pasteurella multocida toxin on animals, and the animals with the KLRB1 protein deleted or the genes encoding the KLRB1 protein can resist the deadly effect of the porcine pasteurella multocida and the recombinant porcine pasteurella multocida toxin. Therefore, the anti-KLRB 1 protein antibody or the KLRB1 gene knockout vector or the KLRB1 gene silencing vector can block the lethal effect of the porcine pasteurella multocida and/or the porcine pasteurella multocida toxin on animals and accelerate the disease-resistant breeding process of the animals.

Description

Method for improving animal antibacterial and toxin based on KLRB1 gene

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a method for improving animal anti-swine pasteurella multocida and toxins thereof based on KLRB1 genes.

Background

Pasteurella multocida (Pasteurella multocida, pm) is a gram-negative facultative anaerobic coccus, which can be divided into A, B, D, E, F five serogroups depending on the capsular antigen. The porcine Pasteurella multocida forms A and D produce a Pasteurella multocida skin necrosis toxin (pasteurella multocida toxin, PMT) which is a thermolabile protein of approximately 146kDa encoded by the toxA gene. The toxin is the main virulence factor of atrophic rhinitis of pigs, LD ₅₀ for mice is 0.2 μg/kg, LD ₁₀₀ for pigs is 40 μg/kg. Pasteurella multocida belongs to conditional pathogenic bacteria, and the disease is generally not caused to be exploded greatly when antibiotics are widely used in pig farms, but drug-resistant strains are generated along with abuse of the antibiotics.

The CD161 protein coded by the KLRB1 gene is a potential inhibitory receptor, and the CRISPR/Cas9 gene editing technology is used for inactivating the KLRB1 gene in the T cells, so that the killing effect of the T cells on tumor cells can be enhanced. At present, the KLRB1 gene and the protein coded by the same are not reported in animal disease-resistant breeding, and the field of optimizing the disease-resistant breeding aiming at host genes is still blank.

Disclosure of Invention

The technical problems to be solved by the invention are as follows: a method for increasing the resistance of an animal to pasteurella multocida is provided.

The technical scheme of the invention is as follows:

Use of an anti-KLRB 1 protein antibody or KLRB1 gene knockout vector or KLRB1 gene silencing vector in the preparation of a product for increasing the resistance of an animal to a pasteurella multocida and/or a pasteurella multocida toxin.

Further, the amino acid sequence of the KLRB1 protein is shown as SEQ ID No. 1.

Further, the anti-KLRB 1 protein antibody is a rabbit anti-KLRB 1 protein antibody.

Further, the CDS sequence of the KLRB1 gene is shown as SEQ ID No. 2.

Further, the animal is a pig or a mouse.

A method of constructing an animal model against pasteurella multocida and/or pasteurella multocida toxins comprising deleting a gene encoding a KLRB1 protein from an animal. The method of the invention has no strict requirement on the way of deleting the gene encoding the KLRB1 protein of the animal, and the method can be carried out by adopting conventional technical means, such as gene editing knockout or RNAi silencing of the KLRB1 gene of the animal.

Further, the animal model is a pig or mouse model.

Compared with the prior art, the invention has the following beneficial effects:

The invention proves for the first time that the KLRB1 protein is related to the deadly effect of the porcine pasteurella multocida and the recombinant porcine pasteurella multocida toxin on animals, and the animals with the KLRB1 protein deleted or the genes encoding the KLRB1 protein can resist the deadly effect of the porcine pasteurella multocida and the recombinant porcine pasteurella multocida toxin. Thus, an anti-KLRB 1 protein antibody or KLRB1 gene knockout vector or KLRB1 gene silencing vector is capable of blocking the lethal effect of pasteurella multocida and/or pasteurella multocida toxin on animals. By developing KLRB1 gene knockout animals, the disease resistance of animals against Pasteurella multocida can be improved.

Drawings

FIG. 1 is a histogram of rabbit anti-porcine KLRB1 antibody 4 titers exempt;

FIG. 2 shows the protective cell viability of rabbit anti-porcine KLRB1 antibodies (PK 15 cell line);

FIG. 3 shows KLRB1 ^-/- cell viability (PK 15 cell line);

FIG. 4 is the survival rate of mice injected with rabbit anti-porcine KLRB1 antibody;

FIG. 5 shows survival of rPMT low-dose challenged mice;

FIG. 6 shows survival of mice challenged with doses of rPMT;

FIG. 7 shows survival of rPMT high dose challenged mice;

FIG. 8 is a graph showing survival of recombinant Pasteurella multocida toxin challenged mice.

Detailed Description

The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, were purchased from commercial sources.

In the present invention, the KLRB1 protein comprises porcine KLRB1 protein; the amino acid sequence of the porcine KLRB1 protein is as follows:

MERQVIYADLNLSRDSGLESSSAPQNVCQGPPWHKFALKLGCAGITLLSLAVIWLSISVIFLRQKLSIEETSMDVPESRNETTERPALLKCPTNWHPFQDKCLFFYNSYKHWNESLADCSTKESSLLLIQDNEELRLIQNLIDSGGIIFWIGLNFSLPEENWKWINGSFLSSEILPITGVAGENNCVSISKTQMLSEPCDSENKWICQKNLKPVRNIVKK(SEQ ID No.1 Shown).

In the present invention, the nucleotide sequence encoding the porcine KLRB1 protein is preferably:

ATGGAAAGACAGGTGATATATGCGGATTTAAACTTATCCAGGGATTCCGGCCTTGAAAGCTCATCAGCTCCTCAGAATGTTTGTCAGGGTCCACCTTGGCATAAATTTGCTCTGAAACTTGGTTGTGCTGGGATTACTCTTCTTTCCTTGGCTGTGATTTGGTTGAGTATTTCAGTGATATTCTTACGACAAAAATTGTCAATAGAAGAAACCAGCATGGATGTTCCAGAGAGCAGGAACGAAACCACAGAAAGACCAGCTCTGCTAAAGTGCCCAACAAATTGGCACCCATTCCAAGATAAATGCTTGTTTTTTTATAACTCTTATAAACACTGGAATGAAAGTCTAGCTGACTGTTCCACAAAAGAATCCAGTCTGCTGCTTATTCAAGATAATGAAGAATTGAGACTCATACAAAATCTGATAGATAGTGGAGGAATTATATTTTGGATTGGACTAAATTTTTCCTTACCAGAGGAGAACTGGAAGTGGATAAATGGCTCCTTTTTAAGTTCTGAGATATTACCTATTACTGGTGTTGCTGGGGAAAACAACTGTGTCTCCATCTCAAAGACACAAATGCTTTCTGAGCCCTGTGATTCAGAAAATAAATGGATCTGCCAAAAAAACCTAAAACCTGTCAGAAATATAGTAAAGAAATAA(SEQ ID No.2 Shown).

Example 1

Preparation of porcine KLRB1 protein

Materials and reagents

1. Plasmids, strains and cell lines

PGEX-4T-1 plasmid (deposited by Sichuan university of agriculture pig disease research center)

Coli DH5 alpha (from Optimum Trionychomycosis Co., ltd.)

Coli BL21 (from Optimus Prinsepia) Ke Bio-technology Co Ltd

Pig kidney epithelial cells (PK 15, purchased from american ATCC deposit).

2. Reagent(s)

DMEM is available from Gibco company; RNA extraction kit was purchased from Axygen; reverse transcriptase was purchased from Transgen company; ampicillin and 2xTaq PCR Master mix were purchased from Tiangen Biochemical Co., ltd; cyclic-Pure Kit (cat# D6492-01), PLASMID MINI KIT I (cat# D6943-01) were all purchased from OMEGA corporation; DL2000 MAKER, restriction endonucleases BamHI, ecoRI, 2X PRIMESTAR MAX PREMIX (cat# R045A) were purchased from Dalianbao bioengineering Co., ltd; 2xSeamless Cloning Mix from Beijing Bomaide Gene technologies Co., ltd; LB broth, LB nutrient agar was purchased from Qingdao sea Bo Biotech; IPTG was purchased from beijing solebao technologies limited; GST-Sepinose (TM) Kit (cat# C600327-0001) and TureColor trichromatic pre-dye protein Marker (160 kDa) were purchased from Shanghai Biotechnology Co., ltd; SDS-PAGE gel preparation kit was purchased from Chengdu Bai and technology Co., ltd; sodium chloride, sodium hydroxide, coomassie brilliant blue R250 and other reagents were purchased from the chemical engineering company, megalan, guangzhou; ultrafiltration centrifuge tubes were purchased from Millipore corporation; BCA protein concentration determination kit, western-Blotting primary antibody diluent, was purchased from Biyundian corporation; goat anti-rabbit IgG/HRP was purchased from bosch company;

PBS buffer: 8g of NaCl, 0.2g of KCl and 1.42g of Na ₂HPO₄、0.27g KH₂PO₄ are weighed, fully dissolved, pH is regulated to 7.4, the volume is fixed to 1L by sterile deionized water, filtration is carried out by a filter membrane with the size of 0.22 mu m, and the mixture is sterilized, packaged and stored at the temperature of 4 ℃.

0.25% Pancreatin: weighing 0.2g of EDTA, 0.58g of NaHCO ₃ and 8g of NaCl, fixing the volume to 100ml, sterilizing and cooling to room temperature, adding 1.0g of glucose, 0.25g of pancreatin powder, fully dissolving, filtering with a 0.22 mu m filter membrane, and sub-packaging for preservation at-20 ℃.

SDS-PAGE running buffer: and weighing Tris-Base 3.02g,Glycine 18.8g,SDS1g, fixing the volume to 1L, and preserving at room temperature.

Transfer buffer: weighing 2.9g glycine, 5.9g Tris,0.37g SDS g glycine, adding water to a volume of 800ml glycine, fully dissolving glycine, adding 200ml methanol and preserving at room temperature.

TBST: 20ml of 1M Tris-HCl (pH 8.0), 8.8g of NaCl, 800ml of deionized water are added for dissolution, 0.5ml of Tween 20 is added for complete mixing, and after the volume is fixed to 1L, the mixture is preserved at 4 ℃.

Construction of recombinant plasmid pGEX-4T-1-KLRB1

Extraction and cleavage of pGEX-4T-1 plasmid

The purchased pGEX-4T-1 strain was streaked with an inoculating loop and inoculated on LA medium containing 100. Mu.g/mL ampicillin resistance, cultured overnight for 12 hours, single colony was picked the next day and cultured overnight for expansion, the plasmid was extracted by Omega PLASMID MINI KIT I (cat# D6943-01), and the procedure was performed according to the instructions of the kit for a small amount of the plasmid.

The concentration of the extracted pGEX-4T-1 plasmid was measured, and double digestion was performed at 37℃in a ratio of plasmid to restriction enzyme of 1000:1, with BamHI and EcoRI sites. The cleaved product was purified using the procedure of Omega Cycle Pure Kit (cat# D6492-01).

2. Preparation of porcine KLRB1 Gene-linked fragments

2.1 CDNA acquisition of PK15 cell line

And (3) digesting and centrifuging the grown PK15 cells to obtain cell precipitates, extracting RNA according to instructions by using an Axygen RNA extraction kit, and carrying out reverse transcription on the obtained RNA according to Transgen reverse transcription kit instructions to obtain pig-derived cDNA for later use.

2.2 Design of amplification primer of pig KLRB1 coding gene

According to the pig KLRB1 coding gene sequence shown in SEQ ID No.2, a primer Design software CE Design is used for designing a primer for amplifying the pig KLRB1 coding gene, and the primer is synthesized by Shanghai Biotechnology Co. The primer sequences are shown in Table 1.

TABLE 1 primers for amplifying genes encoding porcine KLRB1

2.3 Amplification of the porcine KLRB1 coding Gene

The PK15 cell line cDNA obtained in 2.1 was used as a PCR template. PCR amplification was performed using the primers shown in Table 1. The PCR reaction system is shown in Table 2:

TABLE 2 PCR amplification System

2.4 Purification of amplified products

After successful identification by agarose gel electrophoresis, the PCR product is purified by the enzyme digestion product purification method and the concentration is measured for standby.

3. Construction of recombinant plasmids

3.1 Ligation of Linear vector plasmid with fragment of interest

The linear pGEX-4T-1 vector and the KLRB1 amplified fragment are recombined by Bomeide company 2xSeamless Cloning Mix, and the system is suggested according to the specification: the molar ratio of the carrier to the fragments is 1:1-1:3. The homologous recombination system is shown in Table 3:

TABLE 3 homologous recombination System

3.2 Conversion of ligation products

Transferring the connection product of the previous step into DH5 alpha competent 100 mu L on ice, and carrying out ice bath for 30min; then heat-shocking at 42 ℃ for 90s, and putting back on ice for 2min; then 600 mu L of non-resistant LB is added, and the mixture is revived by a shaking table at 180r/min at 37 ℃ for 1h; centrifuging at 4000r for 3min; 600. Mu.L of the supernatant LB was discarded, and the remaining LB mixed precipitate was spread evenly on a LA solid medium plate containing 100. Mu.g/ml of ampicillin using an aluminum cap, and cultured for 12 hours.

3.3 Identification and extraction of recombinant plasmids

The next day single colony PCR was picked for identification, and the PCR identification primers and identification system are shown in tables 4 and 5:

table 4 PCR identification primers

Table 5 PCR identification of primer systems

4. Construction of recombinant expression strains

The pGEX-4T-1-KLRB1 plasmid sequenced successfully was transformed into BL21 competence and plated, for specific steps reference 3.2.

Expression and purification of porcine KLRB1 protein

1. Supernatant expression of porcine KLRB1 protein

Picking a colony containing the recombinant plasmid from a flat plate, culturing for 12 hours, expanding the colony to 300mL of LB liquid culture medium containing 100 mu g/mL of ampicillin resistance, adding IPTG with the final concentration of 1mmol/L into the bacterial liquid culture medium when the OD ₆₀₀ value reaches 0.6-0.8, and inducing for 24 hours at the temperature of 16 ℃ and at 180 r; taking induced bacterial liquid, centrifugally washing the bacterial liquid for 3 times by using PBS, then re-suspending the bacterial liquid in 30ml of PBS, placing the PBS into an ultrasonic crusher to crush bacterial bodies, selecting 15% of power, crushing for 5-6 times, and carrying out 5min (3 s of ultrasonic treatment and 2s of rest) each time, wherein ice bath is needed during crushing. The crushed suspension was centrifuged at 12000g for 30min in a centrifuge at4℃and the supernatant was collected for protein purification.

2. Purification of host protein KLRB1

The supernatant was filtered with a 0.22 μm filter for use and protein purification was performed according to the instructions of GST-Sepinose (TM) Kit (cat# C600327-0001).

The eluted proteins were analyzed by SDS-PAGE, and the concentration was determined and stored at-80℃with 10% glycerol.

Example 2

Application of rabbit anti-porcine KLRB1 antibody in blocking recombinant porcine Pasteurella multocida toxin (rPMT)

1. Preparation of rabbit anti-porcine KLRB1 antibody and determination of titer of rabbit anti-porcine KLRB1 antibody

1.1 Preparation of Rabbit anti-porcine KLRB1 antibody

About 2kg of rabbits are purchased and fed for about 3-5 days, so that the generation of stress to adversely affect the subsequent antibody preparation is avoided.

Day 1 (primary immunization): subcutaneous injection of an equal volume of the mixture of the immunogen solution and Freund's complete adjuvant into test animals, after cutting the hair from the back portion of the rabbits, with subcutaneous multiple injections, each test animal being given an immunogen dose of 500 μg (total protein);

day 14 (first boost): subcutaneous injection of an equal volume of the mixture of the immunogen solution and Freund's incomplete adjuvant into the test animals, using subcutaneous multipoint injection, but each test animal was given an immunogen dose of 250 μg (total protein);

day 28 (second boost): subcutaneous injection of an equal volume of the mixture of the immunogen solution and Freund's incomplete adjuvant into test animals, each test animal being given an immunogen dose of 250 μg (total protein);

day 42 (third boost): subcutaneous injection of an equal volume of the mixture of the immunogen solution and Freund's incomplete adjuvant into test animals, each test animal being given an immunogen dose of 250 μg (total protein);

day 45: and collecting 500 mu l of serum of the test animal, namely rabbit-derived antiserum, namely rabbit anti-pig KLRB1 antibody for short.

1.2 Determination of Rabbit anti-porcine KLRB1 antibody titers

The antibody to be tested is the rabbit anti-porcine KLRB1 antibody prepared in the step 1.1.

(1) The KLRB1 protein prepared in example 1 was diluted with coating buffer diluent to a concentration of 1. Mu.g/100. Mu.L per well, incubated at 37℃for 1h, and then incubated overnight at 4 ℃;

(2) Discarding the liquid in the hole, washing with 250 μl of PBST three times for 3min, adding sealing liquid, and keeping at 37deg.C for 1.5 hr;

(3) The liquid in the wells was discarded, and washed three times with 250. Mu.L of PBST for 3min at a time;

(4) Gradient dilution (2-fold dilution from 1:2000 to 1:128000) of the prepared rabbit anti-porcine KLRB1 antibody with a blocking solution is respectively added into reaction wells coated with KLRB1 protein, each dilution gradient comprises two wells, one 100 mu L, and negative control (the blocking solution is added into the reaction wells coated with KLRB1 protein), and the reaction is carried out for 1h at a constant temperature of 37 ℃;

(5) The liquid in the wells was discarded, and washed three times with 250. Mu.L of PBST for 3min at a time;

(6) Adding 5000 times diluted enzyme-labeled secondary antibody HRP-goat anti-rabbit IgG, and reacting at 37 ℃ for 30min at a constant temperature of 100 mu L per hole;

(7) The liquid in the wells was discarded, and washed three times with 250. Mu.L of PBST for 3min at a time;

(8) Adding a color development solution, reacting for 10min at a constant temperature of 37 ℃ under the protection of light at 100 mu L of each hole;

(9) Adding 50 mu L of stop solution into each hole to stop the reaction;

(10) Measuring the OD450 value of each hole by using an enzyme labeling instrument;

(11) And (3) result judgment: if the OD of the hole to be detected is more than or equal to 0.1 and the P/N value is more than or equal to 2.1, the result is positive, the highest dilution multiple of positive serum is serum antibody titer, and the result of 4-free titer is shown in Table 6 and FIG. 1.

TABLE 6 results of rabbit anti-porcine KLRB1 antibody titers

Antibody dilution fold	Repeat 1	Repeat 2	Average value of	P/N
					1：2000	2.89451	2.83723	2.86587	48.07587139
1：4000	2.38178	2.41269	2.397235	40.21437175
					1：8000	1.58724	1.57115	1.579195	26.49149324
1：16000	0.893351	0.960374	0.9268625	15.5484102
					1：32000	0.502506	0.536151	0.5193285	8.711899066
1：64000	0.271027	0.335578	0.3033025	5.087994914
					1：128000	0.184901	0.192129	0.188515	3.162398467
1：256000	0.108941	0.112794	0.1108675	1.859837212
					Negative	0.058609	0.0606138	0.0596114	/

As can be seen from table 6 and fig. 1, when the 128000-fold dilution of the rabbit anti-porcine KLRB1 antibody, the value of OD450 for the wells to be tested was 0.188515 and the P/N value was 3.162398467; when the rabbit anti-porcine KLRB1 antibody was 256000 times diluted, the value of OD450 of the well to be tested was 0.1108675, the P/N value was 1.859837212, and the result was negative, so that the serum antibody titer was 1:128000.

Blocking effect of antibody 2 on recombinant porcine Pasteurella multocida toxin

2.1 Blocking at the cellular level (WT/KLRB 1 ^-/-/KLRB 1 antibody group)

2.1.1 Cell culture

PK15 cell line is preserved in pig disease center, KLRB1 ^-/- cell is monoclonal deletion cell line obtained by knocking out by CRISPR technique in this laboratory, all are adherent cells, and the cells are cultured in incubator with CO ₂ and saturated humidity at 37deg.C and volume fraction of 5%. The cells need to be cultured in DMEM culture solution containing 10% of standard fetal calf serum, and when the cells grow to 70% -80% and the logarithmic growth phase, the cells are passaged, and the method is as follows:

(1) The culture solution in the culture flask full of WT and KLRB1-/-PK15 cells is completely sucked, and the culture flask is sucked as clean as possible, but the culture flask is not touched with the bottom of the culture flask. Adding 2-3 mL PBS to wash the cells for 1-2 times;

(2) 1mL of 0.05% pancreatin was added for digestion, and the mixture was observed under an inverted phase contrast microscope;

(3) When the morphology of the cells is reduced and the cells are in a round particle shape, gently blowing the cells, and then adding 2mL of complete culture solution to terminate digestion;

(4) After the digestion was terminated, the pipette was blown at a constant speed for 25 times, 800rpm, and the cell pellet after centrifugation for 5min was transferred to a new flask and cultured under conventional culture conditions. Typically, the cells are passaged 1 time for about 2 to 3 days, and the cells are passaged at a ratio of 1/2 to 1/3.

2.1.2KLRB1 antibody blocking protection experiment

When the cells are in the logarithmic growth phase, the cells are digested and centrifuged by 0.05% pancreatin to prepare cell suspension, 2X 10 ⁴ cells/well are inoculated into 2 96-well culture plates and 100 mu L/well; when the cells had grown to 90%, the DMEM medium was discarded, 100. Mu.L/Kong Xi times with PBS, and 100. Mu.L/well serum-free DMEN was added to a control (designated as PBS) 96-well plate. Antibody group (designated as anti-KLRB1 group) 96-well plates were added (25. Mu.L of rabbit anti-porcine KLRB1 antibody prepared in example 2+75. Mu.L of serum-free DMEM)/well and incubated at 37℃for 2h; then washed once with 150. Mu.L/well PBS; recombinant porcine Pasteurella multocida toxin (rPMT) was added to 96-well plates at concentrations of 150. Mu.L/well of 0. Mu.g/mL, 0.001. Mu.g/mL, 0.01. Mu.g/mL, 0.1. Mu.g/mL, 1. Mu.g/mL, 10. Mu.g/mL, 30. Mu.g/mL, 100. Mu.g/mL, 3 replicates per concentration gradient were set, and CCK8 assays were performed after 48h incubation in a cell incubator as follows:

(1) The nutrient solution was discarded per well, and 10. Mu.L of CCK8 solution and 90. Mu.L of DMEM were added per well;

(2) Placing the mixture in a cell incubator for incubation for 1h;

(3) Absorbance was measured at 450 nm.

The CCK8 measurement results are shown in table 7 and fig. 2.

TABLE 7 control and antibody groups cell viability (PK 15 cell line)

As can be seen from Table 7 and FIG. 2, the cell survival rates of the control group and the antibody group were significantly different from each other after the recombinant porcine Pasteurella multocida toxin was added to the cells for 48 hours, and the cell survival rates of the antibody group were higher than those of the control group when the recombinant porcine Pasteurella multocida toxin was added to the cells for 0.1. Mu.g/mL and 1. Mu.g/mL, indicating the blocking effect of the rabbit anti-porcine KLRB1 antibody prepared in example 2 on the recombinant porcine Pasteurella multocida toxin.

2.1.3KLRB1 ^-/- cell resistance to recombinant porcine Pasteurella multocida toxin experiments

When KLRB1 ^-/- cells are in logarithmic growth phase, digesting and centrifuging with 0.05% pancreatin to prepare cell suspension, counting 2X 10 ⁴ cells/well, inoculating 2 96-well culture plates, and 100 μl/well; after growing to 90%, the DMEM culture solution is discarded, 100. Mu.L/Kong Xi times of PBS is used, and 100. Mu.L/well serum-free DMEN is added to 96-well plates of an experimental group (recorded as KLRB1 ^-/-) and a control group (recorded as PBS) and incubated at 37 ℃ for 2 hours; then washed once with 150. Mu.L/well PBS; recombinant porcine Pasteurella multocida toxin (rPMT) was added to 96-well plates at concentrations of 150. Mu.L/well of 0. Mu.g/mL, 0.001. Mu.g/mL, 0.01. Mu.g/mL, 0.1. Mu.g/mL, 1. Mu.g/mL, 10. Mu.g/mL, 30. Mu.g/mL, 100. Mu.g/mL, 3 replicates per concentration gradient were set, and CCK8 assays were performed after 48h incubation in a cell incubator as follows:

(2) Placing the mixture in a cell incubator for incubation for 1h;

(3) Absorbance was measured at 450 nm.

The test results are shown in table 8 and fig. 3.

Table 8 cell viability of control and experimental groups (PK 15 cell line)

As can be seen from Table 8 and FIG. 3, after the recombinant Pasteurella multocida toxin is added for 1-100 mug/mL for 48 hours, the cell survival rate of the experimental group is obviously higher than that of the control group, which indicates that the KLRB1 knocked out can resist the recombinant Pasteurella multocida toxin.

2.2 Blocking at the animal level (WT/KLRB 1 antibody group)

20C 57 mice (male and female halves, weight 20 g) of 8 weeks old are selected, and the mice are equally divided into a WT group and a KLRB1 antibody group (namely 10C 57 mice of the WT group and the anti-KLRB1 group, male and female halves respectively) and are fed for 2-3 d to adapt to the environment, and the formal experiment is detailed as follows:

1) 200 mu L/of rabbit anti-pig KLRB1 antibodies are injected into the abdominal cavity of the KLRB1 antibody group, 200 mu L/of PBS is injected into the abdominal cavity of the WT group, and the feed is normally carried out for 36 hours;

2) The two groups are fed for 24 hours normally by injecting rPMT 0.8ng/g into the abdominal cavity;

3) 200 mu L/WT group of anti-pig KLRB1 antibody of example 1 was injected intraperitoneally with 200 mu L/WT group of PBS, and kept normally for 24 hours;

4) Mice were closely observed and the death of each group of mice was recorded every 24h.

The experimental results are shown in table 9 and fig. 4.

TABLE 9 survival of mice in control and antibody groups

Note that: the number is the number of deaths on the day.

As can be seen from table 9 and fig. 4, the mice in the antibody group died less rapidly than the control group, demonstrating the blocking effect of the rabbit anti-porcine KLRB1 antibody of example 1 on recombinant porcine pasteurellosis toxin.

2.3KLRB1 ^-/- mice resistant to recombinant porcine Pasteurella multocida toxin

C57 mice and KLRB ^-/- C57 mice (male and female halves, weight 20 g) of 8 weeks old are selected and divided into Buffer group, WT group and KLRB1 ^-/- group, and the mice are fed for 2-3 d to adapt to the environment, and the formal experiment is detailed as follows:

1) The WT group and KLRB1 ^-/- group were given intraperitoneal injections of rtts (high dose 4ng/g; medium dose 1.2ng/g; low dose 0.6 ng/g), 200 μl/unit of PBS was injected intraperitoneally into Buffer group;

2) Mice were closely observed and the death of each group of mice was recorded every 24h.

The results of the experiments are shown in tables 10 to 12 and FIGS. 5 to 7.

TABLE 10 survival of mice challenged with Low dose rPMT (0.6 ng/g) in different groups

Note that: the number is the number of deaths on the day.

Table 11 survival of mice challenged with rPMT (1.2 ng/g) at different doses

/>

Note that: the number is the number of deaths on the day.

TABLE 12 survival of mice of different groups challenged with high dose rPMT (4 ng/g)

Note that: the number is the number of deaths on the day.

As can be seen from tables 10-12 and fig. 5-7, the low, medium, and high dose rtt challenge experimental group (KLRB 1 ^-/-) mice died at a lower rate than the control group, indicating that the KLRB1 knockout was resistant to recombinant porcine pasteurellosis toxin.

2.3KLRB1 ^-/- resistance of mice to porcine Pasteurella multocida toxin

C57 mice and KLRB ^-/- C57 mice (male and female halves, weight 20 g) of 8 weeks old were selected and divided into Buffer group, WT group and KLRB1 ^-/- group, and the animals were kept for 2-3 d to adapt to the environment, and the experiment was detailed as follows:

(1) The WT group and KLRB1 ^-/- group were subjected to intraperitoneal injection of 20 CFU/200. Mu.L of swine pasteurella multocida, and the Buffer group was subjected to intraperitoneal injection of 200. Mu.L of PBS/patient;

(2) Mice were closely observed and the death of each group of mice was recorded every 24 h.

The experimental results are shown in table 13 and fig. 8.

TABLE 13 survival of mice of different groups challenged with Pasteurella multocida

/>

Note that: the number is the number of deaths on the day.

As can be seen from table 13 and fig. 8, 20CFU/200 μl of pasteurella multocida challenge experimental group (KLRB 1 ^-/-) mice died at a lower rate and number of deaths than the control group, demonstrating that KLRB1 knockout was resistant to the lethal effects of pasteurella multocida on mice.

The invention proves for the first time that KLRB1 protein or the coding gene thereof is related to the deadly effect of the porcine pasteurella multocida and the recombinant porcine pasteurella multocida toxin on animals, and the animals with the KLRB1 protein deleted or the gene for coding the KLRB1 protein deleted can resist the deadly effect of the porcine pasteurella multocida and the recombinant porcine pasteurella multocida toxin.

Claims

1. Use of an anti-KLRB 1 protein antibody or KLRB1 gene knockout vector or KLRB1 gene silencing vector in the preparation of a product for increasing the resistance of an animal to a pasteurella multocida and/or a pasteurella multocida toxin.

2. The use according to claim 1, wherein the KLRB1 protein has the amino acid sequence shown in SEQ ID No. 1.

3. The use according to claim 1, wherein the anti-KLRB 1 protein antibody is a rabbit anti-KLRB 1 protein antibody.

4. The use according to claim 1, wherein the CDS sequence of the KLRB1 gene is shown in SEQ id No. 2.

5. The use according to claim 1, wherein the animal is a pig or a mouse.

6. A method of constructing an animal model against pasteurella multocida and/or pasteurella multocida toxins in an animal, characterized by silencing the KLRB1 gene of the animal by gene editing knockout or RNAi.

7. The method of claim 1, wherein the animal model is a pig or mouse model.