CN110846285A

CN110846285A - Pseudorabies virus gene deletion strain, porcine pseudorabies inactivated vaccine, and preparation method and application thereof

Info

Publication number: CN110846285A
Application number: CN201810948945.4A
Authority: CN
Inventors: 彭丽英; 林鸷; 何錫忠
Original assignee: Shanghai Academy of Agricultural Sciences
Current assignee: SHANGHAI JIAMU BIOLOGICAL PRODUCTS Co.,Ltd.; Shanghai Academy of Agricultural Sciences
Priority date: 2018-08-20
Filing date: 2018-08-20
Publication date: 2020-02-28

Abstract

The invention discloses a pseudorabies virus gene deletion strain, which is constructed by reading frame shift mutation caused by deletion of a plurality of bases in a gE gene sequence of a wild-type pseudorabies virus PRV strain. The invention also discloses a preparation method of the porcine pseudorabies inactivated vaccine, which comprises the following steps: constructing a pseudorabies virus gE gene deletion strain; training pig testicular cells and performing suspension culture on the pig testicular cells; inoculating a pseudorabies virus gE gene deletion strain, and harvesting a cell culture when more than 80-90% of cells have pathological changes to obtain cell venom containing supernatant; taking supernatant to measure the toxicity value, and putting the qualified cell venom into a sterilization container for inactivation; and mixing the inactivated cell venom with an adjuvant to obtain the porcine pseudorabies inactivated vaccine. The inactivated vaccine for porcine pseudorabies prepared by the invention has good immunogenicity, long immune cycle, no side reaction after immunization, safety and reliability, and can effectively protect infection of pseudorabies virus epidemic strains.

Description

Pseudorabies virus gene deletion strain, porcine pseudorabies inactivated vaccine, and preparation method and application thereof

Technical Field

The invention relates to the technical field of biological engineering, in particular to a pseudorabies virus gene deletion strain, a porcine pseudorabies inactivated vaccine, and a preparation method and application thereof.

Background

Pseudorabies (PR) is a virulent infectious disease caused by Pseudorabies virus (PRV) and occurring in domestic animals and wild mammals with fever, extreme itching (excluding pigs) and encephalomyelitis as major symptoms. The disease is a typical natural epidemic disease, pigs are the main host and the infection source of the disease, and the economic loss caused by the pig industry is second to the swine fever. In animals other than pigs, the disease occurs in sporadic form and, after the disease occurs, it ends up dying.

The loss caused by the pseudorabies is only second to foot-and-mouth disease and swine fever, and becomes one of the pig diseases which are mainly epidemic-prevention in some countries in Europe, PR distribution is worldwide, PR is more popular in countries in eastern Europe and Balganhai peninsula in the middle of the 20 th century, the symptoms of the infected pig are mild before the 60 th year, and no significant economic loss is caused in the pig raising industry; in the 60-70 s, the number of outbreaks of PR in pig farms is remarkably increased due to the appearance of virulent strains, and pigs of various ages of days can be infected, the symptoms of the outbreaks are remarkably increased, the change exists not only in the United states, but also in countries of Western Europe such as Germany, France, Italy, Belgium, Ireland and the like, and the disease is successively introduced into countries and regions of New Zealand, Japan, Taiwan of China and south America after a few years. The domestic condition is that the symptoms of the infected pigs are mild before the 60 s, the cases are rare, the disease is sporadically distributed in the 70 s, and the local prevalence and the sporadic prevalence appear after the 80 s; in the 90 s, local circulation and outbreak trends are shown, the number of PR outbreaks in pig farms is obviously increased due to the occurrence of virulent strains, the symptoms are obviously aggravated, more than 40 animals are reported to be infected by the PR in more than 40 countries, and the PR is reported to occur in 24 provinces and cities in China. PR has been shown to be an outbreak trend in many provinces (cities) of pig farms in China in recent years.

Pseudorabies virus (PRV) belongs to the sub-family of herpes virus A of the family of herpesviridae, the genome of which is linear double-stranded DNA with a length of about 150kb, consists of a long unique region (UL), a short unique region (US) and repeated sequences on both sides of the US and encodes more than 70 proteins. The N end of PRV gE gene contains main target antigen capable of being identified by body immune system, gE is non-essential gene for PRV replication, and it has been shown that gE deletion can reduce virus neurotropic property and does not affect its immunogenicity.

Although there are many isolates of pseudorabies virus in China at present, the isolation of pseudorabies virus with stronger immunogenicity is not many, and the strains isolated in different areas at different time periods are also different. The separation of pseudorabies virus with stronger immunogenicity can lay a good foundation for developing the pseudorabies inactivated vaccine, and the porcine pseudorabies virus (PRV-sh strain) separated in the laboratory has the characteristics of strong toxicity, good immunogenicity and the like.

Due to the single serotype and high immunogenicity of Pseudorabies virus (PRV), vaccination becomes an effective method for controlling PRV infection. The PRV vaccines developed at present comprise inactivated vaccines and attenuated live vaccines, and both of the inactivated vaccines and the attenuated live vaccines have defects in clinical application. Although the inactivated vaccine has good safety, the inactivated vaccine has the defects of poor immune efficacy, large inoculation dose, occasional occurrence of anaphylactic reaction after 24 hours of inoculation and the like. In the aspect of attenuated seedlings, many attenuated seedlings cultured in various countries are provided, and the most commonly used strains are Bartha strains and Bucharest strains. The attenuated vaccine has good immunogenicity, can prevent clinical symptoms after inoculation, but can not prevent the virulent from replicating, discharging and forming latent infection in infected animals, and whether the virulent returns to be strong or not is still needed to be further researched.

In the beginning of 2011, in the pig farms in Henan, Hebei, Beijing and Shandong, in 2012, Jiangsu, Anhui, Shanghai, Guangdong and Guangxi, and in the east of 2013, tens of provinces, sow return, abortion and stillbirth occur successively, piglets have diarrhea and neurological symptoms, the mortality rate is high, fattening pigs in some pig farms die, the pig pseudorabies is determined by clinical diagnosis and laboratory detection, and the prevalence of the pig pseudorabies is also developed in most provinces nationwide in 2014. The disease brings great economic loss to pig farms, and the incidence degree of the pseudorabies is more serious and more violent than the incidence degree of the pseudorabies in the past. The pseudorabies is manifested by abortion, infertility and multiple stillbirths of sows, death of suckling piglets in most one week, no cough and normality of other pigs; at present, the early stage of lactation of the swinery is normal, the later stage of lactation of the swinery is manifested by diarrhea and the like, and the mortality rate is high. The most serious of the symptoms are that after 20 days of age, pigs are coughed first and then suffer asthma, and have rhinorrhea and tears which are often mistaken for asthma or cold; the viruses can cause fatness of the fattening pigs, and the fatness and the morbidity of the fattening pigs are far higher than before. The existing vaccine immunity can not provide complete protection, and shows that PRV epidemic in pig farms in China has variation. In order to effectively control the prevalence of PRV variants, the development of more efficient PRV vaccines is required.

In 2017, the infectious department of Huashan Hospital, Renda university, announced that PRV infected cases were seen in all people, not only PRV antibodies were detected, but also sequence determination showed that the obtained virus strain is highly homologous to PRV high-toxicity variant strains which are popular in China in recent years; beijing's cooperative hospital also reported 6 cases of PRV infection in people. These suggest the possibility of a zoonotic stable virus strain formation due to viral variation, again confirming that PRV is a potential threat to human health. Therefore, the understanding of the human and animal co-morbidity caused by the herpes virus is improved, and a corresponding early warning mechanism is established as soon as possible, so that the method is necessary for effectively preventing and controlling the cross-species transmission of the herpes virus.

Disclosure of Invention

The invention provides a pseudorabies virus gene deletion strain, aiming at solving the technical problems that the PRV variant strain appears in China at present, the protection effect of the existing PRV vaccine on the variant strain is poor, and a new PRV vaccine needs to be developed urgently, wherein the gene deletion strain is a gE gene deletion strain constructed by a pseudorabies virus epidemic strain, and the porcine pseudorabies inactivated vaccine prepared by utilizing the gene deletion strain has good immunogenicity and obviously enhanced immune effect.

In order to solve the technical problems, the invention is realized by the following technical scheme:

in one aspect of the invention, the invention provides a pseudorabies virus gene deletion strain, which is constructed by deleting a plurality of bases from the gE gene sequence of a wild-type pseudorabies virus PRV strain to cause reading frame shift mutation.

Preferably, the gE gene sequence of the gene deletion strain is a nucleic acid sequence with two bases of 829-AG 830 th site deleted from the gE gene sequence of the wild-type pseudorabies virus PRV strain shown in SEQ ID NO. 1.

In another aspect of the invention, the invention also provides a porcine pseudorabies inactivated vaccine which is prepared by taking the pseudorabies virus gene deletion strain as a seed virus.

In another aspect of the present invention, a method for preparing a porcine pseudorabies inactivated vaccine is also provided, which comprises the following steps:

(1) constructing a pseudorabies virus gE gene deletion strain;

(2) training pig testicular cells and performing suspension culture on the pig testicular cells;

(3) when the cell density of the pig testis reaches 3 x 10⁶Inoculating a pseudorabies virus gE gene deletion strain when the cell count is more than one/ml, harvesting a cell culture when more than 80-90% of the pig testicular cells have pathological changes, and repeatedly freezing and thawing for more than 2 times to obtain cell venom containing supernate;

(4) taking supernatant fluid to measure the toxicity value, then placing the qualified cell venom into a sterilization container, adding an inactivating agent, fully shaking up, and inactivating;

(5) and (4) uniformly mixing the inactivated cell venom in the step (4) with an adjuvant to obtain the porcine pseudorabies inactivated vaccine.

Preferably, the temperature of the suspension culture of the pig testicular cells in the step (2) is 36-37 ℃, the dissolved oxygen concentration is 50%, the stirring speed is 80-110r/min, and the pH value is 7.2.

Preferably, the pseudorabies virus gE gene deletion strain inoculated in the step (3) has the virus valence TCID₅₀≥10^8.0The strain is diluted to 0.05-0.2% by weight.

Preferably, the inactivator in step (4) is selected from formaldehyde solution, β -propiolactone, or diethylene imine solution.

More preferably, the inactivating agent in the step (4) is 35-38% by weight of formaldehyde solution, the volume ratio of the cell venom to the formaldehyde solution in the step (4) is 100: 0.1-0.2, the inactivation temperature is 35-37 ℃, and the inactivation time is 28-38 hours.

Preferably, the adjuvant of step (5) comprises an alumina gel adjuvant, MERCKINADE SDA28 adjuvant and 206 adjuvant.

More preferably, the adjuvant in the step (5) is MERCKINADE SDA28 adjuvant, and the cytotoxic solution and MERCKINADE SDA28 adjuvant are mixed according to the weight ratio of 3-4: 1.

In another aspect of the present invention, there is also provided a vaccine composition comprising the pseudorabies virus gene deletion strain described above in admixture with an adjuvant or a pharmaceutically acceptable carrier.

In another aspect of the invention, the invention also provides the application of the pseudorabies virus gene deletion strain in preparing vaccines for preventing or treating pseudorabies.

In another aspect of the invention, the invention also provides a detection kit for distinguishing the pseudorabies virus gene deletion strain vaccine immunity from the pseudorabies virus wild strain infection, which comprises a pseudorabies virus gE protein antibody.

By detecting the gE antibody of the infected pig body, the infection of the pseudorabies virus gE gene deletion strain vaccine immunity and the wild strain can be distinguished.

Compared with the prior art, the invention has the following advantages:

(1) the strain for preparing the vaccine has stronger toxicity: after the pseudorabies virus gE gene deletion strain is inoculated to a single-layer cell, cytopathic effect generally appears in 18-24h, the most obvious cytopathic period is 32-48h after inoculation, the pseudorabies virus gE gene deletion strain begins to be scattered in a focus shape, and then gradually expands until all cells shrink and fall off; after the suspension cells are inoculated, the virus is collected within about 50 hours; thirty hours later, the rabbits died after the pseudorabies virus gE gene deletion strain is inoculated to the rabbits, and the strain is diluted by 10⁷More than half of the rabbits still die after being inoculated;

(2) the virus titer of the strain for preparing the vaccine is high: after the pseudorabies virus gE gene deletion strain is inoculated to a monolayer cell, the virus titer of other strains is only 10^7.0The virus titer of the strain (PRV strain) isolated from the strain/ml can reach 10^8.0A/ml, suspension culture can reach 10^8.75/ml；

(3) The porcine pseudorabies inactivated vaccine has good immunogenicity: the effect of the inactivated vaccine prepared by inactivating the propagated virus is superior to that of the existing single-phase inactivated vaccine in the market, and the existing inactivated vaccine in the market is prepared by using the traditional virus strain, so that the infection of epidemic strains can not be effectively protected;

(4) the safety is good: the adjuvant used by the existing inactivated vaccine in the market is an oil adjuvant, the oil component is more than 41 percent, the injection resistance is large when the pig is immunized, and a needle cylinder and a needle head of an injector are easy to separate to cause inaccurate immunization dosage; the stress response to the pigs is large, especially to a pig farm with sub-healthy swinery; the adjuvant oil used in the invention only accounts for 17 percent of the components, is easy to inject and has no side reaction after immunization; the immunity period is long, and the antibody can last for 4 months after the pig is immunized;

(5) the adopted preparation method has reasonable process and lower price, and greatly reduces the cost burden of the breeding industry.

Drawings

The present invention will be described in further detail with reference to the accompanying drawings and specific embodiments.

FIG. 1 is a graph showing the results of activity detection of Cas9/gRNA in example 1 of the present invention;

FIG. 2 is a graph showing the results of enzyme digestion identification of a mutant strain by T7E1 in example 1 of the present invention;

FIG. 3 is a result diagram of enzyme digestion identification of purified mutant strains of T7E1 in example 1 of the present invention;

FIG. 4 is a comparison chart of the sequencing results of example 1 of the present invention;

FIG. 5 is a graph showing the variation of PRV-specific antibodies in immunized pigs according to example 6 of the present invention.

Detailed Description

The porcine pseudorabies inactivated vaccine adopts the constructed pseudorabies virus gE gene deletion strain with stronger immunogenicity, so that the immune effect is good; the virus liquid production process of suspension culture is adopted in the process production, so that the virus valence of the virus is improved; the MERCKINADE SDA28 adjuvant is adopted, so that adverse reactions of the existing oil emulsion inactivated vaccine after immunization are avoided, the cellular immune response is improved, the immune effect of the vaccine is enhanced, and the immune dose of the vaccine is reduced.

The present invention will be described in detail with reference to specific examples.

Example 1 construction of Pseudorabies Virus gE Gene-deleted Strain

Designing gRNA aiming at PRV gE gene, successfully editing PRV gE gene through CRISPR/Cas9 editing system, obtaining a gE gene deletion mutant strain by plaque purification, carrying out enzyme digestion identification by T7E1 nuclease, and discovering that AG two bases are deleted on the designed site through sequencing, thereby causing frame shift mutation of reading frame and successfully constructing pseudorabies virus gE gene deletion strain.

1. Materials and methods

1.1 materials

1.1.1 poison and cell

The pseudorabies virus PRV strain was isolated from the animal husbandry veterinary institute of the academy of agricultural sciences of Shanghai. ST cells were maintained by the livestock veterinary institute of academy of agricultural sciences, shanghai.

1.1.2 Experimental reagent and consumable

The porcine pseudorabies virus gB and gE antibody detection kit is purchased from IDEXX company. Fetal bovine serum, pancreatic enzymes and DMEN are products of Invitrogen corporation. Cell culture consumables were purchased from Shanghai Biotechnology, Inc. The viral genomic DNA/RNA extraction kit (DP315) was purchased from Tiangen Biochemical technology, Inc. (Beijing). Cas9/gRNA construction kit (VK001-02), gRNA target efficiency kit (VK007), and T7E1 nuclease were purchased from Beijing Weishanglide Biotech, Inc.

1.2 test methods

1.2.1 construction of gE Gene Cas9/gRNA vector

The online gRNA design website (http:// criprpr. mit. edu /) was used to design 4 pairs of gRNAs against the PRV gE gene:

gRNA1：

F:5’-3’:CCCTGGCGCTCTCCACCG(SEQ ID NO.3)；

R:5’-3’:CGGTGGAGAGCGCCAGGG(SEQ ID NO.4)；

gRNA2:

F:5’-3’:CCTCAACGGCGACCTCGA(SEQ ID NO.5)；

R:5’-3’:TCGAGGTCGCCGTTGAGG(SEQ ID NO.6)；

gRNA3:

F:5’-3’:CGTTGAGGTCATCGTCGT(SEQ ID NO.7)；

R:5’-3’:ACGACGATGACCTCAACG(SEQ ID NO.8)；

gRNA4:

F:5’-3’:CGGACACGTTCACCAGAT(SEQ ID NO.9)；

R:5’-3’:ATCTGGTGAACGTGTCCG(SEQ ID NO.10)。

a Cas9/gRNA vector for simultaneously expressing Cas9 and gRNA is constructed by utilizing a commercial CRISPR/Cas9 construction kit.

1.2.2 extraction of viral genome

And (3) putting 200 mu L of virus suspension into a 1.5mL centrifuge tube, repeatedly freezing and thawing for 3 times, and extracting virus DNA according to the instruction of a virus genome DNA/RNA extraction kit (DP 315).

1.2.3T7E1 enzyme cleavage assay

Design 1 can amplify the primer (F: CACCATCGCAGAGGAACAATA (SEQ ID NO. 11); R: TTGTGGGTCATCACGAGCAC (SEQ ID NO.12)) with mutation site DNA fragment, mix the wild type and mutant PCR products, heat and boil to denature, cool naturally to room temperature and renaturate, add 0.5 mu L T7E1 enzyme after renaturation, mix, 37 ℃ reaction 30min after mixing, 65 ℃ inactivation, 2% agarose gel electrophoresis detection.

1.2.4 sequencing analysis

And (3) carrying out glue recovery on the obtained PCR product, sending the PCR product to Shanghai biological engineering company Limited for sequencing, and comparing a sequencing result with a wild type PRV gE gene to determine the mutation position and the mutation type in the PRV gE gene.

2 results

2.1Cas9/gRNAs-gE vector construction

The activity of the synthesized Cas9/gRNA was detected, and compared with the standard 1 and the standard 2, the results showed that the digestion efficiency of gRNA1 was 50% (fig. 1, lane 1), the digestion efficiency of gRNA2 was 80% (fig. 1, lane 2), the digestion efficiency of gRNA3 was 60% (fig. 1, lane 3), and the digestion efficiency of gRNA4 was 95% (fig. 1, lane 4). The gRNA targets with higher activity (gRNA2 and gRNA4) are selected for subsequent cell tests. In fig. 1, M: marker; 1: a gRNA 1; 2: a gRNA 2; 3: a gRNA 3; 4: a gRNA 4; 5: NC; 6: 1, a standard substance; 7: a standard 2; m: marker; 1: a gRNA 1; 2: a gRNA 2; 3: a gRNA 3; 4: a gRNA 4; 5: NC; 6: standard 1; 7: standard 2.

2.2 purification of mutant strains

The T7E1 nuclease can recognize mismatched heteroduplexes and cleave. In order to obtain a mutant strain, the Cas 9/gRNA-gE which is well constructed by transfection is inoculated into an ST cell, PRV is inoculated after transfection, when cytopathic effect (CPE) appears in the cell, supernatant and the cell are collected, virus DNA is extracted, a DNA fragment with a mutant site, the length of which is 1202bp (SEQ ID NO.2), is amplified by PCR (polymerase chain reaction) as shown in a result of a lane 3 in figure 2, and two mutant type bands of 800bp and 400bp appear after annealing and enzyme digestion by T7E1, which indicates that the strain contains mutation. In fig. 2, 1: wild-type PCR products; 2: carrying out enzyme digestion on a wild type PCR product; 3: carrying out enzyme digestion mutant PCR; 4: the mixture of enzyme digestion mutant PCR and wild type PCR; m: marker.

On the basis, several times of plaque purification are carried out, pure mutant strains are obtained by screening, and as shown in

lanes

3 and 4 in figure 3, pure mutant strains are obtained by enzyme digestion identification of T7E 1. These results indicate that mutant strains were edited using CRISPER/Cas 9. In fig. 3, 1: wild-type PCR products; 2: carrying out enzyme digestion on a wild type PCR product; 3: carrying out enzyme digestion mutant PCR; 4: the mixture of enzyme digestion mutant PCR and wild type PCR; m: marker.

2.3 sequencing analysis

In order to verify the specific position and mutation type of the mutation, the PCR product of the purified mutant strain is sequenced. The results showed that a mutant strain was obtained which had two bases of AG at position 829-830 in the gE gene sequence (SEQ ID NO.1) of the wild-type pseudorabies virus PRV strain, resulting in a frame shift mutation of the reading frame (see FIG. 4).

Example 2 preparation of inactivated vaccine against porcine pseudorabies

The preparation method of the porcine pseudorabies inactivated vaccine comprises the following steps:

(1) culturing pig testis cells in a bioreactor for suspension culture, wherein the suspension culture temperature is controlled at 37 ℃, DO is 50%, the stirring speed is 100r/min, and the pH is 7.2;

(2) when the cell density is 3 x 10⁶Then, the pseudorabies virus gE gene-deleted strain constructed in example 1 was inoculated with the virus valence TCID₅₀≥10^8.75The strain is diluted to the weight percentage concentration of 0.1 percent;

(3) when more than 80-90% of the pig testicular cells have pathological changes, harvesting the cell culture, and repeatedly freezing and thawing for 3 times to obtain cell venom containing supernatant; storing the cell venom at-20 deg.C for no more than 30 days;

(4) taking supernatant to measure the virus value, wherein the virus content of each head is more than or equal to 10^8.0TCID₅₀Placing qualified cell venom into a sterilization container, adding 37 wt% formaldehyde at a volume ratio of cell venom to formaldehyde of 100: 0.15, shaking thoroughly, and inactivating at 37 deg.C for 36 h;

(5) and adding a proper amount of VSP into the qualified cell venom, mixing the cell venom with MERCKINADE SDA28 adjuvant according to the weight ratio of 3: 1, emulsifying for 10 minutes at 300rpm, and preparing the porcine pseudorabies inactivated vaccine.

The virus content of each head of the inactivated vaccine for porcine pseudorabies developed by the invention is more than or equal to 10^8.0TCID₅₀. The pig still can resist the attack of PRV strong virus after 5 months of immunization, the duration of the immunization can be maintained for at least 4 months, and the storage period at 2-8 ℃ is 12 months.

The pig body has no adverse clinical reaction after being inoculated with the vaccine. The immune pig has normal appetite and body temperature, good mental state and good safety. The production performance of the inoculated sow is improved, good social and economic benefits are generated, and the feed has a positive effect on preventing the sow breeding disorder caused by the porcine pseudorabies.

The use of the vaccine prepared by the invention:

1. action and uses

Can be used for preventing porcine pseudorabies.

2. Application and dosage

Injecting into neck muscle. The piglet, 2ml each at weaning, the boar 2ml each at 28 days later, and the booster immunization is performed every half year after 1 booster immunization. The pregnant sow is boosted once in a month before delivery.

Example 3 preparation of inactivated vaccine against porcine pseudorabies

(2) example 1 construction of Pseudorabies Virus gE Gene-deleted Strain, its toxicity value TCID₅₀≥10^8.75The strain is diluted to 0.1 weight percent concentration and inoculated to the density of 3 x 10 obtained in the step (1)⁶The temperature of the suspended pig testicular cells is 37 ℃, the DO is 50%, the stirring speed is 90r/min, and the pH is 7.2;

(3) when more than 80-90% of cells have cytopathic effect, harvesting the cell culture, repeatedly freezing and thawing for 3 times to obtain cell venom containing supernatant, and storing the cell venom at a temperature below-20 ℃ for no more than 30 days;

(4) taking supernatant to measure the virus value, wherein the virus content of each head is more than or equal to 10^8.0TCID₅₀Placing qualified cell venom into a sterilization container, adding 36 wt% formaldehyde at a volume ratio of cell venom to formaldehyde of 100: 0.2, shaking thoroughly, and inactivating at 37 deg.C for 28 hr;

(5) and adding a proper amount of VSP into the qualified cell venom, mixing the cell venom with MERCKINADE SDA28 adjuvant at a weight ratio of 4: 1, emulsifying at 300rpm for 10 minutes, and preparing the porcine pseudorabies inactivated vaccine.

The virus content of each head of the inactivated vaccine for porcine pseudorabies developed by the invention is more than or equal to 10^8.0TCID₅₀. After the piglets are immunized for 4.5 months, the piglets still can resist the attack of PRV strong virus, the immunization duration is 4 months, and the storage period at 2-8 ℃ is 12 months.

Example 4 preparation of inactivated vaccine against porcine pseudorabies

(1) culturing pig testis cells in a bioreactor for suspension culture, wherein the suspension culture temperature is controlled at 35 ℃, DO is 40%, the stirring speed is 80r/min, and the pH is 7.2;

(2) example 1 construction of Pseudorabies Virus gE Gene-deleted Strain, its toxicity value TCID₅₀≥10^8.75The strain is diluted to 0.1 weight percent concentration and inoculated to the density of 3 x 10 obtained in the step (1)⁶The temperature of the suspended pig testicular cells is 35 ℃, the DO is 40%, the stirring speed is 80r/min, and the pH is 7.2;

(4) taking supernatant to measure the virus value, wherein the virus content of each head is more than or equal to 10^8.0TCID₅₀Placing qualified cell venom into a sterilization container, adding 35 wt% formaldehyde at a volume ratio of cell venom to formaldehyde of 100: 0.15, shaking thoroughly, and inactivating at 35 deg.C for 32 h;

Example 5 preparation of inactivated vaccine against porcine pseudorabies

(1) culturing pig testis cells in a bioreactor for suspension culture, wherein the suspension culture temperature is controlled at 36 ℃, DO is 50%, the stirring speed is 110r/min, and the pH is 7.2;

(2) example 1 construction of Pseudorabies Virus gE Gene-deleted Strain, its toxicity value TCID₅₀≥10^8.75The strain is diluted to 0.1 weight percent concentration and inoculated to the step (1) to obtain the density of 3 x 10⁶The temperature of the suspended pig testicular cells is 36 ℃, the DO is 50%, the stirring speed is 110r/min, and the pH is 7.2;

(4) taking supernatant to measure the virus value, wherein the virus content of each head is more than or equal to 10^8.0TCID₅₀Placing qualified cell venom into a sterilization container, adding 38 wt% formaldehyde at a volume ratio of cell venom to formaldehyde of 100: 0.1, shaking thoroughly, and inactivating at 37 deg.C for 36 h;

(5) and adding a proper amount of VSP into the qualified cell venom, mixing the cell venom with MERCKINADE SDA28 adjuvant according to the weight ratio of 3.5: 1, emulsifying for 10 minutes at 300rpm, and preparing the porcine pseudorabies inactivated vaccine.

The virus content of each head of the inactivated vaccine for porcine pseudorabies developed by the invention is more than or equal to 10^8.0TCID₅₀. The swine can still resist the attack of PRV virulent virus after being attacked by the virus for 4.5 months after being immunized, the immunization duration can be maintained for at least 4 months, and the storage period at 2-8 ℃ is 12 months.

Example 6 animal immunization test

1. Serum gB and gE antibody level detection

10 PRV antibody-negative tertiary pigs at 21 days of age were purchased from a certain pig farm in Nanjing. Randomly dividing piglets into 2 groups, and inoculating pseudorabies inactivated vaccine to the first group, wherein each group is 2 mL; the second group was inoculated with 2ml of pbs solution each time as a control. The immunization 28d later and the boosting immunization once, respectively taking 0, 14, 28, 42 and 56d serum after the immunization, and detecting the gB and gE antibody level in the serum.

The PRV gB antibody assay results show (fig. 5A): after the immunization of the immunization group for 14d, the gB antibodies are positive and reach strong positive after the immunization for 42d, and the S/N value is less than 0.05 and the dispersion is small; the control group of gB antibodies was negative. All test porcine PRVgE antibodies were negative throughout the test (fig. 5B). In FIG. 5, the antibody was judged to be positive when the S/N value was less than 0.6.

2. Immunization experiment of mice

30 mice with the weight of 20g are respectively injected with 0.3ml of vaccine subcutaneously, second immunization is carried out for 14 days, and after 14 days, the immunized mice and the control mice are injected with strong toxicity for testing subcutaneously, and the dose of the strong toxicity is 0.1ml (containing 50 LD)₅₀) And observing for 7 days, the control group is dead, and the protection rate of 30 mice immunized with the vaccine developed by the invention is 86%. The results are shown in Table 1.

TABLE 1 mouse immune challenge results

3. Test of validity period of pig immunity

The results of the pig immune expiration test are shown in table 2 below: after the 15-day-old pig is immunized, the antibody is produced 14 days, the ELISA antibody S/N is 0.050-0.073, the antibody level reaches the highest peak 42 days after immunization, and the antibody is reduced but still higher antibody is stable 90-140 days later, so that the immunization duration of the pig is more than 4.5 months, and the effective period is determined to be 4 months.

TABLE 2 vaccine expiration test

Note that ELISA shows that S/N value, ① S is the sample hole OD630 value, N is the negative control hole average OD630 value ② S/N is less than or equal to 0.6, the sample is judged to be PRV antibody positive, S/N is more than 0.7, the sample is judged to be PRV antibody negative.

Sequence listing

<110> Shanghai city academy of agricultural sciences

<120> pseudorabies virus gene deletion strain, porcine pseudorabies inactivated vaccine, and preparation method and application thereof

<160>12

<170>PatentIn version 3.3

<210>1

<211>1204

<212>DNA

<213> Pseudorabies Virus (Pseudorabias virus)

<400>1

caccatcgca gaggaacaat aaaaaggtgg tgtttgcata attttgtggg tggcgtttta 60

tctccgtccg cgccgtttta aacctgggca cccccgcgag tctcgcacac accggggttg 120

agaccatgcg gccctttctg ctgcgcgccg cgcagctcct ggcgctgctg gccctggcgc 180

tctccaccga ggccccgagc ctctccgccg agacgacccc gggccccgtc accgaggtcc 240

cgagtccctc ggccgaggtc tgggacgacc tctccaccga ggccgacgac gatgacctca 300

acggcgacct cgacggcgac gaccgccgcg cgggcttcgg ctcggccctc gcatccctga 360

gggaggcgcc cccggcccat ctggtgaacg tgtccgaggg cgccaacttc accctcgacg 420

cgcgcggcga cggcgccgtg ctggccggga tctggacgtt cctgcccgtc cgcggctgcg 480

acgccgtgtc ggtgaccacg gtgtgcttcg agaccgcgtg ccacccggac ctggtgctgg 540

gccgcgcctg cgtccccgag gccccggaga tgggcatcgg cgactacctg ccgcccgagg 600

tgccgcggct ccggcgcgag ccgcccatcg tcaccccgga gcggtggtcg ccgcacctga 660

gcgtcctgcg ggccacgccc aacgacacgg gcctctacac gctgcacgac gcctcggggc 720

cgcgggccgt gttctttgtg gcggtgggcg accggccgcc cgcgccggcg gacccggtgg 780

gccccgcgcg ccacgagccc cgcttccacg cgctcggctt ccactcgcag ctcttctcgc 840

ccggggacac gttcgacctg atgccgcgcg tggtctcgga catgggcgac tcgcgcgaga 900

actttaccgc cacgctggac tggtactacg cgcgcgcgcc cccgcggtgc ctgctgtact 960

acgtgtacga gccctgcatc taccacccgc gcgcgcccga gtgcctgcgc ccggtggacc 1020

cggcgtgcag cttcacctcg ccggcgcgcg cgcggctggt ggcgcgccgc gcgtacgcct 1080

cgtgcagccc gctgctcggg gaccggtggc tgaccgcctg ccccttcgac gccttcggcg 1140

aggaggtgca cacgaacgcc accgcggacg agtcggggct gtacgtgctc gtgatgaccc 1200

acaa 1204

<210>2

<211>1202

<212>DNA

<213> Pseudorabies virus strain lacking gE Gene (gE Gene Deletion Mutant of Peudorabies Virus)

<400>2

caccatcgca gaggaacaat aaaaaggtgg tgtttgcata attttgtggg tggcgtttta 60

tctccgtccg cgccgtttta aacctgggca cccccgcgag tctcgcacac accggggttg 120

agaccatgcg gccctttctg ctgcgcgccg cgcagctcct ggcgctgctg gccctggcgc 180

tctccaccga ggccccgagc ctctccgccg agacgacccc gggccccgtc accgaggtcc 240

cgagtccctc ggccgaggtc tgggacgacc tctccaccga ggccgacgac gatgacctca 300

acggcgacct cgacggcgac gaccgccgcg cgggcttcgg ctcggccctc gcatccctga 360

gggaggcgcc cccggcccat ctggtgaacg tgtccgaggg cgccaacttc accctcgacg 420

cgcgcggcga cggcgccgtg ctggccggga tctggacgtt cctgcccgtc cgcggctgcg 480

acgccgtgtc ggtgaccacg gtgtgcttcg agaccgcgtg ccacccggac ctggtgctgg 540

gccgcgcctg cgtccccgag gccccggaga tgggcatcgg cgactacctg ccgcccgagg 600

tgccgcggct ccggcgcgag ccgcccatcg tcaccccgga gcggtggtcg ccgcacctga 660

gcgtcctgcg ggccacgccc aacgacacgg gcctctacac gctgcacgac gcctcggggc 720

cgcgggccgt gttctttgtg gcggtgggcg accggccgcc cgcgccggcg gacccggtgg 780

gccccgcgcg ccacgagccc cgcttccacg cgctcggctt ccactcgcct cttctcgccc 840

ggggacacgt tcgacctgat gccgcgcgtg gtctcggaca tgggcgactc gcgcgagaac 900

tttaccgcca cgctggactg gtactacgcg cgcgcgcccc cgcggtgcct gctgtactac 960

gtgtacgagc cctgcatcta ccacccgcgc gcgcccgagt gcctgcgccc ggtggacccg 1020

gcgtgcagct tcacctcgcc ggcgcgcgcg cggctggtgg cgcgccgcgc gtacgcctcg 1080

tgcagcccgc tgctcgggga ccggtggctg accgcctgcc ccttcgacgc cttcggcgag 1140

gaggtgcaca cgaacgccac cgcggacgag tcggggctgt acgtgctcgt gatgacccac 1200

aa 1202

<210>3

<211>18

<212>DNA

<213> Artificial sequence (Artificial)

<400>3

ccctggcgct ctccaccg 18

<210>4

<211>18

<212>DNA

<213> Artificial sequence (Artificial)

<400>4

cggtggagag cgccaggg 18

<210>5

<211>18

<212>DNA

<213> Artificial sequence (Artificial)

<400>5

cctcaacggc gacctcga 18

<210>6

<211>18

<212>DNA

<213> Artificial sequence (Artificial)

<400>6

tcgaggtcgc cgttgagg 18

<210>7

<211>18

<212>DNA

<213> Artificial sequence (Artificial)

<400>7

cgttgaggtc atcgtcgt 18

<210>8

<211>18

<212>DNA

<213> Artificial sequence (Artificial)

<400>8

acgacgatga cctcaacg 18

<210>9

<211>18

<212>DNA

<213> Artificial sequence (Artificial)

<400>9

cggacacgtt caccagat 18

<210>10

<211>18

<212>DNA

<213> Artificial sequence (Artificial)

<400>10

atctggtgaa cgtgtccg 18

<210>11

<211>21

<212>DNA

<213> Artificial sequence (Artificial)

<400>11

caccatcgca gaggaacaat a 21

<210>12

<211>20

<212>DNA

<213> Artificial sequence (Artificial)

<400>12

ttgtgggtca tcacgagcac 20

Claims

1. A pseudorabies virus gene deletion strain is characterized in that the gene deletion strain is a pseudorabies virus gE gene deletion strain constructed by deleting a plurality of bases from a gE gene sequence of a wild-type pseudorabies virus PRV strain to cause reading frame shift mutation.

2. The pseudorabies virus gene deletion strain according to claim 1, wherein the gE gene sequence of the gene deletion strain is a nucleic acid sequence in which two bases of 829-830 AG are deleted from the gE gene sequence of the wild-type pseudorabies virus PRV strain shown in SEQ ID NO. 1.

3. An inactivated vaccine for porcine pseudorabies, characterized in that it is prepared by using the pseudorabies virus gene deletion strain of claim 1 or 2 as a seed virus.

4. A preparation method of a porcine pseudorabies inactivated vaccine is characterized by comprising the following steps:

(1) constructing a pseudorabies virus gE gene deletion strain;

(5) and (4) uniformly mixing the inactivated cell venom obtained in the step (4) with an adjuvant to obtain the porcine pseudorabies inactivated vaccine.

5. The preparation method according to claim 4, wherein the temperature of the suspension culture of the pig testicular cells in the step (2) is 36-37 ℃, the dissolved oxygen concentration is 50%, the stirring speed is 80-110r/min, and the pH is 7.2.

6. The preparation method according to claim 4, wherein the inactivating agent in the step (4) is 35-38 wt% of formaldehyde solution, the volume ratio of the cytotoxic liquid to the formaldehyde solution in the step (4) is 100: 0.1-0.2, the inactivating temperature is 35-37 ℃, and the inactivating time is 28-38 hours.

7. The method according to claim 4, wherein the adjuvant of step (5) is MERCKINADESDA 28 adjuvant.

8. A vaccine composition comprising the pseudorabies virus gene deletion strain of claim 1 or 2 in admixture with an adjuvant or a pharmaceutically acceptable carrier.

9. Use of the pseudorabies virus gene deletion strain according to claim 1 or 2 for the preparation of a vaccine for the prevention or treatment of pseudorabies.

10. A detection kit for distinguishing the vaccine immunity of the pseudorabies virus gene deletion strain according to claim 1 or 2 from the infection of the pseudorabies virus wild strain, which comprises a pseudorabies virus gE protein antibody.